Table 2.

Primers and Probes Used for Real-Time PCR Analysis of ACPL1 and GJA8, Primers Used for Semiquantitative PCR Analysis of GJA5, and Primers Used for Microsatellites (STR) Spanning the 1q21.1 Region

Gene/STRForward PrimerReverse PrimerAnnealing Temp °CProbe
ACPL1AGGCCGATGGCCAGTGTCGAGCCCCGTGTCGAA60TCGACCGCAGCCTG
GJA8CTGCCAAGCCTTTCAATGGTAGCCCCGGGACAA60AGGAGAAGATCAGCACAGG
GJA5CCAGACCTTCACAGAACATCCTTAGTGAGAAAGCATCAGTTCAG60
D1S2344TCATGGGACTCTCCATCAAAATACTCAGGAAATGGCCTA70→65
D1S2612GCTGTTCTTAGGGCTTTTCCAACTTGGGCTTCTCTGCTTC70→65
CTS03CAGAATAATACTCCATTGTGCATGTCATATTAATTCACAAGAGCCAAGATA60
CTS04GGCAGGATGGTGCTCTTTGACCAGCCTGGACACCA70→65
CTS05CAATATCAGGCCACTGCACTGGATAATCTAATGGTGGCATTCT70→65
CTS07CCATTTATCTTGTGTGCTACAAGTTTCTCAATTTGTAGATGACATGATCCTA67→62
CTS08AGAAATTCCTGCCACAACTGTAGGTAGTGAGGTATACTGGTGTTACAA67→62
CTS16GTCATGTTCTTCTGGTATATCTACAGATCTAAGCTCAATTTTACAAAAGCA62→57