Skip to main content
  • American Heart Association
  • Science Volunteer
  • Warning Signs
  • Advanced Search
  • Donate

  • Home
  • About this Journal
    • Editorial Board
    • Meet the Editors
    • Editorial Manifesto
    • Impact Factor
    • Journal History
    • General Statistics
  • All Issues
  • Subjects
    • All Subjects
    • Arrhythmia and Electrophysiology
    • Basic, Translational, and Clinical Research
    • Critical Care and Resuscitation
    • Epidemiology, Lifestyle, and Prevention
    • Genetics
    • Heart Failure and Cardiac Disease
    • Hypertension
    • Imaging and Diagnostic Testing
    • Intervention, Surgery, Transplantation
    • Quality and Outcomes
    • Stroke
    • Vascular Disease
  • Browse Features
    • Circulation Research Profiles
    • Trainees & Young Investigators
    • Research Around the World
    • News & Views
    • The NHLBI Page
    • Viewpoints
    • Compendia
    • Reviews
    • Recent Review Series
    • Profiles in Cardiovascular Science
    • Leaders in Cardiovascular Science
    • Commentaries on Cutting Edge Science
    • AHA/BCVS Scientific Statements
    • Abstract Supplements
    • Circulation Research Classics
    • In This Issue Archive
    • Anthology of Images
  • Resources
    • Online Submission/Peer Review
    • Why Submit to Circulation Research
    • Instructions for Authors
    • → Article Types
    • → Manuscript Preparation
    • → Submission Tips
    • → Journal Policies
    • Circulation Research Awards
    • Image Gallery
    • Council on Basic Cardiovascular Sciences
    • Customer Service & Ordering Info
    • International Users
  • AHA Journals
    • AHA Journals Home
    • Arteriosclerosis, Thrombosis, and Vascular Biology (ATVB)
    • Circulation
    • → Circ: Arrhythmia and Electrophysiology
    • → Circ: Genomic and Precision Medicine
    • → Circ: Cardiovascular Imaging
    • → Circ: Cardiovascular Interventions
    • → Circ: Cardiovascular Quality & Outcomes
    • → Circ: Heart Failure
    • Circulation Research
    • Hypertension
    • Stroke
    • Journal of the American Heart Association
  • Impact Factor 13.965
  • Facebook
  • Twitter

  • My alerts
  • Sign In
  • Join

  • Advanced search

Header Publisher Menu

  • American Heart Association
  • Science Volunteer
  • Warning Signs
  • Advanced Search
  • Donate

Circulation Research

  • My alerts
  • Sign In
  • Join

  • Impact Factor 13.965
  • Facebook
  • Twitter
  • Home
  • About this Journal
    • Editorial Board
    • Meet the Editors
    • Editorial Manifesto
    • Impact Factor
    • Journal History
    • General Statistics
  • All Issues
  • Subjects
    • All Subjects
    • Arrhythmia and Electrophysiology
    • Basic, Translational, and Clinical Research
    • Critical Care and Resuscitation
    • Epidemiology, Lifestyle, and Prevention
    • Genetics
    • Heart Failure and Cardiac Disease
    • Hypertension
    • Imaging and Diagnostic Testing
    • Intervention, Surgery, Transplantation
    • Quality and Outcomes
    • Stroke
    • Vascular Disease
  • Browse Features
    • Circulation Research Profiles
    • Trainees & Young Investigators
    • Research Around the World
    • News & Views
    • The NHLBI Page
    • Viewpoints
    • Compendia
    • Reviews
    • Recent Review Series
    • Profiles in Cardiovascular Science
    • Leaders in Cardiovascular Science
    • Commentaries on Cutting Edge Science
    • AHA/BCVS Scientific Statements
    • Abstract Supplements
    • Circulation Research Classics
    • In This Issue Archive
    • Anthology of Images
  • Resources
    • Online Submission/Peer Review
    • Why Submit to Circulation Research
    • Instructions for Authors
    • → Article Types
    • → Manuscript Preparation
    • → Submission Tips
    • → Journal Policies
    • Circulation Research Awards
    • Image Gallery
    • Council on Basic Cardiovascular Sciences
    • Customer Service & Ordering Info
    • International Users
  • AHA Journals
    • AHA Journals Home
    • Arteriosclerosis, Thrombosis, and Vascular Biology (ATVB)
    • Circulation
    • → Circ: Arrhythmia and Electrophysiology
    • → Circ: Genomic and Precision Medicine
    • → Circ: Cardiovascular Imaging
    • → Circ: Cardiovascular Interventions
    • → Circ: Cardiovascular Quality & Outcomes
    • → Circ: Heart Failure
    • Circulation Research
    • Hypertension
    • Stroke
    • Journal of the American Heart Association
Molecular Medicine

Induction of Glutathione Synthesis in Macrophages by Oxidized Low-Density Lipoproteins Is Mediated by Consensus Antioxidant Response Elements

Florian Bea, Francesca N. Hudson, Alan Chait, Terrance J. Kavanagh, Michael E. Rosenfeld
Download PDF
https://doi.org/10.1161/01.RES.0000059561.65545.16
Circulation Research. 2003;92:386-393
Originally published March 7, 2003
Florian Bea
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Francesca N. Hudson
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Alan Chait
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Terrance J. Kavanagh
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Michael E. Rosenfeld
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Tables
  • Info & Metrics

Jump to

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Tables
  • Info & Metrics
  • eLetters
Loading

Abstract

The uptake of oxidized low-density lipoproteins (oxLDL) by macrophages leading to conversion into foam cells is a seminal event in atherogenesis. Excessive accumulation of oxLDL can cause oxidative stress in foam cells leading to cell death and the progression and destabilization of atherosclerotic lesions. Oxidative stress induces a protective compensatory increase in the synthesis of the endogenous antioxidant glutathione (GSH). Glutamate-cysteine ligase (GCL) is the rate-limiting enzyme in GSH synthesis and is composed of a catalytic subunit (GCLC) and a modifier subunit (GCLM), which are products of separate genes. Treatment of RAW 264.7 mouse macrophages and mouse peritoneal macrophages with oxLDL (30 μg/mL) induces increased expression of both Gclc and Gclm in vitro. The increase in mRNA occurs in part via increased transcription as demonstrated with luciferase reporter constructs. The promoters for both GCLC and GCLM contain consensus antioxidant response elements (AREs). Electrophoretic mobility shift assays revealed induction of nuclear factor binding to these AREs after treatment of RAW 264.7 cells and mouse peritoneal macrophages with oxLDL. Nuclear factor binding to the AREs is diminished by a single base pair substitution in the core sequence. Site-directed mutagenesis of the AREs within the Gclc and Gclm promoters resulted in a decrease of oxLDL-induced luciferase activity. Supershift analyses revealed that oxLDL stimulates binding of the transcription factors Nrf1, Nrf2, and c-jun to the AREs. These data suggest that AREs play a direct role in mediating the induction of GSH synthesis by oxLDL and in protecting macrophages against oxidized lipid-induced oxidative stress.

  • arteriosclerosis
  • oxidized low-density lipoproteins
  • glutathione
  • macrophages
  • oxidative stress

The uptake of oxidized low-density lipoproteins (oxLDL) by macrophages and their conversion into foam cells is recognized as a seminal event in the development of atherosclerosis.1 The oxidation of LDL is thought to occur within the vascular wall and lead to a variety of proatherogenic responses such as activation of the endothelium and recruitment of inflammatory cells, impaired endothelium-dependent vascular relaxation, migration and proliferation of smooth muscle cells, promotion of procoagulant properties of vascular cells, and alteration of signaling pathways.2–4 Multiple cell types within the arterial wall contribute to the formation of oxLDL, although the exact mechanisms are not known. However, evidence suggests that mediators such as metal ions, lipoxygenases, cyclooxygenases, reactive nitrogen species, and products of myeloperoxidase may play a role.4,5

Foam cell formation and turnover play important roles in both the initiation and the progression and ultimate instability of advanced lesions. Excessive accumulation of lipids derived from oxLDL induces oxidative stress in foam cells and causes a compensatory increase in the synthesis of the endogenous antioxidant glutathione (GSH).6–10 GSH is an abundant intracellular thiol that serves to buffer changes in the cellular redox state and provides protection from reactive electrophiles or free radicals. Clinical studies have demonstrated a relationship between low serum GSH levels and coronary artery disease.11 In addition, apo E−/− mice with increased GSH levels exhibit reduced cell-mediated oxidation of LDL and reduced atherosclerotic lesion development.12 This protective effect of serum GSH is thought to occur by inhibiting extracellular LDL oxidation, whereas the intracellular GSH content of macrophages determines the response to the cytotoxic effects of oxidized lipids and other pro-oxidants.10,13 Furthermore, inhibition of GSH synthesis potentiates oxLDL toxicity in macrophages.10 This is of particular significance because the death of macrophages is a prominent feature of atherosclerotic lesions and likely contributes to plaque rupture.14

The rate-limiting enzyme in GSH synthesis is glutamate-cysteine ligase (GCL), a heterodimeric enzyme composed of a catalytic subunit GCLC and a modifier subunit GCLM, which are encoded by separate genes.15,16 The promoters of both GCL subunit genes contain consensus antioxidant response elements (AREs)17–19 that play essential roles in regulating the cellular responses to oxidative stress20 and mediate induction of both GCL subunits in several different cell types.17,21–23 The increase in GSH synthesis after treatment with oxLDL occurs via an increase in GCL activity and protein and increases in the expression of both subunits of GCL.6,9,24 However, the molecular mechanisms for this induction remain poorly understood. Thus, the present study was designed to investigate whether AREs in the Gcl subunit genes play a role in the increased Gcl expression that occurs in macrophages in response to treatment with oxLDL.

Materials and Methods

Chemicals and Reagents

LDL (density=1.019 to 1.063 g/mL) was prepared from the plasma of fasted, healthy male donors by sequential density gradient ultracentrifugation. This protocol involving human volunteers was approved by the University of Washington Human Subjects Review Committee. Native LDL (natLDL) was dialyzed overnight in PBS, filtered, and diluted to 300 μg protein/mL in PBS containing 25 μmol/L BHT. OxLDL was prepared by diluting to 300 μg/mL natLDL in PBS without BHT and followed by incubation with 5 μmol/L CuSO4 for 24 hours at 37°C. The oxidation reaction was stopped with addition of BHT (25 μmol/L final concentration), but the BHT in both the oxLDL and natLDL was removed by dialysis before addition to the cells and the lipoproteins were stored under nitrogen. The final preparations of oxLDL contained between 40 to 50 nmol/mg protein of thiobarbituric reactive substances (TBARS), as a measure of the extent of oxidation. Lipofectamine reagent was purchased from Gibco BRL (Gibco-BRL) and Trizol reagent was purchased from Ambion.

Tissue Culture

RAW 264.7 cells, a murine macrophage cell line (ATCC, Manassas, Va), were grown in DMEM (Gibco BRL) containing 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin at 37°C in a 95% O2/5% CO2 humidified environment. Mouse peritoneal macrophages (106 cells per animal on average) were obtained through peritoneal lavage with ice-cold PBS from C57BL/6J mice 4 days after intraperitoneal injection of thioglycolate (72 μg/mouse). The C57BL/6J mice were purchased from the Jackson Laboratories (Bar Harbor, Maine) and used according to a protocol approved by the University of Washington Institutional Animal Care and Use Committee. Cells were purified by adhesion to tissue culture dishes for 24 hours after harvesting prior to the experiments.

Real-Time Quantitative PCR

RAW 264.7 cells were treated with 30 μg/mL natLDL or oxLDL in DMEM plus 10% FBS, and total RNA was harvested from the cells at various time points using Trizol reagent, according to the manufacturer’s protocol. Gclc and Gclm mRNA message levels were obtained by quantitative real-time PCR of cDNA generated from 2 μg total RNA for each sample. Quantitative real-time PCR used a fluorogenic 5′ nuclease assay with primers and probes directed against the 3′-most intron/exon boundary of both the Gclc and Gclm genes. The sequences of the primers and probes are as follows (all sequences 5′ to 3′): Gclc sense primer, ATGTGGACACCCGATGCAGTATT; Gclc antisense primer, TGTCTTGCTTGTAGTCAGGATGGTTT; Gclc probe, CATTAGTTCTCCAGATGCTCTCTTCTTAA; Gclm sense primer, GCCACCAGATTTGACTGCCTTT; Gclm antisense primer, CAGGGATGCTTTCTTGAAGAGCTT; and Gclm probe, TGACTCACAATGACCCGAAAGAACTGCTCTC. Expression levels were derived from comparison with serial dilutions of a known reference standard and values are normalized to GAPDH.

Electrophoretic Mobility Shift Assays

Nuclear extracts were prepared by scraping RAW 264.7 cells in ice-cold cell lysis buffer (0.6% NP-40, 0.15 mol/L NaCl, 10 mmol/L Tris [pH 7.9], and 1 mmol/L EDTA with protease inhibitors) and incubating on ice for 5 minutes to lyse the cells. The nuclei were pelleted by centrifugation in a microfuge at 4°C at 1250g for 5 minutes before lysis on ice for 20 minutes in nuclear extraction buffer (10 mmol/L HEPES [pH 7.9], 0.1 mmol/L EGTA, 0.1 mmol/L EDTA, 1.5 mmol/L MgCl2, 420 mmol/L NaCl, and 25% glycerol with protease inhibitors). After pelleting nuclear debris (1250g, 5 minutes, 4°C), nuclear extracts were aliquoted and stored at −80°C until needed. Protein concentrations were determined using the Bradford assay. Gel shift assays were carried out using 5 to 10 μg of nuclear proteins and 32P-labeled oligonucleotide in the Gel Shift Assay System (Promega) according to the manufacturer’s protocol. Double-stranded oligonucleotides were prepared by boiling complementary strands in annealing buffer (20 mmol/L Tris, 1 mmol/L EDTA, and 50 mmol/L NaCl) for 10 minutes and slowly cooling to room temperature. For competition and antibody supershift assays, unlabeled oligonucleotides or rabbit polyclonal antibodies against Nrf1, Nrf2, c-jun, and c-fos (Santa Cruz Biotechnology) were added subsequent to the radiolabeled oligonucleotides. Gels were analyzed by phosphorimaging (Cyclone, Packard Instruments). The following oligonucleotide sequences (5′→3′) were used (boldface indicates the core consensus ARE sequences; underlining indicates the sites of mutation):

  • Gclc ARE3wt, CGGGCCGATGGTCACGTCGCC

  • Gclc ARE3m1, CGGGCCGATGGTCCCGTCGCC

  • Gclc ARE4wt, GCAGAGTGCTGAGTCACGGTGAG

  • Gclc ARE4m1, GCAGAGTGCTGAGTCCCGGTGAG

  • Gclm AREwt, CTGGAAGACAATGACTAAGCAGAAA

  • Gclm AREm1, CTGGAAGACAAGGACTAAGCAGAAA

  • Gclm AREm2, CTGGAAGACAATGACTAATTTGAAA

Reporter Constructs and Plasmids

The Gclc reporter constructs were prepared as follows: a 7-kb EcoRI/BamHI fragment containing exon 1 and ≈6.5-kb of Gclc promoter was initially subcloned into pBluescript (Stratagene). A 6.5-kb XhoI/NcoI fragment containing 6447 bp of Gclc promoter was then shuttled into pGL3 Basic to yield the full-length 6.5-kb Gclc luciferase reporter construct. Deletion constructs were generated by digesting the 6.5-kb Gclc reporter construct with SacI or KpnI followed by recircularization of the plasmid to yield reporter constructs containing 3869 bp (3.8-kb Gclc) and 1281 bp (1.3-kb Gclc) of Gclc promoter, respectively. Site-directed mutagenesis of the ARE sites in the Gclc promoter was carried out by Bio S&T (Bio S&T) and confirmed by DNA sequencing.

To prepare the Gclm luciferase reporter constructs, a 1292-bp NcoI fragment of the mouse Gclm promoter19 was inserted into the NcoI site of the luciferase reporter vector pGL3 (Promega). Reporter constructs containing mutations within the ARE (m1 and m2) were engineered by separately amplifying a −1685-bp F/MutR fragment and a MutF/GL2R fragment, overlapping fragments that contained the mutation of interest within the region of overlap. The full-length fragment was amplified by addition of −1685-bp F and GL2R primers to the reaction, and the product was blunt-end ligated into a shuttle vector. The 1292-bp NcoI/NcoI fragment containing the mutation was then excised and ligated into the NcoI site of the pGL3 vector. All amplifications were performed using Vent polymerase (New England Biolabs). The sequences of the mutagenesis primers were (5′→3′):

  • ARE m1F, GAGGTTTCTGCTTAGTCCTTGTCTTCCAGGAAA- CAGCTCC

  • ARE m1R, GGAGCTGTTTCCTGGAAGACAAGGACTAAGCAGA- AACCTC

  • ARE m2F, TTTCTCGGGTGAGGTTTCAAATTAGTCATTCTC- TTCCAGG

  • ARE m2R, CCTGGAAGACAATCAATGACTAATTTGAAACC- TCACCCGAGAAA

Reporter Assays

RAW 264.7 cells were seeded into 35-mm plates 24 hours before transfection at 3×105 cells/well. Cells were transfected using Lipofectamine reagent according to the manufacturer’s protocol. Briefly, cells were transfected with 1.5 μg DNA/well for 5 hours. All samples were cotransfected with a CMV-Renilla luciferase construct (Promega) to compensate for variances in transfection efficiencies. Twenty-four hours after beginning transfection the medium was changed to complete medium or medium containing 30 μg/mL natLDL or oxLDL. Cells were treated for 24 hours at which time they were harvested to obtain cell extracts for luciferase assays. Cells were harvested using passive lysis buffer (Promega) according to the manufacturer’s protocol. Luciferase assays were performed using the Dual Luciferase Reporter System (Promega) according to the manufacturer’s protocol and samples were measured in duplicate on a Lumat model 9507 luminometer (EG&G Berthold).

Statistical Analysis

All data are expressed as mean±SEM. Significant differences between means were determined by using the student’s two-tailed t test. All experiments were performed at least three times and representative results are shown.

Results

OxLDL Increases Gclc and Gclm mRNA Levels

To determine whether oxLDL induces an increase in Gcl subunit message levels, mouse RAW 264.7 cells were treated with 30 μg/mL natLDL or oxLDL in the tissue culture medium for up to 24 hours (Figure 1). We did not observe any toxicity using this concentration of LDL. Cellular RNA was harvested for real-time quantitative PCR determination of Gclc and Gclm mRNA levels. Note that RNA was collected from untreated control cells at each time point as Gclc and Gclm subunit message levels fluctuate with changing cellular confluence. We observed induction of both Gclc and Gclm steady-state mRNA levels in response to treatment with oxLDL with induction occurring as early as 3 hours and, for the modifier subunit, persisting for 24 hours (Figure 1). Peak induction for both subunit mRNAs occurred after 6 hours of treatment. In contrast to oxLDL, treatment with natLDL does not appreciably alter message levels for either subunit. Induction of Gclm message after oxLDL treatment is consistently more robust than that observed for Gclc, with a peak 16-fold induction of Gclm message versus 8-fold induction for Gclc message relative to untreated controls.

Figure1
  • Download figure
  • Open in new tab
  • Download powerpoint

Figure 1. Time course of Gclc and Gclm mRNA expression in RAW 264.7 cells after treatment with oxLDL or natLDL. Cells were treated for the indicated time points with 30 μg/mL of oxLDL or natLDL in tissue culture medium. Gclc (A) and Gclm (B) mRNA levels were determined by real-time RT-PCR. Values are normalized to GAPDH expression and are presented as mean±SEM.

OxLDL Induces Expression of Gclc and Gclm Reporter Constructs

An increase in the steady-state mRNA levels could be due to both increased de novo transcription and/or message stability. To determine whether the observed increases in Gclc and Gclm mRNA levels after oxLDL treatment are due to transcriptional upregulation, we transfected RAW 264.7 cells with luciferase reporter constructs containing 6.5 kb of the mouse Gclc or 1.3 kb of the mouse Gclm proximal promoter regions. Transiently transfected RAW 264.7 cells were treated with 30 μg/mL natLDL or oxLDL for 24 hours at which time cell extracts were harvested and assayed for luciferase activity. This time point demonstrated maximum luciferase activity as evaluated through time course experiments. OxLDL increased luciferase reporter expression from both the Gclc (Figure 2A) and Gclm (Figure 2B) promoters with a 1.8-fold increase in luciferase activity for the Gclc construct and a 2.5-fold increase observed for the Gclm construct. The activity of the internal standard, Renilla luciferase, was not affected by treatment with oxLDL (data not shown). These data provide evidence for increased transcription of the Gcl subunits as part of a coordinated response to upregulate GSH production upon exposure to oxLDL in macrophages.

Figure2
  • Download figure
  • Open in new tab
  • Download powerpoint

Figure 2. Induction of Gclc and Gclm reporter constructs in RAW 264.7 cells after treatment with oxLDL or natLDL. RAW 264.7 cells were transiently transfected with 6.5-, 3.8-, or 1.3-kb Gclc/pGL3 constructs (A) or 1.3-kb Gclm/pGL3 construct (B) for 24 hours and cotransfected with a pRL-CMV construct to normalize for transfection efficiency. After transfection, cells were treated with 30 μg/mL natLDL or oxLDL for 24 hours. Luciferase activity in cell lysates was determined. Values are normalized to Renilla luciferase activity and are presented as mean±SEM. *P<0.05 vs untreated control.

As oxLDL triggers an oxidative stress response, we postulated that AREs present within the Gcl subunit promoters mediate the observed increase in transcription after oxLDL treatment. The GCLC promoter contains several putative AREs, of which two distal AREs have been characterized as functional for the human GCLC promoter in response to β-naphthoflavone.17 Transfection of reporter constructs containing truncated fragments of the mouse Gclc promoter into RAW 264.7 cells and subsequent treatment with oxLDL or natLDL reveal that promoter elements necessary for induction by oxLDL lie between −3.8 kb and −6.5 kb relative to the translation start codon (Figure 2A). This region of mouse Gclc promoter contains two putative AREs bearing semblance to the human ARE3 and ARE4, which mediate induction of human GCLC in response to oxidative stress; hence, we refer to these putative AREs as mouse ARE3 and ARE4. In the Gclm promoter, a single ARE located at −500 relative to the translation start codon has been described for both the mouse and human Gclm subunit and is contained within the 1.3-kb promoter fragment of the mouse Gclm reporter construct.

OxLDL Induces Binding of Nuclear Factors to Gclc and Gclm AREs

We conducted electrophoretic mobility shift assays (EMSAs) to determine whether oxLDL induces binding of nuclear factors to AREs located in the mouse Gclc and Gclm subunit promoters. RAW 264.7 cells were treated with oxLDL or natLDL for up to 12 hours during which time cells were harvested at various time points for the preparation of nuclear extracts. Nuclear proteins (5 to 10 μg) were incubated at room temperature for 20 minutes with a radiolabeled double-stranded oligonucleotide corresponding to mouse Gclc ARE3, Gclc ARE4, or Gclm ARE, and the resulting protein:DNA complexes were separated by polyacrylamide gel electrophoresis. As demonstrated in Figure 3, oxLDL induced binding of nuclear factors to both the Gclc ARE3 and ARE4 (Figure 3A) as well as the Gclm ARE (Figure 3B). Addition of excess unlabeled oligonucleotide to the binding reaction successfully competed away nuclear factors, indicative of binding specificity. The time course of induction is similar for all AREs examined, with increased nuclear factor binding occurring within 1 hour after treatment and returning to basal levels by 12 hours. However, for the two Gclc AREs, we observe different patterns of nuclear factor binding, particularly in the magnitude of the changes. The induction is much greater at ARE4 compared with ARE3, whereas the basal level of nuclear factor binding is greater at ARE3. Interestingly, natLDL also strongly induces binding of nuclear factors to these AREs, but the observed induction lags behind the induction after oxLDL treatment. This is perhaps due to oxidation of natLDL by the macrophages in the tissue culture dish. Gclm ARE also exhibits constitutive binding of nuclear factors, but induction is clear by 1 hour of treatment with oxLDL. In contrast to the catalytic subunit AREs, natLDL only slightly induced binding of nuclear factors to the modifier subunit ARE and, similar to the Gclc AREs, the binding is delayed (Figure 3B).

Figure3
  • Download figure
  • Open in new tab
  • Download powerpoint

Figure 3. Induction by oxLDL of nuclear protein-DNA binding to consensus oligonucleotides of the AREs in the Gclc and Gclm promoters. RAW 264.7 cells were treated with 30 μg/mL natLDL or oxLDL for the indicated time period and nuclear proteins were harvested. Protein complexes for the ARE3 and ARE4 of the Gclc promoter (A) as well as the ARE of the Gclm promoter (B) were analyzed by EMSA. Competition studies (lane 3 in all shift assays shown) were performed using 100-fold excess of unlabeled oligonucleotide. Binding activity to the Gclc promoter AREs in the no-treatment controls (data not shown) was similar to the binding activity observed at 12 hours after treatment with oxLDL (panel A, lane 8 for both ARE3 and ARE4).

We also conducted gel shift experiments using oligonucleotides for each of three AREs, which contained single base pair mutations within the ARE consensus sequence, and observed that mutations in the AREs strongly inhibited binding of nuclear factors. As a representative example, the reduced binding of nuclear proteins to the mutated ARE4 is presented in Figure 4, lane 7. Furthermore, addition of anti-Nrf1, anti-Nrf2, or anti-c-jun antibodies to the binding reaction resulted in displacement of the protein:DNA binding complex indicating involvement of the Nrf1, Nrf2, and c-jun transcription factors at this site. In contrast, addition of an anti-c-fos antibody had only minor effects. These transcription factors are known to bind to the AREs and influence transcription of certain ARE-containing genes. The displacement by Nrf1, Nrf2, and c-jun could be observed for ARE4 as demonstrated in Figure 4, lanes 3 through 6, and similar results were also observed for ARE3 and Gclm ARE (data not shown).

Figure4
  • Download figure
  • Open in new tab
  • Download powerpoint

Figure 4. Identification of transcription factors that bind to the Gclc promoter ARE4 and inhibition of nuclear protein-DNA binding using mutated oligonucleotides of the ARE4. RAW 264.7 cells were treated with 30 μg/mL oxLDL for 2 hours and nuclear proteins were harvested. Protein complexes for the ARE4 of the Gclc promoter were analyzed by EMSA. Lane 2, Cells were treated for indicated time; lanes 3 through 6, addition of indicated antibody; lane 7, radiolabeled oligonucleotides for the mutant ARE4; and lane 8, addition of 100-fold excess unlabeled ARE4.

Mutations in Gclc and Gclm Promoter AREs Attenuate Induction by OxLDL

We transfected RAW 264.7 cells with reporter constructs containing targeted mutations within the AREs of the Gclc and Gclm promoters to assess the functional significance of the AREs in induction of these genes in response to oxLDL. Cells were transiently transfected with a luciferase reporter construct containing 6.5 kb of the Gclc promoter with mutations in either ARE3 or ARE4 or both, and luciferase activities were measured in cell extracts obtained after 24 hours of treatment with oxLDL. The introduced mutation targets the core TGAC sequence of these AREs and contains a T>G single base pair transversion. This single base pair mutation in ARE3 diminished constitutive expression of the luciferase reporter but had no effect on induction by oxLDL (Figure 5A). In contrast, the same mutation in ARE4 affected both constitutive and oxLDL-induced expression of the luciferase reporter. Mutation of both AREs resulted in a luciferase expression pattern similar to that observed for the ARE4 mutation alone, suggesting that both ARE3 and ARE4 coordinate to influence constitutive expression, whereas ARE4 predominates in the induction response to oxLDL.

Figure5
  • Download figure
  • Open in new tab
  • Download powerpoint

Figure 5. Functional analysis of the AREs in the Gclc and Gclm promoters in RAW 264.7 cells treated with oxLDL. RAW 264.7 cells were transfected with wild-type or mutated Gclc/pGL3 constructs (A) and wild-type or mutated 1.3-kb Gclm/pGL3 construct (B). Mutations of the reporter constructs were generated as described in Materials and Methods. After transfection for 24 hours, cells were treated with 30 μg/mL oxLDL for 24 hours. Luciferase activity in cell lysates was determined. Values are normalized to Renilla luciferase activity and are presented as mean±SEM. *P<0.05 vs wild-type treated with oxLDL; †P<0.05 vs untreated wild-type; and ‡P<0.05 vs control of the same construct.

For the Gclm reporter construct, we separately introduced two mutations into the ARE of the luciferase reporter construct containing 1.3 kb of the mouse Gclm promoter. The mut1 mutation is the same mutation introduced into the AREs of the Gclc promoter as described above, and the second mutation (mut2) targets the GCA box just downstream and contains a GCA>TTT triple base pair mutation. These mutated ARE constructs were transiently transfected into RAW 264.7 cells and their ability to drive oxLDL-inducible expression was compared with the wild-type ARE luciferase construct. Figure 5B reveals that both mutations in the Gclm ARE inhibit induction of luciferase expression on oxLDL treatment, with no effect on basal luciferase expression. These data, coupled with the EMSA results, support a functional role for the AREs in the observed induction of Gclc and Gclm expression by oxLDL.

Induction of Gcl mRNA and Binding of Nuclear Proteins to the AREs Is Also Observed in Mouse Peritoneal Macrophages

The experiments described above were all conducted in RAW 264.7 cells, an immortalized macrophage cell line. To test whether oxLDL also induces expression of the Gcl subunits and binding of nuclear proteins to the AREs in primary cells, we conducted real-time quantitative PCR and gel shift experiments with mouse peritoneal macrophages. As indicated in Figure 6A, oxLDL but not natLDL induced expression of Gclc and Gclm after 6 hours of treatment. Furthermore, oxLDL induced the binding of nuclear proteins to all AREs. As already shown for the RAW 264.7 cells, the transcription factors Nrf1, Nrf2, and c-jun were identified in the primary macrophages. As a representative example, ARE4 is shown in Figure 6B. However, functional analyses of the AREs could not be determined, because peritoneal macrophages could only be transfected with the constructs used previously for the RAW 264.7 cells at very low transfection efficiency (data not shown).

Figure6
  • Download figure
  • Open in new tab
  • Download powerpoint

Figure 6. Gclm mRNA expression and protein-DNA binding to the Gclm promoter ARE4 in mouse peritoneal macrophages treated with oxLDL. A, Mouse peritoneal macrophages were treated with 30 μg/mL oxLDL or natLDL for 6 hours. Gclc and Gclm mRNA levels were determined by real-time RT-PCR. Values are normalized to GAPDH expression and presented as mean±SEM. B, Mouse peritoneal macrophages were treated with 30 μg/mL oxLDL for 2 hours and nuclear proteins were harvested. Protein complexes for the ARE4 of the Gclc promoter were analyzed by EMSA. Lane 2, Cells treated for indicated time; lanes 3 through 6, addition of indicated antibody; lane 7, radiolabeled oligonucleotides for the mutant ARE4; and lane 8, addition of 100-fold excess of unlabeled ARE4.

Discussion

Macrophage cell death in response to oxidative stress likely plays a fundamental role in the progression and destabilization of atherosclerotic lesions. Clinical and experimental studies suggest that GSH is a critical component of the endogenous defense mechanisms in macrophages against oxidative stress. Darley-Usmar et al8 first demonstrated that treatment of THP-1 cells or mouse peritoneal macrophages with oxLDL increases cellular GSH levels. This increase in GSH correlates with increased levels of GCL protein and activity.6,9 However, it is not known whether the observed increases in GCL protein and activity reflect posttranslational modifications of the GCL protein or instead result from a more comprehensive and sustained defense strategy involving coordinated induction of the GCL subunit genes. In the present study, quantitative real-time PCR analysis of Gclc and Gclm expression demonstrates a clear induction of both subunits in response to oxLDL treatment. Interestingly, the induction of the modifier subunit was considerably more robust than that observed for the catalytic subunit. A survey of constitutive expression levels of both the catalytic and modifier subunits reveals that their expression levels are highly variable among tissues and do not correlate with one another.25 Thus, it may be that in certain tissues, the abundance of the modifier subunit is a limiting factor in GSH synthesis. This is particularly notable in light of a recent study describing an increased rate of myocardial infarction in patients with a polymorphism in the 5′-flanking region of the GCLM subunit.26 Patients with the GCLM promoter polymorphism had decreased plasma GSH levels, and cultured monocytes/macrophages from these individuals exhibited impaired induction of GCLM mRNA in response to treatment with pro-oxidants. It is currently unknown whether similar functional polymorphisms occur in the mouse genes. Nevertheless, these data lend support to the hypothesis that GCL subunit expression is an important determinant of GSH synthesis and that deficiencies of GSH may compromise macrophage defense mechanisms.

The observed increase in Gcl subunit message levels in response to oxLDL is due in part to increased de novo gene transcription as evidenced by increased luciferase activity from Gclc and Gclm promoter reporter constructs. For the Gclc subunit, truncated reporter constructs reveal that important regulatory elements are located between −3.8 kb and −6.5 kb relative to the translation start codon. This promoter region contains two AREs that are structurally similar to those described for the human GCLC promoter, ARE3 and ARE4.17 Although both ARE3 and ARE4 of the human GCLC gene were determined to mediate basal expression, ARE4 was the site identified to be essential for induction following β-naphthoflavone treatment.17 We narrowed our focus to these two homologous sites in the mouse Gclc promoter as likely candidates for mediating the oxidative stress response induced by oxLDL.

EMSAs of nuclear factor binding to the putative AREs in the mouse Gclc promoter demonstrate that oxLDL triggers an increase in nuclear protein binding at these sites. The increase in binding was much more dramatic for the ARE4 site in comparison to ARE3; however, constitutive binding was greater for ARE3 (data not shown). Functional studies using luciferase reporter constructs reveal a similar pattern, with ARE3 being a constitutive regulator and ARE4 responsible for both constitutive and inducible Gclc induction. These data are consistent with the findings derived from human GCLC constructs.17

For the Gclm subunit, we limited our investigation to the single characterized ARE in the proximal promoter region. Our transfection studies indicate that regulatory elements mediating induction in response to oxLDL lie within the first 1.3 kb of the Gclm proximal promoter. This region is highly conserved between mouse and human, and the role of this ARE in mediating induction of human GCLM expression in response to pro-oxidants has been well described.21 EMSA analyses reveal that RAW 264.7 cell nuclear factors recognize and bind to this ARE in response to oxLDL. Mutation of this ARE inhibits both binding of nuclear proteins and induction of luciferase activity, thus establishing a functional role for this ARE. However, mutation of the Gclm ARE binding site does not completely attenuate induction of reporter activity in response to oxLDL, indicating that other regulatory elements might be involved as well. We also observed induced binding to consensus AP-1 oligonucleotides in RAW 264.7 cells treated with oxLDL (data not shown). Binding of nuclear factors to canonical AP-1 sites has been reported in endothelial cells exposed to oxLDL.24

EMSAs implicate the transcription factors Nrf1, Nrf2, and c-jun as nuclear proteins binding to the Gclc and Gclm AREs in response to treatment with oxLDL. These transcription factors have been characterized as important regulators of ARE-driven gene expression. This was first reported by Venugopal et al,27 who demonstrated that overexpression of Nrf1 and Nrf2 in HepG2 cells potentiates induction of NAD(P)H:quinone oxidoreductase 1 (NQO1) and ARE-mediated expression in response to xenobiotics and antioxidants. Furthermore, transient overexpression of wild-type Nrf2 in HepG2 cells results in an increased activity of GCLC and GCLM promoter/reporter constructs.18 A role for the transcription factor c-jun has also been described for the induction of human GCLC ARE-mediated expression.28

Although it is clear that oxLDL is a potent inducer of the expression of both the Gclc and Gclm subunits, it is not yet clear exactly which components of oxLDL are responsible for the observed activity. Copper oxidation of LDL results in formation of a large number of oxidation products derived from polyunsaturated fatty acids, phospholipids, and cholesterol, all of which could potentially be responsible for inducing Gcl subunit expression. A comprehensive analysis of the exact components responsible for inducing Gcl subunit expression awaits future studies.

In summary, we report the induction of Gcl subunit mRNAs by oxLDL in mouse RAW 264.7 cells and peritoneal macrophages. EMSAs and transfection studies with Gclc and Gclm reporter constructs demonstrate that the observed induction involves AREs present within the Gclc and Gclm promoters. These data now provide a mechanistic link between oxLDL and the synthesis of GSH and could lead to potential therapies for oxidative stress-induced macrophage cell death and atherosclerotic plaque rupture.

Acknowledgments

This study was supported by NIH grants HL58954, AG00057, ES04696, and ES00733. We would like to thank Marc T. Caldwell and Monica I. Shelley for expert technical assistance.

Footnotes

  • ↵*Both authors contributed equally to this study.

  • Presented in part at the 74th Scientific Sessions of the American Heart Association, Anaheim, Calif, November 11–14, 2001, and published in abstract form (Circulation. 2001;104[suppl II]:II-230).

  • Original received November 13, 2002; revision received January 22, 2003; accepted January 23, 2003.

References

  1. ↵
    Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993; 362: 801–809.
    OpenUrlCrossRefPubMed
  2. ↵
    Escargueil-Blanc I, Salvayre R, Vacaresse N, Jurgens G, Darblade B, Arnal JF, Parthasarathy S, Negre-Salvayre A. Mildly oxidized LDL induces activation of platelet-derived growth factor β-receptor pathway. Circulation. 2001; 104: 1814–1821.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    Nagy L, Tontonoz P, Alvarez JG, Chen H, Evans RM. Oxidized LDL regulates macrophage gene expression through ligand activation of PPARγ. Cell. 1998; 93: 229–240.
    OpenUrlCrossRefPubMed
  4. ↵
    Glass CK, Witztum JL. Atherosclerosis: the road ahead. Cell. 2001; 104: 503–516.
    OpenUrlCrossRefPubMed
  5. ↵
    Heinecke JW. Oxidants and antioxidants in the pathogenesis of atherosclerosis: implications for the oxidized low density lipoprotein hypothesis. Atherosclerosis. 1998; 141: 1–15.
    OpenUrlPubMed
  6. ↵
    Shen L, Sevanian A. OxLDL induces macrophage γ-GCS-HS protein expression: a role for oxLDL-associated lipid hydroperoxide in GSH synthesis. J Lipid Res. 2001; 42: 813–823.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Kalyanaraman B, Karoui H, Singh RJ, Felix CC. Detection of thiyl radical adducts formed during hydroxyl radical- and peroxynitrite-mediated oxidation of thiols-a high resolution ESR spin-trapping study at Q-band (35 GHz). Anal Biochem. 1996; 241: 75–81.
    OpenUrlCrossRefPubMed
  8. ↵
    Darley-Usmar VM, Severn A, O’Leary VJ, Rogers M. Treatment of macrophages with oxidized low-density lipoprotein increases their intracellular glutathione content. Biochem J. 1991; 278: 429–434.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Moellering DR, Levonen AL, Go YM, Patel RP, Dickinson DA, Forman HJ, Darley-Usmar VM. Induction of glutathione synthesis by oxidized low-density lipoprotein and 1-palmitoyl-2-arachidonyl phosphatidylcholine: protection against quinone-mediated oxidative stress. Biochem J. 2002; 362: 51–59.
    OpenUrlCrossRefPubMed
  10. ↵
    Gotoh N, Graham A, Nikl E, Darley-Usmar VM. Inhibition of glutathione synthesis increases the toxicity of oxidized low-density lipoprotein to human monocytes and macrophages. Biochem J. 1993; 296: 151–154.
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Morrison JA, Jacobsen DW, Sprecher DL, Robinson K, Khoury P, Daniels SR. Serum glutathione in adolescent males predicts parental coronary heart disease. Circulation. 1999; 100: 2244–2247.
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Rosenblat M, Coleman R, Aviram M. Increased macrophage glutathione content reduces cell-mediated oxidation of LDL and atherosclerosis in apolipoprotein E-deficient mice. Atherosclerosis. 2002; 163: 17–28.
    OpenUrlCrossRefPubMed
  13. ↵
    Kuzuya M, Naito M, Funaki C, Hayashi T, Asai K, Kuzuya F. Protective role of intracellular glutathione against oxidized low density lipoprotein in cultured endothelial cells. Biochem Biophys Res Commun. 1989; 163: 1466–1472.
    OpenUrlCrossRefPubMed
  14. ↵
    Yao PM, Tabas I. Free cholesterol loading of macrophages is associated with widespread mitochondrial dysfunction and activation of the mitochondrial apoptosis pathway. J Biol Chem. 2001; 276: 42468–42476.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Gipp JJ, Mulcahy RT. Structure of the human glutamate-l-cysteine ligase catalytic (GLCLC) subunit gene. Cytogenet Cell Genet. 2000; 88: 130–132.
    OpenUrlCrossRefPubMed
  16. ↵
    Tsuchiya K, Mulcahy RT, Reid LL, Disteche CM, Kavanagh TJ. Mapping of the glutamate-cysteine ligase catalytic subunit gene (GLCLC) to human chromosome 6p12 and mouse chromosome 9D-E and of the regulatory subunit gene (GLCLR) to human chromosome 1p21-p22 and mouse chromosome 3H1-3. Genomics. 1995; 30: 630–632.
    OpenUrlCrossRefPubMed
  17. ↵
    Mulcahy RT, Wartman MA, Bailey HH, Gipp JJ. Constitutive and β-naphthoflavone-induced expression of the human γ-glutamylcysteine synthetase heavy subunit gene is regulated by a distal antioxidant response element/TRE sequence. J Biol Chem. 1997; 272: 7445–7454.
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Wild AC, Moinova HR, Mulcahy RT. Regulation of γ-glutamylcysteine synthetase subunit gene expression by the transcription factor Nrf2. J Biol Chem. 1999; 274: 33627–33636.
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Hudson FN, Kavanagh TJ. Cloning and characterization of the proximal promoter region of the mouse glutamate-l-cysteine ligase regulatory subunit gene. Biochim Biophys Acta. 2000; 1492: 447–451.
    OpenUrlPubMed
  20. ↵
    Wasserman WW, Fahl WE. Functional antioxidant responsive elements. Proc Natl Acad Sci U S A. 1997; 94: 5361–5366.
    OpenUrlAbstract/FREE Full Text
  21. ↵
    Moinova HR, Mulcahy RT. An electrophile responsive element (EpRE) regulates β-naphthoflavone induction of the human γ-glutamylcysteine synthetase regulatory subunit gene: constitutive expression is mediated by an adjacent AP-1 site. J Biol Chem. 1998; 273: 14683–14689.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    Ng D, Kokot N, Hiura T, Faris M, Saxon A, Nel A. Macrophage activation by polycyclic aromatic hydrocarbons: evidence for the involvement of stress-activated protein kinases, activator protein-1, and antioxidant response elements. J Immunol. 1998; 161: 942–951.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    Miller KP, Chen YH, Hastings VL, Bral CM, Ramos KS. Profiles of antioxidant/electrophile response element (ARE/EpRE) nuclear protein binding and c-Ha-ras transactivation in vascular smooth muscle cells treated with oxidative metabolites of benzo[a]pyrene. Biochem Pharmacol. 2000; 60: 1285–1296.
    OpenUrlCrossRefPubMed
  24. ↵
    Cho S, Hazama M, Urata Y, Goto S, Horiuchi S, Sumikawa K, Kondo T. Protective role of glutathione synthesis in response to oxidized low density lipoprotein in human vascular endothelial cells. Free Radic Biol Med. 1999; 26: 589–602.
    OpenUrlCrossRefPubMed
  25. ↵
    Gipp JJ, Bailey HH, Mulcahy RT. Cloning and sequencing of the cDNA for the light subunit of human liver γ-glutamylcysteine synthetase and relative mRNA levels for heavy and light subunits in human normal tissues. Biochem Biophys Res Commun. 1995; 206: 584–589.
    OpenUrlCrossRefPubMed
  26. ↵
    Nakamura S, Kugiyama K, Sugiyama S, Miyamoto S, Koide S, Fukushima H, Honda O, Yoshimura M, Ogawa H. Polymorphism in the 5′-flanking region of human glutamate-cysteine ligase modifier subunit gene is associated with myocardial infarction. Circulation. 2002; 105: 2968–2973.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Venugopal R, Jaiswal AK. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductase1 gene. Proc Natl Acad Sci U S A. 1996; 93: 14960–14965.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Jeyapaul J, Jaiswal AK. Nrf2 and c-Jun regulation of antioxidant response element (ARE)-mediated expression and induction of γ-glutamylcysteine synthetase heavy subunit gene. Biochem Pharmacol. 2000; 59: 1433–1439.
    OpenUrlCrossRefPubMed
View Abstract
Back to top
Previous ArticleNext Article

This Issue

Circulation Research
March 7, 2003, Volume 92, Issue 4
  • Table of Contents
Previous ArticleNext Article

Jump to

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Tables
  • Info & Metrics

Article Tools

  • Print
  • Citation Tools
    Induction of Glutathione Synthesis in Macrophages by Oxidized Low-Density Lipoproteins Is Mediated by Consensus Antioxidant Response Elements
    Florian Bea, Francesca N. Hudson, Alan Chait, Terrance J. Kavanagh and Michael E. Rosenfeld
    Circulation Research. 2003;92:386-393, originally published March 7, 2003
    https://doi.org/10.1161/01.RES.0000059561.65545.16

    Citation Manager Formats

    • BibTeX
    • Bookends
    • EasyBib
    • EndNote (tagged)
    • EndNote 8 (xml)
    • Medlars
    • Mendeley
    • Papers
    • RefWorks Tagged
    • Ref Manager
    • RIS
    • Zotero
  •  Download Powerpoint
  • Article Alerts
    Log in to Email Alerts with your email address.
  • Save to my folders

Share this Article

  • Email

    Thank you for your interest in spreading the word on Circulation Research.

    NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

    Enter multiple addresses on separate lines or separate them with commas.
    Induction of Glutathione Synthesis in Macrophages by Oxidized Low-Density Lipoproteins Is Mediated by Consensus Antioxidant Response Elements
    (Your Name) has sent you a message from Circulation Research
    (Your Name) thought you would like to see the Circulation Research web site.
  • Share on Social Media
    Induction of Glutathione Synthesis in Macrophages by Oxidized Low-Density Lipoproteins Is Mediated by Consensus Antioxidant Response Elements
    Florian Bea, Francesca N. Hudson, Alan Chait, Terrance J. Kavanagh and Michael E. Rosenfeld
    Circulation Research. 2003;92:386-393, originally published March 7, 2003
    https://doi.org/10.1161/01.RES.0000059561.65545.16
    del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Related Articles

Cited By...

Subjects

  • Basic, Translational, and Clinical Research
    • Pathophysiology
    • Metabolism
  • Genetics
    • Gene Expression & Regulation

Circulation Research

  • About Circulation Research
  • Editorial Board
  • Instructions for Authors
  • Abstract Supplements
  • AHA Statements and Guidelines
  • Permissions
  • Reprints
  • Email Alerts
  • Open Access Information
  • AHA Journals RSS
  • AHA Newsroom

Editorial Office Address:
3355 Keswick Rd
Main Bldg 103
Baltimore, MD 21211
CircRes@circresearch.org

Information for:
  • Advertisers
  • Subscribers
  • Subscriber Help
  • Institutions / Librarians
  • Institutional Subscriptions FAQ
  • International Users
American Heart Association Learn and Live
National Center
7272 Greenville Ave.
Dallas, TX 75231

Customer Service

  • 1-800-AHA-USA-1
  • 1-800-242-8721
  • Local Info
  • Contact Us

About Us

Our mission is to build healthier lives, free of cardiovascular diseases and stroke. That single purpose drives all we do. The need for our work is beyond question. Find Out More about the American Heart Association

  • Careers
  • SHOP
  • Latest Heart and Stroke News
  • AHA/ASA Media Newsroom

Our Sites

  • American Heart Association
  • American Stroke Association
  • For Professionals
  • More Sites

Take Action

  • Advocate
  • Donate
  • Planned Giving
  • Volunteer

Online Communities

  • AFib Support
  • Garden Community
  • Patient Support Network
  • Professional Online Network

Follow Us:

  • Follow Circulation on Twitter
  • Visit Circulation on Facebook
  • Follow Circulation on Google Plus
  • Follow Circulation on Instagram
  • Follow Circulation on Pinterest
  • Follow Circulation on YouTube
  • Rss Feeds
  • Privacy Policy
  • Copyright
  • Ethics Policy
  • Conflict of Interest Policy
  • Linking Policy
  • Diversity
  • Careers

©2018 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. The American Heart Association is a qualified 501(c)(3) tax-exempt organization.
*Red Dress™ DHHS, Go Red™ AHA; National Wear Red Day ® is a registered trademark.

  • PUTTING PATIENTS FIRST National Health Council Standards of Excellence Certification Program
  • BBB Accredited Charity
  • Comodo Secured