This Article Full Text Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Palmer, B. R. Articles by Nakayama, T. Search for Related Content PubMed PubMed Citation Articles by Palmer, B. R. Articles by Nakayama, T.

(Circulation Research. 2004;94:e86.)
© 2004 American Heart Association, Inc.

Letters to the Editor

Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand

Barry R. Palmer, Chris M. Frampton, A. Mark Richards, Vicky A. Cameron

Christchurch Cardioendocrine Research Group, Department of Medicine, Christchurch School of Medicine, and Health Sciences, Christchurch, New Zealand, barry.palmer@chmeds.ac.nz

Tomohiro Nakayama

Division of Receptor Biology, Advanced Medical Research Center, Nihon University School of Medicine, Tokyo, Japan

An extract of the first 250 words of the full text is provided, because this article has no abstract.

To the Editor:

Nakayama et al¹ have described an interesting polymorphism in the NPR-A gene in a Japanese population. An 8-nucleotide deletion in the 5' untranslated region (UTR) of the gene was found to be associated with essential hypertension and left ventricular hypertrophy in a study of 200 hypertensive (HT) and 200 normotensive (NT) subjects. The polymorphism occurred at a frequency of 4% in the HT patients and in a single NT subject (0.5%) who was subsequently found to have left ventricular hypertrophy. Carriers of the functional deletion (D) allele had higher plasma BNP levels, a strong marker of cardiac stress, than those with the wild-type allele. Expression of NPR-A from the D allele was reduced compared with the wild-type allele and it is suggested that the deletion interferes with binding of regulatory factors to the 5' UTR of the gene.¹

We screened 498 patients from the Christchurch Post-Myocardial Infarction (PMI) Study^2–4 who had acute myocardial infarction for the NPR-A D allele. DNA samples were amplified using the polymerase chain reaction primers hNPR-Af 5'acgcgcctgatgcctgggac3' and hNPR-Ar 5'cagtaccacggctaccgtcaggtt3' and the wild-type (I) and D amplimers (216 and 208 bp, respectively) were resolved on 3% agarose, 0.5 x TBE gels and visualized using ethidium bromide and a Bio-Rad Fluor-S imaging system (Hercules, Calif). Patient DNA samples with (n=3) and without (n=3) the functional deletion from the Japanese study were used as controls.¹ The New Zealand patients were 75% male, with a mean age of 62.4 (±0.5) years, 15.0% . . . [Full Text of this Article]

This article has been cited by other articles:

				C. Vassalle and M. G. Andreassi Genetic Polymorphisms of the Natriuretic Peptide System in the Pathogenesis of Cardiovascular Disease: What Lies on the Horizon? Clin. Chem., May 1, 2009; 55(5): 878 - 887. [Abstract] [Full Text] [PDF]