A more recent version of this article appeared on September 14, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 89/6/534    most recent hh1801.097239v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Karas, R. H. Articles by Mendelsohn, M. E. Search for Related Content PubMed Articles by Karas, R. H. Articles by Mendelsohn, M. E. Related Collections Gene expression Genetically altered mice Smooth muscle proliferation and differentiation Receptor pharmacology Other Vascular biology

© 2001 American Heart Association, Inc.

Article

Effects of Estrogen on the Vascular Injury Response in Estrogen Receptor ,ß (Double) Knockout Mice

Richard H. Karas, Henny Schulten, Gary Pare, Mark J. Aronovitz, Claes Ohlsson, Jan-Ake Gustafsson Michael E. Mendelsohn

From the Molecular Cardiology Research Institute, Department of Medicine (R.H.K., H.S., G.P., M.J.A., M.E.M.), and Division of Cardiology, New England Medical Center Hospitals and Tufts University School of Medicine, Boston, Mass; Department of Internal Medicine (C.O.), Sahlgrenska University Hospital, Gothenburg, Sweden; and Department of Medical Nutrition (J.-A.G.), Karolinska Institute, NOVUM, Huddinge, Sweden.

Correspondence to Michael E. Mendelsohn, MD, Tufts University School of Medicine, New England Medical Center, Molecular Cardiology Research Institute, 750 Washington St, Box 80, Boston, MA 02111. E-mail mmendelsohn{at}lifespan.org

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract — The two known estrogen receptors, ER and ERß, mediate the effects of estrogen in all target tissues, including blood vessels. We have shown previously that estrogen inhibits vascular injury response to the same extent in female wild-type (WT), ER knockout (ERKO_CH), and ERß knockout (ERßKO_CH) mice. We generated mice harboring disruptions of both ER and ERß genes (ER,ßKO_CH) by breeding and studied the effect of 17ß-estradiol (E2) on vascular injury responses in ovariectomized female ER,ßKO_CH mice and WT littermates. E2 inhibited increases in vascular medial area following injury in the WT mice but not in the ER,ßKO_CH mice, demonstrating for the first time that the two known estrogen receptors are necessary and sufficient to mediate estrogen inhibition of a component of the vascular injury response. Surprisingly, as in WT littermates, E2 still significantly increased uterine weight and inhibited vascular smooth muscle cell (VSMC) proliferation following injury in the ER,ßKO_CH mice. These data support that the role of estrogen receptors differs for specific components of the vascular injury response in the ER,ßKO_CH mice. The results leave unresolved whether E2 inhibition of VSMC proliferation in ER,ßKO_CH mice is caused by a receptor-independent mechanism, an unidentified receptor responsive to estrogen, or residual activity of the ER splice variant reported previously in the parental ERKO_CH mice. These possibilities may be resolved by studies of mice in which ER has been fully disrupted (ERKO_St), which are in progress.

Key Words: animal models • vascular injury • 17ß-estradiol • hormone action

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The cardiovascular effects of estrogen are diverse. Estrogen has both systemic effects on circulating factors (eg, cholesterol, cytokines, coagulation/fibrinolytic factors) and direct effects on the blood vessel wall (eg, regulation of vasomotor tone, vascular cell proliferation; reviewed in Mendelsohn and Karas,¹ Farhat et al,² and Mendelsohn³) Some of the effects of estrogen occur rapidly, whereas others require prolonged estrogen exposure. At physiologically relevant concentrations of estrogen, both the rapid and the longer-term cardiovascular effects of estrogens are mediated by estrogen receptors.^3–6 To date, two estrogen receptors (ERs) have been described, ER and ERß (reviewed in Gustafsson [1997],⁷ Katzenellenbogen and Korach,⁸ and Gustafsson [1999]⁹). Although their physiological relevance in the vasculature is incompletely understood, ER and ERß are expressed in endothelial cells and vascular smooth muscle cells (VSMCs),^10,11–16 the predominant cells present in vascular tissues.

Using wild-type (WT) and estrogen receptor knockout (KO) mice, we have previously studied the role of ER and ERß in mediating the vascular protective effects of estrogen in a mouse carotid artery injury model.^10,17,18 Previous studies used mice developed at the University of North Carolina, Chapel Hill, which harbor gene deletions of either ER (ERKO_CH)¹⁹ or ERß (ERßKO_CH).²⁰ These studies show that treatment of ovariectomized female mice with nanomolar concentrations of 17ß-estradiol (E2) inhibits the response to vascular injury to equivalent levels in wild-type,¹⁷ ERKO_CH,¹⁰ and ERßKO_CH mice.^18,21 These findings suggest that ER and ERß are able to complement one another such that each receptor alone is sufficient to mediate the vascular protective effects of estrogen, or that the vascular protective effects of estrogen are mediated by an ER/ERß-independent pathway. To distinguish between these two hypotheses, we undertook the present study examining the effect of estrogen on the response to vascular injury in ER,ßKO_CH (double) estrogen receptor knockout mice.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Animals
A total of over 820 animals were required to ultimately generate the ER,ßKO_CH mice used in this study. These mice, which have been extensively studied, do not express ER proteins in any tissue.^{19,20,22–24} However, ERKO_CH mice have been shown previously to express mRNA for 2 partial ER transcripts, one of which retains the hormone- and DNA-binding domains of full-length ER, and can both bind estradiol and mediate hormone-induced gene expression.²⁴ This partial ER transcript, detectable only by reverse transcriptase- polymerase chain reaction approaches, may account for the low level of residual specific binding of estradiol in uterine tissue of the ERKO_CH mice.²⁴ ER,ßKO_CH mice were generated by extensive crossbreeding in one of our laboratories (C.O.) as follows: male and female double heterozygous (ER^+/-ß^+/-) mice were created from the parental ERKO_CH and ERßKO_CH mice. Female offspring with the wild-type ER^+/+ß^+/+ genotype and the double receptor knockout ER^-/-ß^-/- genotype were included in the present study,^19,20,25 and the latter are referred to as ER,ßKO_CH. More than 830 mice were required to generate a sufficient number of ER,ßKO_CH female mice for the study. All mice were of mixed C57BL/6J/129 backgrounds. Genotyping of tail DNA was performed at 4 weeks of age and again at the end of the vascular injury experiment on tail snips. The ER gene was analyzed with the following primer pairs. Primers AACTCGCCGGCTGCCACTTACCAT and CATCAGCGGGCTAGGCGACACG for the WT gene correspond to flanking regions in the targeted exon 2. They produce a fragment of 320 bp. Primers TGTGGCCGGCTGGGTGTG and GGCGCTGGGCTCGTTCTC for the knockout gene correspond to part of the Neo cassette and the flanking exon 2. They produce a 700-bp fragment. Genotyping of the ERß gene has been described previously.²⁶ (The primers used for the ERß gene were one primer in intron 2 [ßNHD4-25; 5'-AGAATGTTGCACTG- CCCCTGCTGC-3'], one in intron 3 [C1wt-27; 5'-GGAGTAGAA- ACAAGCAATCCAGACATC-3'], and one in the Neo cassette [Neo-25; 5'-GCAGCCTCTGTTCCACATACACTTC-3']. A 650-bp product [ßNHD4-25 and C1wt-27] was amplified for the homozygous wild-type [WT; +/+] mice, and a 450-bp [ßNHD4-25 and Neo-25] product was amplified for the homozygous mutant [-/-] mice; both bands were amplified for the heterozygous [+/-] mice). Animals had free access to fresh water and food pellets.

Carotid Artery Injury
All procedures and protocols were approved by the New England Medical Center Animal Research Committee. A detailed description of the vascular injury protocol has been published previously.^10,17,18 Briefly, 7 days following ovariectomy, 26 wild-type and 23 ER,ßKO_CH female mice, average age 12 to 13 weeks, were randomized to receive either placebo pellets (-E2) or 17ß-estradiol- containing pellets (+E2; 0.1 mg/21-day pellets, Innovative Research) at a dose previously shown to produce physiologically relevant (ie, low nanomolar) concentrations of circulating 17ß-estradiol (E2). A week after pellets were implanted, the mice were anesthetized with inhaled isoflurane and subjected to unilateral vascular injury by intraluminal passage of a wire into the left common carotid artery resulting in endothelial denudation. At this time, osmotic minipumps calibrated to release bromodeoxyuridine (BrdU) over the 14 days of the experiment were implanted subcutaneously, as described.¹⁷ The mice were allowed to recover and return to normal activity.

Tissue Harvest
Two weeks following vascular injury, the mice were anesthetized with 2.5% isoflurane and blood was taken for cholesterol and estradiol determinations. Uteri where then extracted and wet weights obtained, followed by harvesting of a small segment of the tail for confirmation of prestudy genotype analysis by reverse transcriptase- polymerase chain reaction. Both carotid arteries were harvested next after perfusion fixation with 10% formalin at 150 mm Hg for 4 minutes. A small segment of small intestine was also harvested for use as a positive control for the BrdU stains (see next section).

Immunohistochemistry and Morphometry
Following embedding in paraffin, parallel sections from all 98 carotid arteries were stained as previously described for hematoxylin/eosin and for elastin.^10,17,18,27 Immunodetection of BrdU-labeled cells was also performed as previously described.^10,17,18 A section of small intestine was included on each slide to serve as a positive control for the BrdU stain. One section of each vessel was not exposed to a primary antibody, serving as a negative control. VSMCs were identified by immunostaining for smooth muscle specific actin, performed on a Vantana automated slide staining machine using clone 1A4 from Sigma as the primary antibody. BrdU-stained VSMCs and unstained VSMC nuclei were counted by two independent observers. A VSMC proliferation index also was calculated by dividing the number of BrdU-labeled VSMCs by the total number of unstained VSMCs for each section. Medial area was determined on serial elastin-stained sections using the ImagePro Plus software. All observations were made by observers blinded to both the genotype and the treatment group of the specimen. Only one vessel developed an occlusive thrombosis, and this mouse from the WT-E2 group was excluded from analysis.

Additional Assays
Circulating concentrations of E2 were measured by radioimmunoassay using a commercially available kit (Ultra-Sensitive Estradiol RIA, Diagnostic System Laboratories Inc), according to the manufacturer’s instructions. Pooled samples of serum (200 µL) from each of the treatment groups were each assayed in triplicate, and the mean value is reported as representative of the group. Control experiments confirmed the linearity of the assay between the range of 0.018 and 2.78 nmol/L. Circulating concentrations of total and HDL cholesterol, and triglycerides were determined as previously described.¹⁷ At the time of euthanasia, the correct genotype of each mouse was confirmed by a second independent set of PCR studies using tail-snip DNA as described above.

Statistical Analysis
For all analyses, differences between the 4 treatment groups were first examined with a one-way ANOVA after the normality of the data were tested. Post hoc comparisons were made with the Student-Newman-Keuls test. Two group comparisons were made with the Student’s t test. All statistics were performed using SigmaStat software. A value of P0.05 was considered significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
As in our previous studies, implantation of E2-containing pellets in the ovariectomized female mice restored circulating levels of E2 to physiological levels in both the WT and ER,ßKO_CH mice (0.43±0.03 nmol/L [115±9 pg/mL] and 0.55±0.03 nmol/L [148±7 pg/mL], respectively; Table). There were no significant differences in body weight, blood pressure, or heart rate at baseline or at the time of injury between any of the groups (Table). Cholesterol levels also were similar between the WT and ER,ßKO_CH animals, and not significantly changed by estrogen treatment (Table). In the WT animals, E2 treatment resulted in the expected approximately 10-fold increase in uterine weight compared with the -E2 group (Figure 1; P<0.001 WT+E2 versus WT-E2). The uterine weights were lower in the placebo-treated ER,ßKO_CH mice than in the placebo-treated WT mice (P<0.01 ER,ßKO_CH-E2 versus WT-E2). Surprisingly, E2 replacement to physiological levels also significantly increased uterine weight in the ER,ßKO_CH mice (5.8-fold; Figure 1; P<0.01 ER,ßKO_CH+E2 versus ER,ßKO_CH-E2), although to a lesser extent than in the WT mice. Uterine weight increased in every animal assigned to receive E2-containing pellets, confirming proper placement and function of the pellets.

View this table: [in this window] [in a new window]   Table 1. Effects of E2 on Wild-Type and ER,ßKOCH Mice

View larger version (14K): [in this window] [in a new window]   Figure 1. Uterine weights of wild-type and ER,ßKOCH mice treated with placebo or 17B-estradiol. Wet weights of uteri were determined at the time of euthanasia in wild-type and ER,ßKOCH mice. Mice received either placebo pellets (-E2) or 17ß-estradiol-containing pellets (+E2) for a total of 3 weeks before harvest. Bars represent the mean value for each group, ±SEM. *P<0.001 vs -E2.

The 2 primary endpoints for the mouse carotid artery injury model are well established^10,17,18 and include (1) change in medial area and (2) extent of VSMC proliferation, both assessed 14 days after unilateral endothelial denudation injury. The medial-area endpoint reflects the combined effects of alterations in extracellular matrix constituents and cellular volume, whereas the VSMC proliferation endpoint specifically indicates the degree of mitogenesis that occurs in these cells in response to the vascular injury.

Response to Vascular Injury: Medial Area
Medial areas were determined by computerized morphometric analysis of elastin-stained sections of each carotid artery. A summary of the medial area results is presented in Figure 2. The medial areas of the uninjured carotid arteries were similar in the WT (n=26) and ER,ßKO_CH (n=23) mice (15.5±0.3x 10^-3 mm² versus 15.3±0.5x10^-3 mm², respectively; P=NS). In the placebo-treated WT mice, injury induced an increase in the medial area to 21.3±1.6x10^-3 mm² (P<0.01 WT-E2 versus uninjured). Estrogen replacement in the WT mice significantly inhibited the injury-induced increase in medial area, resulting in a medial area of 16.0±1.4x10^-3 mm² (P=0.03 WT+E2 versus WT-E2). The medial area of the injured carotid in the WT+E2 animals was indistinguishable from that of the uninjured contralateral vessel (P=0.7 WT+E2 versus uninjured).

View larger version (41K): [in this window] [in a new window]   Figure 2. Medial areas of uninjured and injured carotid arteries from wild-type and ER,ßKOCH mice treated with vehicle or 17ß-estradiol. a through f, Representative elastin-stained sections from uninjured (Uninj) and injured (Inj) carotid arteries from wild-type (WT) and ER,ßKOCH mice treated with placebo pellets (-E2), or 17ß-estradiol-containing pellets (+E2) are shown (x400). The medial area of each specific section shown is listed in parentheses. The medial area was determined on the entire section. a, Wild-type, uninjured (15.5x10-3 mm2). b, Wild-type, injured, placebo-treated (22.2x10-3 mm2). c, Wild-type, injured, E2-treated (15.4x10-3 mm2). d, ER,ßKOCH, uninjured (14.7x10-3 mm2). e, ER,ßKOCH, injured, placebo-treated (21.6x10-3 mm2). f, ER,ßKOCH, injured, E2-treated (18.9x10-3 mm2). g, Summary of medial area results for all mice. In panel b, the external elastic lamina is identified by the red arrow, and the internal elastic lamina is identified by the black arrow. In panel g, bars represent the mean value for each group, ±SEM. *P<0.05 vs the inj, -E2 group within the same genotype.

In the placebo-treated ER,ßKO_CH mice, injury induced a significant increase in medial area (20.3±1.1x10^-3 mm²; P<0.01 ER,ßKO_CH-E2 versus uninjured), similar to the degree of injury response in the placebo-treated WT mice (P=0.6 ER,ßKO_CH-E2 versus WT-E2). In contrast to the findings in the WT mice, in the ER,ßKO_CH mice E2 treatment did not significantly inhibit the injury-induced increase in medial area (19.0±0.7x10^-3 mm² in the ER,ßKO_CH+E2, P=0.5 versus ER,ßKO_CH-E2). Thus, the injury-induced increase in medial area was similar in the placebo-treated WT and ER,ßKO_CH mice, but E2 replacement no longer inhibited the increase in medial area following injury in the ER,ßKO_CH mice. In contrast to any of our previous studies using this model, in over 300 animals (References 10, 17, 18, and unpublished results, 2000–2001), these results in the ER,ßKO_CH mice represent the first instance that E2 has failed to protect against an endpoint analyzed to quantify the vascular response to carotid injury.

Response to Vascular Injury: VSMC Proliferation
VSMC proliferation was assessed by immunohistochemical detection of BrdU-labeled VSMCs in sections from each carotid artery. A summary of these results is presented in Figure 3. There were no differences in the morphological appearance or total number of nuclei in the uninjured vessels of the WT and ER,ßKO_CH mice (95±15 versus 93±14 cells/section, respectively; P=NS). This supports that there are no obvious developmental abnormalities in the formation of the vasculature in the ER,ßKO_CH mice. As expected, BrdU-labeled VSMCs were only rarely detected in the uninjured vessels of either the WT or the ER,ßKO_CH mice (mean <1 labeled cell per vessel for WT and ER,ßKO_CH groups; P=NS between groups). As in our previous studies using this injury technique, a small amount of neointima was observed in a minority of injured vessels and there were no significant differences in neointimal formation in the WT compared with the ER,ßKO_CH mice (data not shown). In the placebo-treated WT mice, injury increased the VSMC proliferation index from <0.1 to 1.1±0.3 (P<0.001 WT-E2 versus uninjured). This increase in VSMC proliferation was significantly attenuated by E2 treatment in the WT mice, resulting in a VSMC proliferation index of 0.5±0.1 (P<0.05 WT+E2 versus WT-E2).

View larger version (41K): [in this window] [in a new window]   Figure 3. Vascular smooth muscle cell proliferation of uninjured and injured carotid arteries from wild-type and ER,ßKOCH mice treated with vehicle or 17ß-estradiol. a through f, Representative BrdU-stained sections from uninjured (Uninj) and injured (Inj) carotid arteries from wild-type (WT) and ER,ßKOCH mice treated with placebo pellets (-E2) or 17ß-estradiol-containing pellets (+E2) are shown (x400). The VSMC proliferation index (BrdU-labeled VSMCs/unstained VSMCs) of each specific section shown is listed in parentheses. The VSMC proliferation index was determined on the entire section. a, Wild-type, uninjured. b, Wild-type, injured, placebo-treated (0.90). c, Wild-type, injured, E2-treated (0.54). d, ER,ßKOCH, uninjured. e, ER,ßKOCH, injured, placebo-treated (0.77). f, ER,ßKOCH, injured, E2-treated (0.46). g, Summary of VSMC BrdU-labeling results for all mice. In panel g, bars represent the mean value for each group, ±SEM. *P<0.05 vs the Inj, -E2 group within the same genotype.

In the placebo-treated ER,ßKO_CH mice, injury also induced an increase in the VSMC proliferation index from <0.1 to 0.8±0.1 (P<0.001 ER,ßKO_CH-E2 versus uninjured). The injury-induced increase in VSMC proliferation in the placebo-treated ER,ßKO_CH mice was similar to that observed in the placebo-treated WT mice (P=0.4 ER,ßKO_CH-E2 versus WT-E2). As in the WT mice, E2 treatment of the ER,ßKO_CH mice significantly attenuated the injury-induced increase in the VSMC proliferation index (0.4±0.1; P<0.05 ER,ßKO_CH+E2 versus ER,ßKO_CH-E2; P=0.6 ER,ßKO_CH+E2 versus WT+E2). Thus, injury induced an increase in VSMC proliferation to similar degrees in the placebo-treated WT and ER,ßKO_CH mice, and the inhibitory effect of E2 on the injury-induced increase in VSMCs observed in the WT animals was retained in the ER,ßKO_CH mice. These findings demonstrate maintenance of the protective effect of E2 on VSMC proliferation in the ERKO_CH mice, in surprising contrast to the loss of the protective effect of E2 on the medial-area endpoint presented above.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Recent data demonstrate clearly that estrogen receptors mediate both genomic and nongenomic effects in vascular cells at physiological levels of estrogen.^3–6 ER was the first and only known estrogen receptor from 1985, when it was initially cloned,²⁸ until 1996, when ERß was discovered.^29–31 Although ER and ERß are the products of distinct genes, they share relatively high degrees of homology in the DNA binding domain (95%) and in the ligand binding domain (55%). Recent studies have begun to define receptor-specific differences in ligand binding affinity,^29,32–34 receptor interacting proteins,^35,36 and pharmacologic agonists and antagonists.^37–39 These findings highlight the potential for differences in the physiological effects of these two receptors.

In 1995, we first reported that estrogen inhibits the vascular injury response in normolipemic wild-type mice,¹⁷ as it does in other animal models (reviewed in Mendelsohn and Karas¹). A subsequent study showed equivalent inhibition of the vascular injury response in the ERKO_CH mice created by Lubahn et al¹⁹ compared with their littermate wild-type controls.¹⁰ A more recent study in which ERKO_CH mice were bred with the hyperlipidemic apolipoprotein E knockout mice demonstrated that in this model estrogen no longer decreased plaque size, but continued to significantly alter plaque complexity, decreasing the number of lesions with fibrous caps, calcifications, and cholesterol clefts.⁴⁰ These studies support the existence of ER-independent vascular protective effects of E2 or of residual ER activity in the ERKO_CH mice.²⁴ The discovery of ERß,²⁹ identification of its expression in vascular cells and tissues,¹⁰ and demonstration that vascular injury dramatically enhances vascular cell expression of ERß but not ER^13,16 all raised expectations that ERß might mediate the vascular protective effects of estrogen. However, a subsequent carotid artery injury study in the ERßKO mice demonstrated that E2 continued to inhibit the response to injury equally well in ERßKO and WT mice.¹⁸ These studies, which used the only available ER knockout mice at that time,^19,20 suggested that neither ER nor ERß by themselves are necessary for the protective effect of estrogen in the vasculature.

In the present study, the effect of E2 on the usual two vascular injury endpoints, medial area and VSMC proliferation, was compared in ER,ßKO_CH and WT mice. In the wild-type mice, E2 inhibited the injury-induced increase in medial area as it has in each of our previous studies.^10,17,18 In contrast, in the ER,ßKO_CH mice, E2 did not prevent the injury-induced increase in medial area. Loss of the protective effect of estrogen on the medial-area endpoint in the ER,ßKO_CH mice supports that ER and ERß mediate this effect of estrogen. Thus, for the first time, ER and ERß are implicated as physiologically relevant mediators of one component of the vascular injury response. Taken together with the results of previous single estrogen receptor knockout experiments,^10,18 these data support that the ER and ERß can functionally complement one another in vivo, such that either receptor alone can mediate the inhibitory effect of E2 on the medial area thickening endpoint (see subsequent caveat).

The E2-mediated inhibition of VSMC proliferation observed in the WT mice in the present study also is consistent with our previous observations in the WT mice.^10,17,18 Quite surprisingly, however, estrogen also inhibited VSMC proliferation in the ER,ßKO_CH mice to a similar extent as in the WT mice. One interpretation of the preserved estrogenic effect on VSMC proliferation in ER,ßKO_CH mice is the exciting possibility that there are estrogen receptors other than ER and ERß that have not yet been identified. However, to date, extensive searching has failed to identify any likely candidates (authors’ unpublished results, 1997–2001).

It is important to note that E2-mediated inhibition of VSMC proliferation was not the only estrogenic effect observed in the ER,ßKO_CH mice. Estrogen exposure also resulted in a significant increase in ER,ßKO_CH uterine weights (Figure 1). This demonstrates that preservation of an effect of estrogen in the ER,ßKO_CH mice is not confined to, or specific for, the cardiovascular system. The estrogen responsiveness of the uterus in these mice raises an additional consideration. The ER,ßKO_CH mice used in the present study were produced by breeding ERKO_CH and ERßKO_CH mice.^19,20,22,23 Uteri of ERKO_CH mice express mRNA for 2 partial ER transcripts.²⁴ Although one of these transcripts is nonfunctional, the other transcript, E1, is a splice variant of the wild-type ER in which only a portion of exon 2 is omitted.²⁴ The protein encoded by this mutant sequence appears to bind estrogen with an affinity similar to that of the wild-type receptor, and to be capable of mediating hormone-induced gene expression.²⁴ In this prior study, immunoblot analyses of ERKO_CH uterus did not detect expression of a protein from the E1 splice variant.²⁴ However, it remains quite possible that the estrogenic effects observed on VSMC proliferation and uterine weight in the present study are mediated by expression of low levels of this mutant ER. If the E1 transcript mediates the effects of estrogen on uterine weight and/or VSMC proliferation in the ER,ßKO_CH mice (and the parental ERKO_CH mice¹⁰), this would have widespread implications for the published reports that have used ERKO_CH mice to study various physiological systems (reviewed in Couse and Korach⁴¹).

The mechanism by which estrogen continues to inhibit VSMC proliferation and increase uterine weight in the ER,ßKO_CH mice thus remains unclear. Receptor-independent effects of estradiol could be involved, although there is little physiological evidence in support of this explanation.¹ The presence of an unidentified, novel estrogen receptor could also account for the persistent ability of E2 to inhibit VSMC proliferation, although no ER has been identified despite extensive searching. However, another member of the steroid hormone receptor superfamily⁴² (eg, ERR, ERRß, ERR, or an orphan receptor) with the ability to respond to estrogen could be involved. Alternatively, a low level of expression of the E1 estrogen receptor splice variant identified by Couse et al²⁴ in the ERKO_CH parental strain could mediate residual estrogen responsiveness in ER,ßKO_CH mice. The explanation for persistent effects of estrogen in this study may be resolved by our ongoing studies of the effect of E2 on the vascular injury response in mice recently created in the Chambon laboratory in Strasbourg, France (ERKO_St),⁴³ in which ER has been fully disrupted. Understanding the mechanism by which estrogen responsiveness is retained in the ER,ßKO_CH mice has important implications for our understanding of estrogen receptor-mediated signaling in all target tissues, including the cardiovascular system.

	Acknowledgments

 
This work was supported in part by NIH P50 HL63494, NIH R01 HL55309, and NIH R01 HL56069 (M.E.M.); NIH R01 HL61298 (R.H.K.); the Swedish Medical Research Council and the Swedish Foundation for Strategic Research (C.O.); and by KaraBio AB and the Swedish Cancer Fund (J.-A.G.). The authors would like to thank Kristen Whitehead and Sharon Lynch for expert preparation of this manuscript. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of NIH.

Received June 13, 2001; accepted August 7, 2001.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Mendelsohn ME, Karas RH. Mechanisms of disease: the protective effects of estrogen on the cardiovascular system. N Engl J Med. . 1999; 340: 1801–1811.[Full Text]

2. Farhat MY, Lavigne MC, Ramwell PW. The vascular protective effects of estrogen. FASEB J. . 1996; 10: 615–624.[Abstract]

3. Mendelsohn ME. Nongenomic, ER-mediated activation of endothelial nitric oxide synthase: how does it work? What does it mean? Circ Res. . 2000; 87: 956–960.[Abstract/Full Text]

4. Chen Z, Yuhanna IS, Galcheva-Gargova ZI, Karas RH, Mendelsohn ME, Shaul PW. Estrogen receptor mediates the nongenomic activation of endothelial nitric oxide synthase by estrogen. J Clin Invest. . 1999; 103: 401–406.[Abstract/Full Text]

5. Haynes MP, Sinha D, Strong Russell K, Collinge M, Fulton D, Morales-Ruiz M, Bender JR. Membrane estrogen receptor engagement activates endothelial nitric oxide synthase via the PI3-kinase-Akt pathway in human endothelial cells. Circ Res. . 2000; 87: 677–682.[Abstract/Full Text]

6. Simoncini T, Hafezi-Moghadam A, Brazil DP, Ley K, Chin WW, Liao JK. Interaction of oestrogen receptor with the regulatory subunit of phosphatidylinositol-3-OH kinase. Nature. . 2000; 407: 538–541.[Medline]

7. Gustafsson JÅ. Estrogen receptor ß: getting in on the action? Nat Med. 1997;3:493–494.

8. Katzenellenbogen BS, Korach KS. A new actor in the estrogen receptor drama: enter ER-ß. Endocrinology. . 1997; 1381: 861–862.

9. Gustafsson JÅ. Estrogen receptor ß: a new dimension in estrogen mechanism of action. J Endocrinol. 1999;163:379–383.

10. Iafrati MD, Karas RH, Aronovitz M, Kim S, Sullivan TR Jr, Lubhan DB, O’Donnell TF Jr, Korach KS, Mendelsohn ME. Estrogen inhibits the vascular injury response in estrogen receptor -deficient mice. Nat Med. . 1997; 3: 545–548.[Medline]

11. Karas RH, Patterson BL, Mendelsohn ME. Human vascular smooth muscle cells contain functional estrogen receptor. Circulation. . 1994; 89: 1943–1950.[Abstract]

12. Kim-Schulze S, McGowan KA, Hubchak SC, Cid MC, Martin MB, Kleinman HK, Greene GL, Schnaper HW. Expression of an estrogen receptor by human coronary artery and umbilical vein endothelial cells. Circulation. . 1996; 94: 1402–1407.[Abstract/Full Text]

13. Lindner V, Kim SK, Karas RH, Kuiper GGJM, Gustafsson J-Å, Mendelsohn ME. Increased expression of estrogen receptor ß mRNA in male blood vessels following vascular injury. Circ Res. 1998;83:224–229.

14. Venkov CD, Rankin AB, Vaughan DE. Identification of authentic estrogen receptor in cultured endothelial cells: a potential mechanism for steroid hormone regulation of endothelial function. Circulation. . 1996; 94: 727–733.[Abstract/Full Text]

15. Losordo DW, Kearney M, Kim EA, Jekanowski J, Isner JM. Variable expression of the estrogen receptor in normal and atherosclerotic coronary arteries of premenopausal women. Circulation. . 1994; 89: 1501–1510.[Abstract]

16. Register TC, Adams MR. Coronary artery and cultured aortic smooth muscle cells express mRNA for both the classical estrogen receptor and the newly described estrogen receptor ß. J Steroid Biochem Mol Biol. . 1998; 64: 187–191.[Medline]

17. Sullivan TR Jr, Karas RH, Aronovitz M, Faller GT, Ziar JP, Smith JJ, O’Donnell TF Jr, Mendelsohn ME. Estrogen inhibits the response-to-injury in a mouse carotid artery model. J Clin Invest. . 1995; 96: 2482–2488.[Medline]

18. Karas RH, Hodgin JB, Kwoun M, Krege JH, Aronovitz M, Mackey W, Gustafsson JÅ, Korach KS, Smithies O, Mendelsohn ME. Estrogen inhibits the vascular injury response in estrogen receptor ß-deficient female mice. Proc Natl Acad Sci USA. 1999;96:15133–15136.

19. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O. Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci USA. . 1993; 90: 11162–11166.[Abstract]

20. Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF, Sar M, Korach KS, Gustafsson J-A, Smithies O. Generation and reproductive phenotype of mice lacking estrogen receptor ß. Proc Natl Acad Sci USA. . 1998; 95: 15677–15682.[Abstract/Full Text]

21. Deleted in proof.

22. Couse JF, Hewitt SC, Bunch DO, Sar M, Walker VR, Davis BJ, Korach KS. Postnatal sex reversal of the ovaries in mice lacking estrogen receptors and ß. Science. . 1999; 286: 2328–2331.[Abstract/Full Text]

23. Ogawa S, Chester AE, Hewitt SC, Walker VR, Gustafsson JA, Smithies O, Korach KS, Pfaff DW. From the Cover: Abolition of male sexual behaviors in mice lacking estrogen receptors and ß (ßERKO). Proc Natl Acad Sci USA. . 2000; 97: 14737–14741.[Abstract/Full Text]

24. Couse JF, Curtis SW, Washburn TF, Lindzey J, Golding TS, Lubahn DB, Smithies O, Korach KS. Analysis of transcription and estrogen insensitivity in the female mouse after targeted disruption of the estrogen receptor gene. Mol Endocrinol. . 1995; 9: 1441–1454.[Abstract]

25. Vidal O, Lindberg MK, Hollberg K, Baylink DJ, Andersson G, Lubhan DB, Mohan S, Gustafsson JA, Ohlsson C. Estrogen receptor specificity in the regulation of skeletal growth and maturation in male mice. Proc Natl Acad Sci USA. . 1997; 10: 5474–5479.

26. Windahl SH, Vidal O, Andersson G, Gustafsson JA, Ohlsson C. Increased cortical bone mineral content but unchanged trabecular bone mineral density in female ERß(-/-) mice. J Clin Invest. . 1999; 104: 895–901.[Abstract/Full Text]

27. Lindner V, Fingerle J, Reidy MA. Mouse model of arterial injury. Circ Res. . 1993; 73: 792–796.[Abstract]

28. Walter P, Green S, Green G, Krust A, Bornert JM, Jeltsch JM, Staub A, Jensen E, Scrace G, Waterfield M, Chambon P. Cloning of the human estrogen receptor cDNA. Proc Natl Acad Sci USA. . 1985; 82: 7889–7893.[Medline]

29. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JÅ. Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA. 1996;93:5925–5930.

30. Mosselman S, Polman J, Dijkema R. ERß. Identification and characterization of a novel human estrogen receptor. FEBS Lett. . 1996; 392: 49–53.[Medline]

31. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, Giguère V. Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor ß. Mol Endocrinol. . 1997; 11: 353–365.[Abstract/Full Text]

32. Barkhem T, Carlsson B, Nilsson Y, Enmark E, Gustafsson J, Nilsson S. Differential response of estrogen receptor and estrogen receptor ß to partial estrogen agonists/antagonists. Mol Pharmacol. . 1998; 54: 105–112.[Abstract/Full Text]

33. Giguère V, Tremblay A, Tremblay GB. Estrogen receptor ß: re-evaluation of estrogen and antiestrogen signaling. Steroids. . 1998; 63: 335–339.[Medline]

34. Paech K, Webb P, Kuiper GGJM, Nilsson S, Gustafsson JÅ, Kushner PJ, Scanlan TS. Differential ligand activation of estrogen receptors ER and ERß at AP1 sites. Science. 1997;277:1508–1510.

35. Montano MM, Ekena K, Delage-Mourroux R, Chang WR, Martini P, Katzenellenbogen BS. An estrogen receptor-selective coregulator that potentiates the effectiveness of antiestrogens and represses the activity of estrogens. Proc Natl Acad Sci USA. . 1999; 96: 6947–6952.[Abstract/Full Text]

36. Poelzl G, Kasai Y, Mochizuki N, Shaul PW, Brown M, Mendelsohn ME. Specific association of estrogen receptor with a cell cycle spindle assembly checkpoint protein, MAD2. Proc Natl Acad Sci USA. . 2000; 97: 2836–2839.[Abstract/Full Text]

37. Sun J, Meyers MJ, Fink BE, Rajendran R, Katzenellenbogen JA, Katzenellenbogen BS. Novel ligands that function as selective estrogens or antiestrogens for estrogen receptor or estrogen receptor ß. Endocrinology. . 1999; 140: 800–804.[Abstract/Full Text]

38. Chang C, Norris JD, Grohn H, Paige LA, Hamilton PT, Kenan DJ, Fowlkes D, McDonnell DP. Dissection of the LXXLL nuclear receptor-coactivator interaction motif using combinatorial peptide libraries: discovery of peptide antagonists of estrogen receptors and ß. Mol Cell Biol. . 1999; 19: 8226–8239.[Abstract/Full Text]

39. Norris JD, Paige LA, Christensen DJ, Chang CY, Huacani MR, Fan D, Hamilton PT, Fowlkes DM, McDonnell DP. Peptide antagonists of the human estrogen receptor. Science. . 1999; 285: 744–746.[Abstract/Full Text]

40. Hodgin JB, Krege JH, Reddick RL, Korach KS, Smithies O, Madeda N. Estrogen receptor is a major mediator of 17ß-estradiol’s atheroprotective effects on lesion size in Apoe-/- mice. J Clin Invest. . 2001; 107: 333–340.[Abstract/Full Text]

41. Couse JF, Korach KS. Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev. . 1999; 20: 358–417.[Abstract/Full Text]

42. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM. The nuclear receptor superfamily: the second decade. Cell. . 1995; 83: 835–839.[Medline]

43. Dupont S, Krust A, Gansmuller A, Dierich A, Chambon P, Mark M. Effect of single and compound knockouts of estrogen receptors (ER) and ß (ERß) on mouse reproductive phenotypes. Development. . 2000; 127: 4277–4291.[Abstract]

This article has been cited by other articles:

				Y. Macotela, J. Boucher, T. T. Tran, and C. R. Kahn Sex and Depot Differences in Adipocyte Insulin Sensitivity and Glucose Metabolism Diabetes, April 1, 2009; 58(4): 803 - 812. [Abstract] [Full Text] [PDF]

				A. Billon-Gales, C. Fontaine, C. Filipe, V. Douin-Echinard, M.-J. Fouque, G. Flouriot, P. Gourdy, F. Lenfant, H. Laurell, A. Krust, et al. The transactivating function 1 of estrogen receptor {alpha} is dispensable for the vasculoprotective actions of 17{beta}-estradiol PNAS, February 10, 2009; 106(6): 2053 - 2058. [Abstract] [Full Text] [PDF]

				A. Grasselli, S. Nanni, C. Colussi, A. Aiello, V. Benvenuti, G. Ragone, F. Moretti, A. Sacchi, S. Bacchetti, C. Gaetano, et al. Estrogen Receptor-{alpha} and Endothelial Nitric Oxide Synthase Nuclear Complex Regulates Transcription of Human Telomerase Circ. Res., July 3, 2008; 103(1): 34 - 42. [Abstract] [Full Text] [PDF]

				R. K. Dubey, B. Imthurn, and E. K. Jackson 2-Methoxyestradiol: A Potential Treatment for Multiple Proliferative Disorders Endocrinology, September 1, 2007; 148(9): 4125 - 4127. [Full Text] [PDF]

				D. Sun, C. Yan, A. Jacobson, H. Jiang, M. A. Carroll, and A. Huang Contribution of epoxyeicosatrienoic acids to flow-induced dilation in arteries of male ER{alpha} knockout mice: role of aromatase Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1239 - R1246. [Abstract] [Full Text] [PDF]

				P. B. Gupta, D. Proia, O. Cingoz, J. Weremowicz, S. P. Naber, R. A. Weinberg, and C. Kuperwasser Systemic Stromal Effects of Estrogen Promote the Growth of Estrogen Receptor-Negative Cancers Cancer Res., March 1, 2007; 67(5): 2062 - 2071. [Abstract] [Full Text] [PDF]

				J. G. Greger, N. Fursov, N. Cooch, S. McLarney, L. P. Freedman, D. P. Edwards, and B. J. Cheskis Phosphorylation of MNAR Promotes Estrogen Activation of Phosphatidylinositol 3-Kinase Mol. Cell. Biol., March 1, 2007; 27(5): 1904 - 1913. [Abstract] [Full Text] [PDF]

				A. Cvoro, S. Paruthiyil, J. O. Jones, C. Tzagarakis-Foster, N. J. Clegg, D. Tatomer, R. T. Medina, M. Tagliaferri, F. Schaufele, T. S. Scanlan, et al. Selective Activation of Estrogen Receptor-{beta} Transcriptional Pathways by an Herbal Extract Endocrinology, February 1, 2007; 148(2): 538 - 547. [Abstract] [Full Text] [PDF]

				Y. D. Krom, N. M.M. Pires, J. W. Jukema, M. R. de Vries, R. R. Frants, L. M. Havekes, K. W. van Dijk, and P. H.A. Quax Inhibition of neointima formation by local delivery of estrogen receptor alpha and beta specific agonists Cardiovasc Res, January 1, 2007; 73(1): 217 - 226. [Abstract] [Full Text] [PDF]

				K. Moriarty, K. H. Kim, and J. R. Bender Estrogen Receptor-Mediated Rapid Signaling Endocrinology, December 1, 2006; 147(12): 5557 - 5563. [Abstract] [Full Text] [PDF]

				M. Doshida, M. Ohmichi, S. Tsutsumi, J. Kawagoe, T. Takahashi, B. Du, A. Mori-Abe, T. Ohta, M. Saitoh-Sekiguchi, K. Takahashi, et al. Raloxifene Increases Proliferation and Up-regulates Telomerase Activity in Human Umbilical Vein Endothelial Cells J. Biol. Chem., August 25, 2006; 281(34): 24270 - 24278. [Abstract] [Full Text] [PDF]

				P. Ouyang, E. D. Michos, and R. H. Karas Hormone Replacement Therapy and the Cardiovascular System: Lessons Learned and Unanswered Questions J. Am. Coll. Cardiol., May 2, 2006; 47(9): 1741 - 1753. [Abstract] [Full Text] [PDF]

				V. L. Ballard and J. M. Edelberg Harnessing Hormonal Signaling for Cardioprotection Sci. Aging Knowl. Environ., December 21, 2005; 2005(51): re6 - re6. [Abstract] [Full Text] [PDF]

				K. Wassmann, S. Wassmann, and G. Nickenig Progesterone Antagonizes the Vasoprotective Effect of Estrogen on Antioxidant Enzyme Expression and Function Circ. Res., November 11, 2005; 97(10): 1046 - 1054. [Abstract] [Full Text] [PDF]

				T. M. D'Eon, S. C. Souza, M. Aronovitz, M. S. Obin, S. K. Fried, and A. S. Greenberg Estrogen Regulation of Adiposity and Fuel Partitioning: EVIDENCE OF GENOMIC AND NON-GENOMIC REGULATION OF LIPOGENIC AND OXIDATIVE PATHWAYS J. Biol. Chem., October 28, 2005; 280(43): 35983 - 35991. [Abstract] [Full Text] [PDF]

				M. J. Byers, A. Zangl, T. M. Phernetton, G. Lopez, D.-b. Chen, and R. R. Magness Endothelial vasodilator production by ovine uterine and systemic arteries: ovarian steroid and pregnancy control of ER{alpha} and ER{beta} levels J. Physiol., May 15, 2005; 565(1): 85 - 99. [Abstract] [Full Text] [PDF]

				T. Pelzer, P.-A. A. Loza, K. Hu, B. Bayer, C. Dienesch, L. Calvillo, J. F. Couse, K. S. Korach, L. Neyses, and G. Ertl Increased Mortality and Aggravation of Heart Failure in Estrogen Receptor-{beta} Knockout Mice After Myocardial Infarction Circulation, March 29, 2005; 111(12): 1492 - 1498. [Abstract] [Full Text] [PDF]

				R. K. Dubey, E. K. Jackson, D. G. Gillespie, M. Rosselli, F. Barchiesi, A. Krust, H. Keller, L. C. Zacharia, and B. Imthurn Cytochromes 1A1/1B1- and Catechol-O-Methyltransferase-Derived Metabolites Mediate Estradiol-Induced Antimitogenesis in Human Cardiac Fibroblast J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 247 - 255. [Abstract] [Full Text] [PDF]

				M. Zaitseva, D. S. Yue, J. A. Katzenellenbogen, P. A. W. Rogers, and C. E. Gargett Estrogen Receptor-{alpha} Agonists Promote Angiogenesis in Human Myometrial Microvascular Endothelial Cells Reproductive Sciences, December 1, 2004; 11(8): 529 - 535. [Abstract] [PDF]

				M. Razandi, A. Pedram, I. Merchenthaler, G. L. Greene, and E. R. Levin Plasma Membrane Estrogen Receptors Exist and Functions as Dimers Mol. Endocrinol., December 1, 2004; 18(12): 2854 - 2865. [Abstract] [Full Text] [PDF]

				R. K. Dubey, E. K. Jackson, D. G. Gillespie, L. C. Zacharia, and B. Imthurn Catecholamines Block the Antimitogenic Effect of Estradiol on Human Coronary Artery Smooth Muscle Cells J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 3922 - 3931. [Abstract] [Full Text] [PDF]

				F. Barchiesi, E. K. Jackson, B. Imthurn, J. Fingerle, D. G. Gillespie, and R. K. Dubey Differential Regulation of Estrogen Receptor Subtypes {alpha} and {beta} in Human Aortic Smooth Muscle Cells by Oligonucleotides and Estradiol J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2373 - 2381. [Abstract] [Full Text] [PDF]

				S. Ling, A. Dai, R. J. Dilley, M. Jones, E. Simpson, P. A. Komesaroff, and K. Sudhir Endogenous Estrogen Deficiency Reduces Proliferation and Enhances Apoptosis-Related Death in Vascular Smooth Muscle Cells: Insights From the Aromatase-Knockout Mouse Circulation, February 3, 2004; 109(4): 537 - 543. [Abstract] [Full Text] [PDF]

				R. K. Dubey, S. P. Tofovic, and E. K. Jackson Cardiovascular Pharmacology of Estradiol Metabolites J. Pharmacol. Exp. Ther., February 1, 2004; 308(2): 403 - 409. [Abstract] [Full Text] [PDF]

				L. C. Zacharia, J. A. Gogos, M. Karayiorgou, E. K. Jackson, D. G. Gillespie, F. Barchiesi, and R. K. Dubey Methoxyestradiols Mediate the Antimitogenic Effects of 17{beta}-Estradiol: Direct Evidence From Catechol-O-Methyltransferase-Knockout Mice Circulation, December 16, 2003; 108(24): 2974 - 2978. [Abstract] [Full Text] [PDF]

				D. Javeshghani, R. M. Touyz, M. R. Sairam, A. Virdis, M. F. Neves, and E. L. Schiffrin Attenuated Responses to Angiotensin II in Follitropin Receptor Knockout Mice, a Model of Menopause-Associated Hypertension Hypertension, October 1, 2003; 42(4): 761 - 767. [Abstract] [Full Text] [PDF]

				T. Watanabe, M. Akishita, T. Nakaoka, K. Kozaki, Y. Miyahara, H. He, Y. Ohike, T. Ogita, S. Inoue, M. Muramatsu, et al. Estrogen receptor {beta} mediates the inhibitory effect of estradiol on vascular smooth muscle cell proliferation Cardiovasc Res, September 1, 2003; 59(3): 734 - 744. [Abstract] [Full Text] [PDF]

				R. K. Dubey, L. C. Zacharia, D. G. Gillespie, B. Imthurn, and E. K. Jackson Catecholamines Block the Antimitogenic Effect of Estradiol on Human Glomerular Mesangial Cells Hypertension, September 1, 2003; 42(3): 349 - 355. [Abstract] [Full Text] [PDF]

				M. van Eickels, R. D. Patten, M. J. Aronovitz, A. Alsheikh-Ali, K. Gostyla, F. Celestin, C. Grohe, M. E. Mendelsohn, and R. H. Karas 17-Beta-Estradiol increases cardiac remodeling and mortality in mice with myocardial infarction J. Am. Coll. Cardiol., June 4, 2003; 41(11): 2084 - 2092. [Abstract] [Full Text] [PDF]

				R. K. Dubey, D. G. Gillespie, L. C. Zacharia, F. Barchiesi, B. Imthurn, and E. K. Jackson CYP450- and COMT-Derived Estradiol Metabolites Inhibit Activity of Human Coronary Artery SMCs Hypertension, March 1, 2003; 41(3): 807 - 813. [Abstract] [Full Text] [PDF]

				G. A. Figtree, D. McDonald, H. Watkins, and K. M. Channon Truncated Estrogen Receptor {alpha} 46-kDa Isoform in Human Endothelial Cells: Relationship to Acute Activation of Nitric Oxide Synthase Circulation, January 7, 2003; 107(1): 120 - 126. [Abstract] [Full Text] [PDF]

				K. J. Ho and J. K. Liao Nonnuclear Actions of Estrogen Arterioscler Thromb Vasc Biol, December 1, 2002; 22(12): 1952 - 1961. [Abstract] [Full Text] [PDF]

				K. L. Chambliss and P. W. Shaul Estrogen Modulation of Endothelial Nitric Oxide Synthase Endocr. Rev., October 1, 2002; 23(5): 665 - 686. [Abstract] [Full Text] [PDF]

				M. J. Evans, H. A. Harris, C. P. Miller, S. K. Karathanasis, and S. J. Adelman Estrogen Receptors {alpha} and {beta} Have Similar Activities in Multiple Endothelial Cell Pathways Endocrinology, October 1, 2002; 143(10): 3785 - 3795. [Abstract] [Full Text] [PDF]

				P. Geraldes, M. G. Sirois, P. N. Bernatchez, and J.-F. Tanguay Estrogen Regulation of Endothelial and Smooth Muscle Cell Migration and Proliferation: Role of p38 and p42/44 Mitogen-Activated Protein Kinase Arterioscler Thromb Vasc Biol, October 1, 2002; 22(10): 1585 - 1590. [Abstract] [Full Text] [PDF]

				E. K. Jackson Commentary on Liu et al: Effect of Estrogen and AT1 Receptor Blocker on Neointima Formation Hypertension, October 1, 2002; 40(4): 448 - 450. [Full Text] [PDF]

				M. Matsuda, I. Shimomura, M. Sata, Y. Arita, M. Nishida, N. Maeda, M. Kumada, Y. Okamoto, H. Nagaretani, H. Nishizawa, et al. Role of Adiponectin in Preventing Vascular Stenosis. THE MISSING LINK OF ADIPO-VASCULAR AXIS J. Biol. Chem., September 27, 2002; 277(40): 37487 - 37491. [Abstract] [Full Text] [PDF]

				K. J. Ho and J. K. Liao Non-nuclear Actions of Estrogen: New Targets for Prevention and Treatment of Cardiovascular Disease Mol. Interv., July 1, 2002; 2(4): 219 - 228. [Abstract] [Full Text] [PDF]

				Y. Yuan, L. Liao, D. A. Tulis, and J. Xu Steroid Receptor Coactivator-3 Is Required for Inhibition of Neointima Formation by Estrogen Circulation, June 4, 2002; 105(22): 2653 - 2659. [Abstract] [Full Text] [PDF]

				G. Pare, A. Krust, R. H. Karas, S. Dupont, M. Aronovitz, P. Chambon, and M. E. Mendelsohn Estrogen Receptor-{alpha} Mediates the Protective Effects of Estrogen Against Vascular Injury Circ. Res., May 31, 2002; 90(10): 1087 - 1092. [Abstract] [Full Text] [PDF]

				F. Barchiesi, E. K. Jackson, D. G. Gillespie, L. C. Zacharia, J. Fingerle, and R. K. Dubey Methoxyestradiols Mediate Estradiol-Induced Antimitogenesis in Human Aortic SMCs Hypertension, April 1, 2002; 39(4): 874 - 879. [Abstract] [Full Text] [PDF]

				C. Pendaries, B. Darblade, P. Rochaix, A. Krust, P. Chambon, K. S. Korach, F. Bayard, and J.-F. Arnal The AF-1 activation-function of ERalpha may be dispensable to mediate the effect of estradiol on endothelial NO production in mice PNAS, February 19, 2002; 99(4): 2205 - 2210. [Abstract] [Full Text] [PDF]

				Y. Zhu, Z. Bian, P. Lu, R. H. Karas, L. Bao, D. Cox, J. Hodgin, P. W. Shaul, P. Thoren, O. Smithies, et al. Abnormal Vascular Function and Hypertension in Mice Deficient in Estrogen Receptor beta Science, January 18, 2002; 295(5554): 505 - 508. [Abstract] [Full Text] [PDF]

				M. E. Mendelsohn and R. H. Karas The Time Has Come to Stop Letting the HERS Tale Wag the Dogma Circulation, November 6, 2001; 104(19): 2256 - 2259. [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 89/6/534    most recent hh1801.097239v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Karas, R. H. Articles by Mendelsohn, M. E. Search for Related Content PubMed Articles by Karas, R. H. Articles by Mendelsohn, M. E. Related Collections Gene expression Genetically altered mice Smooth muscle proliferation and differentiation Receptor pharmacology Other Vascular biology