Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2006;99:119-131
doi: 10.1161/01.RES.0000233356.10630.8a
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Inoue, R.
Right arrow Articles by Ito, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inoue, R.
Right arrow Articles by Ito, Y.
Related Collections
Right arrow Remodeling
Right arrow Cell signalling/signal transduction
Right arrow Growth factors/cytokines
Right arrow Ion channels/membrane transport
Right arrow Pulmonary biology and circulation
Right arrow Smooth muscle proliferation and differentiation
Right arrow Autonomic, reflex, and neurohumoral control of circulation
(Circulation Research. 2006;99:119.)
© 2006 American Heart Association, Inc.


Review

Transient Receptor Potential Channels in Cardiovascular Function and Disease

Ryuji Inoue, Lars Jørn Jensen, Juan Shi, Hiromitsu Morita, Motohiro Nishida, Akira Honda, Yushi Ito

From the Department of Physiology (R.I., A.H.), Fukuoka University School of Medicine, Japan; Department of Pharmacology (L.J.J., J.S., H.M., Y.I.), Graduate School of Medical Sciences; and Department of Pharmacology and Toxicology (M.N.), Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka, Japan; and Department of Anatomy and K.K. Leung Brain Research Centre (J.S.), the Fourth Military Medical University, Xi’an, China.

Correspondence to Ryuji Inoue, MD, PhD, Department of Physiology, Fukuoka University School of Medicine, Fukuoka 814-0180, Japan. E-mail inouery{at}fukuoka-u.ac.jp



This Review is part of a thematic series on TRP Channels in the Cardiovascular System, which includes the following articles:

Recent Developments in Vascular Endothelial Cell TRP Channels

Transient Receptor Potential Channels in Cardiovascular Function and Disease
Bernd Nilius Guest Editor


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowExpression Pattern of TRPs...
down arrowArterial Tone Regulation
down arrowVSMC Growth and Hyperplasia
down arrowVascular Integrity: Disruption...
down arrowTRPs in Vascular Diseases
down arrowPossible Roles of TRPs...
down arrowConclusions
down arrowNote Added in Proof
down arrowReferences
 
Sustained elevation in the intracellular Ca2+ concentration via Ca2+ influx, which is activated by a variety of mechanisms, plays a central regulatory role for cardiovascular functions. Recent molecular biological research has disclosed an unexpectedly diverse array of Ca2+-entry channel molecules involved in this Ca2+ influx. These include more than ten transient receptor potential (TRP) superfamily members such as TRPC1, TRPC3–6, TRPV1, TRPV2, TRPV4, TRPM4, TRPM7, and polycystin (TRPP2). Most of them appear to be multimodally activated or modulated and show relevant features to both acute hemodynamic control and long-term remodeling of the cardiovascular system, and many of them have been found to respond not only to receptor stimulation but also to various forms of stimuli. There is good evidence to implicate TRPC1 in neointimal hyperplasia after vascular injury via store-depletion–operated Ca2+ entry. TRPC6 likely contributes to receptor-operated and mechanosensitive Ca2+ mobilizations, being involved in vasoconstrictor and myogenic responses and pulmonary arterial proliferation and its associated disease (idiopathic pulmonary arterial hypertension). Considerable evidence has also been accumulated for unique involvement of TRPV1 in blood flow/pressure regulation via sensory vasoactive neuropeptide release. New lines of evidence suggest that TRPV2 may act as a Ca2+-overloading pathway associated with dystrophic cardiomyopathy, TRPV4 as a mediator of endothelium-dependent hyperpolarization, TRPM7 as a proproliferative vascular Mg2+ entry channel, and TRPP2 as a Ca2+-entry channel requisite for vascular integrity. This review attempts to provide an overview of the current knowledge on TRP proteins and discuss their possible roles in cardiovascular functions and diseases.


Key Words: cardiovascular function • non–voltage-gated Ca2+-entry channel • transient receptor potential protein • receptor stimulation • growth factor • mechanotransduction • cardiovascular remodeling


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowExpression Pattern of TRPs...
down arrowArterial Tone Regulation
down arrowVSMC Growth and Hyperplasia
down arrowVascular Integrity: Disruption...
down arrowTRPs in Vascular Diseases
down arrowPossible Roles of TRPs...
down arrowConclusions
down arrowNote Added in Proof
down arrowReferences
 
The function of the circulation is to supply a sufficient blood flow to peripheral tissues and organs on their metabolic demand. This is achieved by the moment-to-moment changing hemodynamics, which is determined by the cardiac output, vascular resistance, and renal fluid regulation, and also by a long-term control mediated by altered size and integrity of heart and vasculature. The major mechanisms responsible for the former involve inotropic and chronotropic changes in the cardiac pumping function as well as rapid changes in peripheral resistance, which mainly reflect the degree of tension generated in small arterial/arteriolar walls (or arterial tone). It is widely accepted that ion channels, especially those permeating Ca2+, occupy a central position in hemodynamic control via changes in the intracellular Ca2+ concentration ([Ca2+]i).1–8 Evidence is also being accumulated for the role of Ca2+ influx in slowly progressive remodeling processes of the cardiovascular system manifested as cardiac hypertrophy, cardiomyopathy, atherosclerosis, and other proliferative/degenerative disorders.8–10 Previous studies using electrophysiological and fluorometric techniques have suggested that several distinct Ca2+-influx pathways exist in mammalian cells. Based on the mode of activation, these are classified into voltage-gated Ca2+ channels (VGCCs), which are directly activated by membrane depolarization,2,11 and non–voltage gated Ca2+-entry pathways, including those activated in response to receptor stimulation (receptor-operated Ca2+-entry channels [ROCCs] or non-capacitative Ca2+ entry [NCCE]),6,12,13depletion of intracellular Ca2+ stores (store-operated Ca2+-entry channels [SOCs] or capacitative Ca2+ entry [CCE]),14 mechanical forces imposed on the cell membrane (mechanosensitive Ca2+-entry channels [MSCCs]),4,15,16 and other external stimuli such as chemicals and changes in temperature and osmolarity. (Note that distinction of ROCC versus SOC and that of NCCE versus CCE do not rely on rigorous molecular definitions but rather on experimental protocols; new evidence for the molecular identification of SOC has also been presented very recently.13,14,17,18) Besides the established importance of VGCCs, however, the molecular entity of the above non–voltage-gated Ca2+-entry pathways was entirely elusive until only recently. There is now a vast new family of Ca2+-entry channels emerging as promising candidates for these diverse Ca2+-entry pathways, which are referred to as the transient receptor potential (TRP) proteins (Figure 1). Since their discovery, TRP proteins have attracted almost exponentially growing attention as exceptionally unique Ca2+-entry channels activated by a multitude of physiochemical stimuli and associated with a diversity of biological functions.19–22


Figure 1
View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Dendrogram of vascular TRPs. TRPs in black; TRP isoforms detected from cardiovascular tissues.30–58,108,112–115,140 (Those in bold indicate major cardiovascular isoforms whose functions are discussed in detail.) The results of the whole amino acid sequence alignment of human TRPs, dTRP, dTRPL, and dTRPN (Drosophila) and mTRPC2 (mouse) by CLUSTALW. Scale bar indicates genetic distance.

The archetypal TRP protein dTRP was originally discovered in the screening process of mutants responsible for the aberrant visual transduction of Drosophila melanogaster. This protein was later shown to function as a Ca2+-entry channel associated with increased phosphoinositide turnover.23 Mammalian homologs of TRP have a predicted 6 transmembrane (TM)-domain structure flanked by cytosolic N and C termini with a putative pore loop between the fifth and sixth TM domains. This architecture places them in the voltage-dependent cation channel superfamily, but positively charged amino acid residues characteristic for voltage-sensing are not preserved in most family members. (Some members of this superfamily, however, possess a sequence reminiscent of the voltage-sensor and their gating are strongly modulated by changes in membrane potential.24) Mammalian TRP proteins likely function as non–voltage-gated, nonselective cationic channels (NSCC) (Ca2+-permeable except for TRPM4 and TRPM5), activated not only by G protein–coupled receptors and receptor tyrosine kinases that are linked to phosphoinositide hydrolysis via phospholipase C (PLC) activation (TRPC family; "classical" or "canonical"; TRPC1–7; TRPC2 is a pseudogene in human) but also by a variety of chemical and physical stimuli including pungent agents (eg, capsaicin), lipids, acid, heat, shear stress, and hypoosmolarity (TRPV1–6; vanilloid receptor-related). This superfamily also includes NSCCs constitutively active or activated in response to oxidative stress, intracellular Ca2+ elevation and cold exposure or cooling agents (menthol, icilin) (TRPM1–8; melastatin-related), as well as more distantly related families associated with specific genetic disorders, ie, polycystins (TRPP) and mucolipidins (TRPML), and the latest TRP subfamilies, TRPN and TRPA.19–21 TRP proteins show broad tissue distribution and may participate in divergent functions such as visual, auditory, taste, and pain signal transductions and regulation of blood circulation, gut motility, mineral absorption and body fluid balance, airway and bladder hypersensitivities, cell survival/growth/death, and pheromone behaviors. Such enormous functional diversity of TRP proteins seems to arise, in addition to the multiplicity of their activation mechanisms, from their complex regulation by transcription, splicing, membrane trafficking, glycosylation, and phosphorylation, as well as from homo- and heterophilic interactions occurring between different TRP isoforms/splice variants and other accessory proteins expressed in a cell-specific manner that are coassembled into large signaling complexes.19–22

The purpose of this review is to provide an overview of newly emerging roles of TRP proteins in cardiovascular functions. Because of space limitations, the main focus will be placed on those abundantly expressed in the vasculature whose connections to in vivo functions are relatively clear, eg, vascular tone regulation, vascular remodeling and integrity, and associated disorders. A brief account will also be made for the available information on cardiac TRP channels, which is still scanty. Readers interested in full details of the TRP superfamily are recommended to consult with several excellent reviews published recently.19–22,24–29


*    Expression Pattern of TRPs in the Cardiovascular System
up arrowTop
up arrowAbstract
up arrowIntroduction
*Expression Pattern of TRPs...
down arrowArterial Tone Regulation
down arrowVSMC Growth and Hyperplasia
down arrowVascular Integrity: Disruption...
down arrowTRPs in Vascular Diseases
down arrowPossible Roles of TRPs...
down arrowConclusions
down arrowNote Added in Proof
down arrowReferences
 
Until now, more than 10 distinct members of the TRP superfamily have been detected in the vascular smooth muscle cells (VSMCs) from various species, including humans, by means of RT-PCR, immunohistochemistry, and Western blotting (Table).30–44 The most commonly expressed TRPC isoforms in VSMCs are TRPC1, TRPC4, and TRPC6, whereas TRPC3, TRPC5, and TRPC7 are less frequently detected. Virtually no message of TRPC2 (pseudogene in human) was amplified from freshly isolated vascular tissues. The expression pattern of TRP isoform appears to depend on the species and location in the vascular tree. For example, expression of TRPC1, TRPC5, and TRPC7 differs among canine and rat arteries.30–32,34 In rat pulmonary artery, 2 (TRPC3, TRPC5) of TRPC isoforms expressed in the proximal region (TRPC1, TRPC3–6)31 could not be identified in distal branches.34


View this table:
[in this window]
[in a new window]
 
Table 1. Major TRP Isoforms Expressed in CVS

Conditions that stimulate the VSMC growth or facilitate the remodeling of vascular tissues also likely affect the expression pattern of TRPC and may alter their associated functions. In human pulmonary arterial smooth muscle cells (PASMCs), upregulation of TRPC4, which is normally not expressed therein, was found to occur via CREB-mediated transcription, in response to a low-dose ATP that is known to stimulate PASMC growth.45 Similarly, in cultured PASMCs, serum stimulation and treatment with platelet-derived growth factor (PDGF) resulted in enhancement of TRPC1 and TRPC6 expression, respectively, with an associated increase in SOCs.46,47 The same pattern of upregulation of TRPC isoforms and associated Ca2+-transporting activities was shown to occur via expression of hypoxia inducible factor 1 (HIF-1) during chronic hypoxic insult.48

In the established aortic A7r5 cell line, the expression level of TRPC isoforms, as evaluated by quantitative RT-PCR, was found to vary considerably among different cell populations showing distinct functional properties. Whereas A7r5 cells abundantly expressing TRPC2, 3, and 6 exhibited NCCE in response to 8Arg-vasopressin (AVP), this Ca2+ entry was lost in cells devoid of these TRPC isoforms. In contrast, the expression level of TRPC1 was constant among different cell populations that showed salient CCE.49 It is possible that heteromultimerization of different sets of TRPC isoforms may account for such functional disparities.50,51

There is relative paucity of published data on the expression profile of other TRP members in VSMCs. However, a recent extensive survey for TRPM and TRPV subtypes by the RT-PCR technique reported that the majority of TRPM and TRPV subtypes including TRPM2–4, -7, and -8 and TRPV1–4 can be detected from deendothelialized, rat aorta and pulmonary artery. The rank of relative expression level evaluated by the quantitative PCR was found similar between these vascular tissues; TRPV4>TRPV2>TRPV1>>TRPV3; TRPM8>TRPM4>TRPM7>TRPM3>TRPM2>>TRPM5. Furthermore, salient Ca2+ responses could be induced, in response to menthol and 4{alpha}-phorbol 12,13-didecanoate (4{alpha}PDD), specific agonists for the 2 most predominantly expressed subtypes TRPM8 and TRPV4, respectively, suggesting that at least these subtypes are functional.44 In addition to this study, 4 other reports focusing on a particular TRP subtype confirmed both expression and functional significance of TRPV2 in murine aorta and mesenteric and basilar arteries, TRPV4 and TRPM4 in rat cerebral artery and TRPM7 in an embryonic aortic cell line A7r5, respectively.37,41–43 Our own survey with RT-PCR technique (rat aorta and cerebral and mesenteric arteries; Figure 2) gave almost consistent results with these. mRNA transcripts for 2 TRPV members (TRPV2 and -4), as well as 2 TRPM members (TRPM4, TRPM7) were constantly amplified from both conduit and peripheral arteries, whereas the expression of TRPM2 and TRPM8 appears region specific, being dominant in aorta but marginal in mesenteric artery. The reported expression of TRPV1 and TRPV3 in aorta and pulmonary artery may rather reflect contamination from perivascular sensory nerve endings in the arterial wall (the former may also be from remaining endothelial cells52) because these isoforms could not be detected from single VSMCs dissociated from either of the above 3 vascular tissues. Finally, a TRP-related protein, polycystin-2 (or PKD2), was found abundantly expressed in the aorta and cerebral circulation (see below), but no information is yet available for TRPML and TRPA members in VSMCs.


Figure 2
View larger version (71K):
[in this window]
[in a new window]
 
Figure 2. Expression profile of TRPV and TRPM isoforms in rat aorta and cerebral and mesenteric arteries, respectively. Total RNA extracted from the 3 vascular tissues were subjected to RT-PCR using the following protocol: preheating at 94°C for 1 minute followed by 35 cycles (denaturation at 94°C for 10 seconds; annealing at 58 to 65°C for 30 seconds; extension at 72°C for 1 minute) and final extension at 72°C for 10 minutes. Positive controls were obtained with RNA extracts from whole rat brain and kidney or HEK293 cells. Primer pairs used for each TRP isoform are as follows (forward/reverse [5' to 3']): GGGGATGCCTTGAAAGACCA / GCCAAGCTCAGCTGATCTGGA (TRPM1); CTTCCGGGAAGGCAAGGATGGT / GAGGCTCACTCCCTGCACGTT (TRPM2); GAGGAGACCATGTCCCCAACTT / GAGTAGCTGTTGGCGCGCT (TRPM3); GTCATCGTGAGCAAGATGATGAA / GTCCACCTTCTGGGACGTGC (TRPM4); CAAGTGTGACATGGTGGCCATCTT / GCTCAGGTGGCTGAGCAGGAT (TRPM5); GAGGAGATGGATGGGGGCCT / GGTCCAGTGAGAGAAAGCCAACAT (TRPM6); CCATACCATATTCTCCAAGGTTCC / CATTCCTCTTCAGATCTGGAAGTT (TRPM7); GAAGGCACCCAGATCAACCAAA / GAGCCTTCCACCACCACACA (TRPM8); GAAGATCGGGGTCTTGGCCTA / CTCACTGTAGCTGTCCACAAACAAA (TRPV1); GACGTGCCTGATGAAGGCTGT / CTGGTGTGGGTTCTCCAGGA (TRPV2); AGTGGCAACTGGGAGCTGG / GGGTCAGGGTGATGTTGTAGAAGA (TRPV3); GTGCCTGGGCCCAAGAAA / GGGCAGCTCCCCAAAGTAGAA (TRPV4); CTCACCCCCTTCAAGCTGGCT / CCCAGCATCTGGAATCCTCG (TRPV5); GCCGAGATGAGCAGAACCTGCT / GTCTGGTCCAGGATCTGGCGA (TRPV6).

The expression of TRP isoforms in cardiac tissues is only poorly characterized. Patchy information collected from whole heart tissue experiments indicate that several TRP isoforms such as TRPC1, TRPC4, TRPC6, TRPC7, TRPV2, TRPV4, TRPM4, and TRPM7, and some of TRP-related proteins including polycystins (TRPP2 or PKD2, TRPP3 or PKD2L1) and a mucolipidin (TRPML1), are detectable.19,53–57 A more systematic analysis of whole human heart with real-time PCR has shown that the order of relative expression of TRPC isoforms is TRPC1>TRPC4≥ TRPC6>TRPC5>>TRPC3, whereas the level of TRPC7 is below the detection limit.58 On the other hand, there are no studies quantitatively evaluating the expression of the other TRP family members, and little information is available as to the precise location of each TRP isoform within the heart tissue (eg, myocyte, fibroblast, nerve).

In summary, the above results collectively suggest that more than 10 members of TRP superfamily are expressed in cardiovascular muscle. In the following, we attempt to summarize the current knowledge available for these TRP channels in their possible connection to functions and diseases (Table and Figures 1 and 3Down).


Figure 3
View larger version (44K):
[in this window]
[in a new window]
 
Figure 3. TRP channels involved in vascular functions. In the most prevailing hypothesis,1,3,4 the magnitude of continuous Ca2+ influx through VDCC, which critically determines the contractile status of VSMC, decreases and increases by membrane hyperpolarization and depolarization, respectively. Several TRP isoforms likely function as the "depolarization" channels or direct Ca2+-entry pathways, which open in response to receptor stimulation by neurotransmitters released from perivascular sympathetic and sensory nerves or vasopressor hormones paracrinely and endocrinely released, and increased arterial wall tension, via elevation in [Ca2+]i or production of second messengers such as DAG and 20-HETE. Proproliferative stimuli such as growth factors, Ang II (AGII), endothelin (ET), and blood flow (shear stress) also activate at least 3 TRP isoforms (TRPC1, TRPC6, TRPM7) to stimulate VSMC growth, as Ca2+ or Mg2+ entry pathways. MS indicates mechanical stimulus; G, G protein; AC, adenylate cyclase; R, receptor. White hollow arrowheads and dotted arrows indicate external stimuli and intervening messengers activating vascular TRP channels, respectively. For more information, see the Table and text.


*    Arterial Tone Regulation
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowExpression Pattern of TRPs...
*Arterial Tone Regulation
down arrowVSMC Growth and Hyperplasia
down arrowVascular Integrity: Disruption...
down arrowTRPs in Vascular Diseases
down arrowPossible Roles of TRPs...
down arrowConclusions
down arrowNote Added in Proof
down arrowReferences
 
The wall tension of small arteries/arterioles is dynamically regulated by neurotransmitters released from perivascular nerves, circulating hormones, and autacoids locally released from the vascular endothelium and migrating blood cells. Among them, noradrenaline, angiotensin II (Ang II), vasopressin, and endothelin are the most broadly acting potent vasoconstrictors in the vasculature, whereas nitric oxide and endothelium-derived hyperpolarization factor (EDHF) serve as important vasorelaxants that counteract the vasoconstriction keeping arteries/arterioles toward a relaxed state.3,5,6,59 In addition to these neurohormonal factors, reflex vasoconstriction induced by intravascular pressure increase (the so-called "myogenic response" or Bayliss effect) is thought to be another important intrinsic mechanism that maintains the vascular tone.4 A considerable body of evidence has now accumulated to indicate that at least 5 TRP subtypes, ie, TRPC1, TRPC6, TRPM4, TRPV1, and TRPV4, are involved in these vasoregulatory mechanisms.

TRPC1 Connects SOC Activity to Vasoconstriction
TRPC1 is expressed widely in almost all types of VSMCs. There is good evidence to suggest that this protein serves as the essential component of SOC or CCE associated with vascular contractility,60–62 although whether it is a pore-forming subunit or merely a regulator of SOC is controversial.61,62 Overexpression of human TRPC1 in rat pulmonary artery with an adenoviral vector was shown to enhance store-depletion–induced Ca2+ entry and contraction.63 Conversely, acute application of TIE3 antibody, which specifically targets the putative outer TRPC1 channel pore and significantly inhibited CCE in pial arteriole,32 was shown to inhibit endothelin-1 (ET-1)–induced contraction of rat caudal artery.64 In this artery, disruption of caveolar structure by cholesterol depletion with ß-cyclodextrin caused a paralleled reduction of ET-1–induced vasoconstriction, SOC activity, and degree of colocalization of TRPC1 protein with caveolin-1 in the cell membrane. These observations suggest that activation of SOC and its relative importance in contraction may be greatly dependent on the caveolar localization of TRPC1 protein in a large signaling complex. In support of this speculation, it has been shown that TRPC1 can interact directly with a variety of signaling molecules and membrane-localized scaffolding/adaptor proteins (caveolin-1, homer, INAD, Gq/11 G protein, PLCß, inositol 1,4,5-trisphosphate [IP3] receptors, and plasmalemmal Ca2+-ATPase), being colocalized in caveolae or cholesterol-rich raft.19,25,65,66 Similar contribution of SOC activity of TRPC1 to vascular tone generation was also demonstrated in the rat model of hypoxia-induced pulmonary hypertension.67

TRPC6 Regulates the Vascular Tone As ROCC and MSCC
TRPC6 is another ubiquitous TRPC isoform expressed in the whole vasculature. Heterologously expressed TRPC6 behaves as a Ca2+-permeable NSCC activated by diacylglycerol (DAG) independently of PKC activation or store depletion, and phosphorylation by calmodulin-dependent kinases appears to play an indispensable role in this process.50,68–70 A similar activation profile has been found for several native ROCCs activated by physiological vasoconstrictors, such as {alpha}1-adrenoceptor–activated NSCCs in rabbit portal vein35,71,72 and rat mesenteric artery73 and NSCCs activated by vasopressin and Ang II in A7r5 cells.36,51,74 Activation of these channels and associated Ca2+ influx was strongly impaired by deletion of TRPC6 with its specific antisense oligodeoxynucleotide (ODN) pretreatment or small-interfering RNA (siRNA) silencing.35,74 Thus, it is highly likely that TRPC6 serves as the integral subunit forming these vasoconstrictor-activated ROCCs.

TRPC6 protein also likely contributes to mechanically induced vasoconstriction. A recent investigation by Welsh el al.75 has demonstrated that, in cannulated rat cerebral artery, antisense elimination of TRPC6 strongly attenuated pressure-induced vasoconstriction (myogenic response) and associated membrane depolarization, which secondarily activates voltage-dependent Ca2+ entry. According to previous studies, increased intravascular pressure facilitated endogenous production of DAG and IP3 in deendothelialized preparations,76 and the PLC inhibitor U73122 effectively inhibited vasoconstriction produced by pressurization.77,78 In freshly dissociated rat pulmonary, basilar, and coronary artery myocytes, it has been demonstrated that direct stretch can evoke TRPC-like single-channel activities in the patch membrane and contraction of arterial strips, both of which were inhibited by U73122 pretreatment.79 These observations point to the physiological importance of TRPC6-like channels as "MSCCs" in a broader definition that are indirectly activated via mechanical activation of the PLCß/DAG pathway to produce "myogenic" tone by its capability of depolarizing the VSMC membrane and enhancing Ca2+ influx through VGCCs.4,74 However, 20-hydroxyeicosatetraenoic acid (20-HETE), which is a potent vasoconstrictor lipid released from VSMCs by intravascular pressurization80,81 and has been shown to directly activate TRPC6,82 may also play an additional role in the above-described mechanical activation of vascular TRPC6-like channels.

The physiological importance of TRPC6 in both receptor-mediated and pressure-induced vasoconstrictions implies its pivotal role in blood pressure regulation. However, a recent study on TRPC6-deficient mice provided unexpected observations: elevated mean arterial blood pressure, exaggerated agonist responsiveness and myogenic response of isolated arteries, and increased basal and receptor-activated cation currents.83 Although the exact background is unclear, these seemingly counterintuitive results may reflect in part the overcompensatory expression (2-to 3-fold of wild-type mice) of TRPC3, which seems less tightly regulated by vasoconstrictor receptors than TRPC6 (TRPC3 shows a much higher spontaneous activity than TRPC6) and thus could not optimally replace the role of TRPC6 in in vivo situation.

TRPM4 Is Also Involved in Cerebral Blood Flow Autoregulation
In the cerebral circulation, blood flow is maintained almost constant within a wide range of blood pressure (ie, autoregulation), owing to a powerful myogenic response.4 This response likely involves the activation of VGCCs by depolarization following activation of MSCCs whose molecular entity is elusive. As described above, TRPC6 has been suggested as a good candidate for such MSCCs, but more candidates are emerging. Earley et al41 found that antisense elimination of TRPM4 protein, which is expressed in cerebral arteries and seems to function as a {approx}25 pS Ca2+-activated, monovalent cation-selective NSCC (CAN),28 also strongly attenuated the pressure-induced depolarization and accompanying development of vascular tone. Although the activation mechanism of TRPM4-like channels by pressurization remained unclear from this study, our preliminary observations84 showed that pretreatment with the ryanodine receptor (RyR) inhibitors, ryanodine and tetracaine, strongly suppressed stretch-induced activation of TRPM4-like channels on the same VSMC membrane. It is thus tempting to speculate that this RyR-dependent activation of TRPM4-like channels may involve increased Ca2+-spark activities by membrane stretch.85

Does TRPV4 in VSMC Mediate Endothelium-Dependent Hyperpolarization?
A paradoxical vasodilatory role of TRPV4 has come out from a recent study in cerebral circulation. Earley et al42 have proposed a new link between a putative EDHF candidate, 11,12 epoxyeicosatrienoic acids (EET),59 TRPV4 in VSMC, and vascular smooth muscle hyperpolarization and relaxation. In their observations, exogenously administered 11,12 EET and TRPV4 agonist 4{alpha}PDD86 activated TRPV4 currents and caused hyperpolarization and relaxation of pressurized cerebral artery, whereas application of TRPV4 inhibitor ruthenium red and antisense knockout of endogenous TRPV4 greatly attenuated these responses. Normally, activation of TRPV4 causes an increase in [Ca2+]i, and thus vasoconstriction rather than vasorelaxation is expected. A novel mechanism reconciling this apparent paradox relies on a complex sequence of several distinct processes, ie, activation of Ca2+ entry through TRPV4 channels by 11,12 EET->increased Ca2+ discharges from the sarcoplasmic reticulum (SR) (increase in Ca2+ spark frequency)->activation of a large conductance Ca2+-dependent K+ channel (BKCa) and resultant membrane hyperpolarization->reduced Ca2+ influx through VDCCs and decrease in [Ca2+]i and consequent vasorelaxation. This hypothesis assumes close spatial arrangements of several signaling molecules involved. However, several crucial questions have been raised against the relevance and generality of this hypothesis.87 First, 11, 12 EET was found ineffective to provoke a [Ca2+]i increase via activation of heterologously expressed TRPV4 channels.88 Second, VSMC hyperpolarization induced by EDHF or exogenously administered EETs is, in general, insensitive to iberiotoxin, a specific blocker of BKCa, but inhibited by a combination of charybdotoxin and apamin, blockers for intermediate and small conductance Ca2+-activated K+ channels (IKCa, SKCa). Thus, the most favored hypothesis suggests that EETs first activates endothelial IKCa and SKCa to cause hyperpolarization, which in turn spreads electronically to VSMC via myoendothelial gap junctions.59 Third, activation of single BKCa by 11,12 EET in inside-out patch membranes appears to occur through a Gs{alpha}-mediated mechanism rather than the direct effects of Ca2+.89 Finally, in rabbit pulmonary arteries, 11,12 EET has shown to cause vasoconstriction rather than relaxation,90 and Ca2+ sparks in these arteries appear to be linked to membrane depolarization.91 This means that the relationship between 11,12 EET/TRPV4/ryanodine receptor and the consequence of their activation may be dependent on the type of circulation. In addition to these questions, it is intriguing to examine whether endocannabinoids (eg, anandamide), which are also effective activators of expressed and endothelial TRPV4 channels,88,92 may exert vasodilatory actions through the same mechanism involving the TRPV4/RyR/BKCa signaling complex.

"Efferent Function" of Perivascular Sensory Nerve Is Mediated by TRPV1
As an additional mechanism involved in arterial tone regulation, the unique role of TRPV1 as the sensory effector channels93–95 has received attention. Scotland et al96 found that in small mesenteric resistance arteries, substantial part of the myogenic response was susceptible to blockade by capsazepine or desensitization with capsaicin. This capsazepine-sensitive component was independent of the presence of endothelium and strongly attenuated by the neurokinin 1 receptor (NK1) antagonist SR140333 or in transgenic mice lacking the functional NK1 receptor. Immunohistochemical analysis identified the expression of TRPV1, substance P, and CGRP within the mesenteric arterial wall, and capsazepine-inhibitable vasoconstriction could also be induced by exogenous application of 20-HETE. Taking these observations altogether, the authors hypothesized that 20-HETE produced in VSMCs in response to intravascular pressure increase80 diffuses to adjacent sensory nerve terminals and activate TRPV1 channels therein. This, in turn, triggers the release of substance P, which causes vasoconstriction via activation of NK1 receptors on VSMCs. Although recombinant TRPV1 has been shown to be responsive to various arachidonic acid products (leukotriene B4, 12-HPETE, 15-HPETE, 5-HETE, and 15HETE),97 there is no such evidence obtained for 20-HETE. It is also perplexing why and how activation of sensory TRPV1 by 20-HETE causes the preferential release of substance P to CGRP in the same type of arterial preparation where potent vasodilatation can be produced by CGRP.98 Indeed, in many types of arteries, it has been shown that activation of sensory TRPV1 channel leads to vasodilation rather than vasoconstriction via CGRP release in response to exogenously applied anandamide.98,99 Anandamide is actively biosynthesized in neurons, endothelial cells, and circulating macrophages and platelets and has been implicated in the pathogenesis of hypotension associated with hemorrhagic and endotoxin shocks and advanced liver cirrhosis.98,99 It has also been demonstrated by using the laser-Doppler perfusion imaging technique that cutaneous administration of anandamide increases the blood flow in human skin microcirculation in a manner sensitive to capsazepine blockade.100 Thus, 1 plausible explanation for these discrepant roles of TRPV1 in vasculature is that it may exert both positive and negative regulations on blood flow and pressure via sensory neuropeptide release depending on the type and region of circulation.

Potential Roles of Other TRPs in Vascular Tone Regulation
Although obtained data are still fragmental, a number of recent reports suggest a potential role of other TRP isoforms in vascular tone regulation by using the antisense strategy. In rat cerebral artery, TRPC3 has been implicated in membrane depolarization and vasoconstriction evoked by UTP, a potent endothelium-released vasoconstrictor.101 In both conduit and resistance arteries of the mouse, hypoosmolarity was shown to induce a nonselective cation conductance with concomitant elevation in [Ca2+]i, whereas overexpression of TRPV2 in CHO cells resulted in appearance of MSCC activities evoked by negative pressure in the patch pipette.37 This activation profile of TRPV2 suggests its role in mechanotransduction in VSMCs, but no evidence is yet available regarding this possibility. Similarly, no data are present for a TRPA member TRPA1 in vascular tissues, which has also been proposed to be MSCCs in inner-ear hair cell.102


*    VSMC Growth and Hyperplasia
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowExpression Pattern of TRPs...
up arrowArterial Tone Regulation
*VSMC Growth and Hyperplasia
down arrowVascular Integrity: Disruption...
down arrowTRPs in Vascular Diseases
down arrowPossible Roles of TRPs...
down arrowConclusions
down arrowNote Added in Proof
down arrowReferences
 
VSMCs are highly plastic and undergo rapid phenotypic switching through altered gene expression from the "differentiated" or "contractile" state to the highly "migratory" and "proliferative" state, eg, during vascular development, wound repair, and inflammatory occlusive diseases such as atherosclerosis and postangioplastic restenosis. This process often requires Ca2+ influx, which elevates [Ca2+]i in VSMCs to activate Ca2+-dependent transcriptional activities.103 Substantial evidence is now emerging that several TRP isoforms may contribute to this process.

TRPC1 Is Involved in Neointimal Hyperplasia After Vascular Injury
In rat cerebral and human internal mammary arteries, it was found that expression levels of TRPC1 and TRPC6 were increased by a short-term organ culture or after vascular injury caused by balloon dilatation.104 Similar upregulation of TRPC1 expression associated with decreased VGCC and augmented SOC activities can occur in mouse and rat carotid arteries in which the hyperplasia of VSMCs is experimentally induced by cuff injury. Moreover, organ culture of human saphenous veins obtained from patients taking coronary bypass graft surgery caused the neointimal growth of VSMCs, and this was effectively suppressed by the TRPC1-specific T1E3 antibody preventing intraluminal narrowing.105 Although additional contribution of other Ca2+-entry pathways cannot be excluded, these observations suggest indispensable contribution of TRPC1 to neointimal hyperplasia associated with vascular injury and simultaneously provides a new therapeutic direction toward the treatment of vascular proliferative disorders.

Proproliferative Role of TRPC6 in the Pathogenesis of Pulmonary Arterial Hypertension
Excessive proliferation of PASMCs is thought to be the main cause of pulmonary arterial medial hypertrophy, which narrows the intraluminal diameter, increases the resistance to blood flow, and eventually leads to pulmonary arterial hypertension.8 It has recently been reported that PASMCs from patients with idiopathic pulmonary arterial hypertension (IPAH) are hyperproliferative, with markedly increased expression of TRPC6 (and TRPC3 as well).106 Strikingly, both proliferation and TRPC6 expression in these cells were strongly attenuated by TRPC6-specific siRNA silencing. It seems thus likely that overexpression of TRPC6 protein may underlie the abnormally enhanced PASMC proliferation in IPAH patients.106 Interestingly, the endothelin receptor blocker bosentan, which is clinically used for the treatment of IPAH patients as an antiproliferative agent, was found to markedly downregulate TRPC6 expression.107 These findings imply that TRPC6 may serve as a common downstream signaling molecule of proproliferative mechanisms in pulmonary circulation.

Mg2+ Influx Through TRPM7 Regulates VSMC Growth
In A7r5 cells, it was found that prolonged application of Ang II (and aldosterone) enhanced the expression of TRPM7, intracellular Mg2+ level ([Mg2+]i), and incorporation of 3[H]-thymidine and 3[H]-leucine, and these effects were abolished by siRNA knockdown of TRPM7.43 A subsequent study by the same research group reported that, in cultured myocytes of small mesenteric artery from normotensive rats, Ang II can dose-dependently increase the expression of TRPM7 protein with concurrent elevation in [Mg2+]i, whereas these effects are defective in those from spontaneously hypertensive rats (SHR).108 Because reduction in [Mg2+]i is known to cause a variety of vascular dysfunctions and thus could be a risk factor of cardiovascular diseases,109 it is plausible that Mg2+ influx through TRPM7 may be a crucial determinant of Mg2+ homeostasis in VSMC and its growth/differentiation.

Does Flow-Dependent Expression of TRPM7 Contribute to VSMC Remodeling?
A recent report provided intriguing evidence that in A7r5, exposure to fluid flow rapidly increases endogenous TRPM7 expression and enhances constitutive NSCC conductance.110 A detailed investigation of heterologous systems expressing GFP-fused TRPM7 protein by the total internal reflection fluorescence microscopy suggested that flow-dependent activation of TRPM7 reflects the fast cell membrane fusion of TRPM7-containing vesicles that undergo highly dynamic subcellular cycling in close cell membrane proximity. This fast vesicular incorporation of TRPM7 protein occurred independently of its kinase domain and appears mechanistically different from that observed for TRPC5 on epidermal growth factor stimulation.111 It is expected that flow-dependent regulation of TRPM7 expression may become significant when VSMC is directly exposed to blood flow as a result of endothelial damage, eg, during vascular injury and atherosclerosis.


*    Vascular Integrity: Disruption of Polycystins Produces Vascular Fragility
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowExpression Pattern of TRPs...
up arrowArterial Tone Regulation
up arrowVSMC Growth and Hyperplasia
*Vascular Integrity: Disruption...
down arrowTRPs in Vascular Diseases
down arrowPossible Roles of TRPs...
down arrowConclusions
down arrowNote Added in Proof
down arrowReferences
 
Polycystins (TRPP1 and TRPP2) are gene products responsible for autosomal dominant polycystic disease (ADPKD)112 and expressed in the whole body including various types of arteries.113–115 Kim et al116 reported that homozygous disruption of the TRPP1 gene produces a vascular phenotype reminiscent of ADPKD, with increased vascular extravasation and rupture of blood vessels. In heterozygous TRPP2-null mutant mice, induction of hypertension by unilateral ligation of carotid artery caused rapid development of intracranial artery dilatation with irregular thickening and thinning in the tunica media layer, and increased the incidence of premature death.117 In freshly dissociated aortic myocytes from TRPP2+/– mice, the resting [Ca2+]i level and the amount of stored Ca2+ or the rate of Ca2+ entry activated by emptying internal stores were all significantly decreased, as compared with wild type.118 Importantly, reduction in [Ca2+]i was accompanied by elevation of intracellular cAMP concentration via decreased activities of Ca2+-stimulated phosphodiesterase PDE4, leading to increased rate of proliferation and apoptosis.118 It is likely that disrupted Ca2+ homeostasis resulting from defective Ca2+-transporting activity of TRPP2 causes a variable extent of imbalance of proliferation and apoptosis in respective cells, producing structural disorganization of arterial wall and consequent vascular fragility, manifested as intracranial and aortic aneurysms or thoracic aortic dissection.112,117 Thus, polycystins likely play a pivotal role in the maintenance of vascular integrity and resistance to hemodynamic stress.


*    TRPs in Vascular Diseases
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowExpression Pattern of TRPs...
up arrowArterial Tone Regulation
up arrowVSMC Growth and Hyperplasia
up arrowVascular Integrity: Disruption...
*TRPs in Vascular Diseases
down arrowPossible Roles of TRPs...
down arrowConclusions
down arrowNote Added in Proof
down arrowReferences
 
As described above, many of TRP isoforms expressed in VSMCs show the features suggestive of their intriguing connection to vascular diseases. The most convincing evidence has been demonstrated for the causative significance of TRPC6 upregulation in IPAH106 and of polycystin mutations in ADPKD-associated vascular fragility.117 Although there is no clinical evidence, the effectiveness of TRPC1-specific antibody (T1E3) in inhibiting postangioplastic neointimal hyperplasia has also given us a fresh insight into the pathogenesis of vascular occlusive diseases such as atherosclerosis. This simultaneously provides a new therapeutic strategy for the treatment of these diseases. Dysfunction of several vasoactive TRP channels could be a potential mechanism underlying altered vascular reactivity and might thus be involved in the progression of hypertension.119 Indeed, although unequivocal evidence linking them to dysregulation of blood pressure at whole-body level is still lacking (see eg, ref.83), a very recent study has reported that in patients with essential hypertension, expression of TRPC3 and TRPC5 is significantly increased with concomitant increase in Gd3+-sensitive Ca2+ influx, as compared with normotensive controls.120 Notable evidence has also been presented for the protective role of vasosensory TRPV1-mediated CGRP release against the development of salt-sensitive hypertension through both vasodilatory and natriuretic–diuretic actions, in a human salt-sensitive hypertension model, Dahl salt-sensitive rats.121,122 In addition to these, it is also tempting to speculate possible involvement of decreased TRPM7 expression in the pathogenesis of hypertension via compromised Mg2+ homeostasis in VSMCs (see above).108


*    Possible Roles of TRPs in Cardiac Functions and Diseases
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowExpression Pattern of TRPs...
up arrowArterial Tone Regulation
up arrowVSMC Growth and Hyperplasia
up arrowVascular Integrity: Disruption...
up arrowTRPs in Vascular Diseases
*Possible Roles of TRPs...
down arrowConclusions
down arrowNote Added in Proof
down arrowReferences
 
TRPs in cardiac tissues have just begun to be elucidated, thus lacking unequivocal evidence linked to specific functions. However, it is worthwhile considering a number of key observations, which will briefly be summarized in the following.

Pace Making and Arrhythmogenesis
Tight physical association and functional coupling of TRPC3 and Na+/Ca2+ exchanger type 1 (NCX1) was demonstrated in heterologous expression systems.123 This coupling may be potentially important in cardiac myocytes, because abnormally increased intracellular Na+ concentration attributable to sustained Na+ entry through TRPC3 channels may cause Ca2+ overload via the reverse-mode operation of Na+/Ca2+ exchanger.124 This may increase the risk of arrhythmia by provoking "delayed afterdepolarizations."125 TRPC1 may be the essential part of MSCCs126 in the skeletal muscle of dystrophic mdx mice127 that are effectively blocked by a spider venom toxin GsMTx4.128 Because similar MSCCs were identified in cardiac myocytes129 and GsMTx4 inhibited the stretch-induced atrial fibrillation in animal model,130 TRPC1 may be importantly involved in mechanically induced arrhythmia.

TRPM4 and TRPM7 are expressed at relatively high level in cardiac tissues.19,20,28 When heterologously expressed, these TRPM proteins act as a Ca2+-activated nonselective cation channel (CAN) and a constitutively activated (or background) cation channel, respectively.28 Similar channel activities (or conductances) were previously identified in cardiac myocytes by the patch clamp technique.28,131–133 This raises a possibility that these 2 TRPM isoforms may play a role in pace-making and "arrhythmogenic" delayed afterdepolarizations.125,131–134

Depressor Effects of Sensory TRPV1
The cardiac tissues receive sensory inputs, and systemic administration of anandamide was shown to produce depressor effects (negative inotropy and bradycardia) partially sensitive to TRPV1 antagonist capsazepine. However, targeted deletion of TRPV1 gene only affected the initial transient changes in heart rate and contractility in response to a bolus injection of anandamide without significant changes in baseline cardiac characteristics.135 Thus, the physiological impact of sensory nerve activities on in vivo cardiac functions remains unclear.

Cardiomyopathy
In the sarcolemmal region of striated muscles of dystrophic human patients and animal models deficient in dystrophin or {delta}-sarcoglycan, TRPV2 (or growth factor-regulated Ca2+ channel136) is unusually enriched.137 In dystrophic skeletal myotubes, cyclic stretch facilitated the translocation of TRPV2 protein to the sarcolemmal region, causing great enhancement of Ca2+ influx and cell damage. Cardiac-specific overexpression of TRPV2 protein in transgenic mice resulted in its elevated expression in the sarcolemma and enlargement of all heart chambers associated with compromised systolic performance, findings similar to those obtained for dystrophic animals and patients.137 These results together suggest that TRPV2 may be responsible for cardiac muscle degeneration as a sustained Ca2+ overloading pathway and hence may be involved in the pathogenesis of dystrophic cardiomyopathy.

Polycystins are expressed in the heart, and homozygous disruption of these genes was demonstrated to produce lethal abnormalities in cardiac morphogenesis.138 It has been reported that a TRPP2-like large conductance single cation channel activity can be recorded from single dissociated cardiac myocytes.139 There is also evidence that a TRPP2 homolog TRPP4 (or PKD2L2), which shows more than 50% sequence homology to TRPP2, is expressed abundantly in heart and functions as a hypotonically activated Ca2+-permeable NSCC when coexpressed with TRPP1.140 In other studies, TRPP2 and TRPP3 (or PKD2L1) have been shown to bind to actin cytoskeleton through troponin I and tropomyosin, thereby being regulated for their channel activities.141,142 Considering the evidence that epithelial TRPP2 is activated by fluid flow,143 these observations might point to a yet-unidentified role of polycystins in mechanotransduction in the heart, most intriguingly, in pressure-overload–induced cardiomyopathies.144,145

TRPML1 is expressed in a wide range of tissues including the heart and was reported to function as intracellular Ca2+-permeable channel. It was shown that mutations in mucolipidosis IV patients cause impaired lysosomal sorting and trafficking and consequent neurogenerative disorders.19–22,146 There is, however, no evidence for these mutations to contribute to cardiac muscle degeneration.

Cardiac Hypertrophy
Downregulation of Ca2+-ATPase SERCA2 by siRNA silencing in cultured cardiac myocytes has been shown to induce compensatory increase in Na+/Ca2+ exchanger, TRPC4 and TRPC5, and several transcriptional factors such as stimulating protein 1, myocyte enhancer factor 2 (MEF2), and nuclear factor of activated cells 4 (NFAT4).147 These data may imply possible involvement of these TRP isoforms, in addition to other abundantly expressed cardiac TRP isoforms (TRPC1, TRPC3), in cardiac hypertrophy,148 but no direct proof is yet available.


*    Conclusions
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowExpression Pattern of TRPs...
up arrowArterial Tone Regulation
up arrowVSMC Growth and Hyperplasia
up arrowVascular Integrity: Disruption...
up arrowTRPs in Vascular Diseases
up arrowPossible Roles of TRPs...
*Conclusions
down arrowNote Added in Proof
down arrowReferences
 
The emergence of TRP channels kindled the molecular elucidation of long-enigmatic Ca2+-entry pathways linked to diverse cardiovascular functions. However, this has now been met by some confusion and perplexity arising from the great diversity and redundancy of TRP proteins involved. For example, the classical concept of mechanotransduction in vascular tissues seems to require substantial revision by taking into account several distinct modes of activation including at least 4 TRP isoforms, TRPC6, TRPV1, TRPV2, and TRPM4. In a similar context, TRP candidates involved in VSMC proliferation are also divergent and redundant, where multiple isoforms contribute to the regulation of proliferation in the same type of VSMC (Figure 3). Conversely, it is also not rare to find that single TRP isoform plays a multifaceted role. One good example is TRPC6, which has been implicated not only in receptor-mediated and mechanosensitive vasoconstriction but also in PASMC proliferation and associated disease IPAH. Unfortunately, we are still at the early stage of simply listing possible linkages of TRP proteins with in vivo functions and, in most cases, have no definite answers to questions such as why such diversity and redundancy are necessary or how and to what extent respective TRP channels are mutually related and contribute in the context of cardiovascular functions. Nevertheless, considering their unprecedented unique properties strongly reminiscent of many cellular functions that have yet to be elucidated, TRP channels will undoubtedly continue to be fascinating new therapeutic targets for various cardiovascular disorders and diseases, the pathogenic mechanism of which remains largely unclear. Further progress in the elucidation of TRP isoforms is eagerly awaited.


*    Note Added in Proof
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowExpression Pattern of TRPs...
up arrowArterial Tone Regulation
up arrowVSMC Growth and Hyperplasia
up arrowVascular Integrity: Disruption...
up arrowTRPs in Vascular Diseases
up arrowPossible Roles of TRPs...
up arrowConclusions
*Note Added in Proof
down arrowReferences
 
A very recent report described a new role of Ca2+ influx through TRPC1/TRPC5 heteromultimeric channel for sphingosin-1 phosphate-evoked human VSMC motility.149


*    Acknowledgments
 
Sources of Funding

This work was supported by grants-in-aid from the Japan Society for the Promotion of Science (nos. 14570079 and 17590221 to R.I.).

Disclosures

None.


*    Footnotes
 
Original received June 30, 2005; resubmission received June 5, 2006; revised resubmission received June 9, 2006; accepted June 12, 2006.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowExpression Pattern of TRPs...
up arrowArterial Tone Regulation
up arrowVSMC Growth and Hyperplasia
up arrowVascular Integrity: Disruption...
up arrowTRPs in Vascular Diseases
up arrowPossible Roles of TRPs...
up arrowConclusions
up arrowNote Added in Proof
*References
 
1. Nelson MT, Patlak JB, Worley JF, Standen NB. Calcium channels, potassium channels, and voltage-dependence of arterial smooth muscle tone. Am J Physiol. 1990; 259: C3–C18.[Medline] [Order article via Infotrieve]

2. McDonald TF, Pelzer S, Trautwein W, Pelzer DJ. Regulation and modulation of calcium channels in cardiac, skeletal, and smooth muscle cells. Physiol Rev. 1994; 74: 365–507.[Free Full Text]

3. Kuriyama H, Kitamura K, Itoh T, Inoue R. Physiological features of visceral smooth muscle cells, with special reference to receptors and ion channels. Physiol Rev. 1998; 78: 811–920.[Abstract/Free Full Text]

4. Davis MJ, Hill MA. Signaling mechanisms underlying the vascular myogenic response. Physiol Rev. 1999; 79: 387–423.[Abstract/Free Full Text]

5. Inoue R, Morita H, Ito Y. Newly emerging Ca2+ entry channel molecules that regulate the vascular tone. Expert Opin Ther Targets. 2004; 8: 321–334.[CrossRef][Medline] [Order article via Infotrieve]

6. Large WA. Receptor-operated Ca2+-permeable nonselective cation channels in vascular smooth muscle: a physiologic perspective. J Cardiovasc Electrophysiol. 2002; 13: 493–501.[CrossRef][Medline] [Order article via Infotrieve]

7. Maier LS, Bers DM. Calcium, calmodulin, and calcium-calmodulin kinase II: heartbeat to heartbeat and beyond. J Mol Cell Cardiol. 2002; 34: 919–939.[CrossRef][Medline] [Order article via Infotrieve]

8. Mandegar M, Remillard CV, Yuan JX. Ion channels in pulmonary arterial hypertension. Prog Cardiovasc Dis. 2002; 45: 81–114.[CrossRef][Medline] [Order article via Infotrieve]

9. Berry C, Touyz R, Dominiczak AF, Webb RC, Johns DG. Angiotensin receptors: signaling, vascular pathophysiology, and interactions with ceramide. Am J Physiol Heart Circ Physiol. 2001; 281: H2337–H2365.[Abstract/Free Full Text]

10. Varro A, Nanasi PP, Acsai K, Virag L, Papp JG. Cardiac sarcolemmal ion channels and transporters as possible targets for antiarrhythmic and positive inotropic drugs: strategies of the past–perspectives of the future. Curr Pharm Des. 2004; 10: 2411–2427.[CrossRef][Medline] [Order article via Infotrieve]

11. Hofmann F, Lacinova L, Klugbauer N. Voltage-dependent calcium channels: from structure to function. Rev Physiol Biochem Pharmacol. 1999; 139: 33–87.[Medline] [Order article via Infotrieve]

12. Bolton TB. Mechanisms of actions of neurotransmitters and other substances on smooth muscle. Physiol Rev. 1979; 59: 606–718.[Free Full Text]

13. Taylor CW, Moneer Z. Regulation of capacitative and non-capacitative Ca2+ entry in A7r5 vascular smooth muscle cells. Biol Res. 2004; 37: 641–645.[Medline] [Order article via Infotrieve]

14. Parekh AB, Putney JW Jr. Store-operated calcium channels. Physiol Rev. 2005; 85: 757–810.[Abstract/Free Full Text]

15. Sachs F, Morris CE. Mechanosensitive ion channels in nonspecialized cells. Rev Physiol Biochem Pharmacol. 1998; 132: 1–77.[Medline] [Order article via Infotrieve]

16. Hamill OP, Martinac B. Molecular basis of mechanotransduction in living cells. Physiol Rev. 2001; 81: 685–740.[Abstract/Free Full Text]

17. Nilius B. Store-operated Ca2+ entry channels: still elusive! Sci STKE. 2004; 243: pe36.

18. Parekh AB. Cell biology: cracking the calcium entry code. Nature. 2006; 441: 163–165.[CrossRef][Medline] [Order article via Infotrieve]

19. Montell C. The TRP superfamily of cation channels. Sci STKE. 2005; 272: re3.

20. Clapham DE. TRP channels as cellular sensors. Nature. 2003; 426: 517–524.[CrossRef][Medline] [Order article via Infotrieve]

21. Pedersen SF, Owsianik G, Nilius B. TRP channels: an overview. Cell Calcium. 2005; 38: 233–252.[CrossRef][Medline] [Order article via Infotrieve]

22. Nilius B, Voets T, Peters J. TRP channels in disease. Sci STKE. 2005 ;295: re8.

23. Hardie RC, Minke B. Novel Ca2+ channels underlying transduction in Drosophila photoreceptors: implications for phosphoinositide-mediated Ca2+ mobilization. Trend Neurosci. 1993; 16: 371–376.[CrossRef][Medline] [Order article via Infotrieve]

24. Nilius B, Talavera K, Owsianik G, Prenen J, Droogmans G, Voets T. Gating of TRP channels: a voltage connection? J Physiol. 2005; 567: 35–44.[Abstract/Free Full Text]

25. Nilius B, Droogmans G. Ion channels and their functional role in vascular endothelium. Physiol Rev. 2001; 81: 1415–1459.[Abstract/Free Full Text]

26. Vazquez G, Wedel BJ., Aziz O, Trebak M, Putney JW Jr. The mammalian TRPC cation channels. Biochim Biophys Acta. 2004; 1742: 21–36.[Medline] [Order article via Infotrieve]

27. Gunthorpe MJ, Benham CD, Randall A, Davis JB. The diversity in the vanilloid (TRPV) receptor family of ion channels. Trend Pharmacol Sci. 2002; 23: 183–191.[CrossRef][Medline] [Order article via Infotrieve]

28. Fleig A, Penner R. The TRPM ion channel subfamily: molecular, biophysical and functional features. Trend Pharmacol Sci. 2004; 25: 633–639.[CrossRef][Medline] [Order article via Infotrieve]

29. Vriens JA, Owsianik GA, Voets T, Droogmans GA, Nilius B. Invertebrate TRP proteins as functional models for mammalian channels. Pflug Arch Eur J Physiol. 2004; 449: 213–226.[Medline] [Order article via Infotrieve]

30. Walker RL, Hume JR, Horowitz B. Differential expression and alternative splicing of TRP channel genes in smooth muscles. Am J Physiol Cell Physiol. 2001; 280: C1184–C1192.[Abstract/Free Full Text]

31. Ng LC, Gurney AM. Store-operated channels mediate Ca2+ influx and contraction in rat pulmonary artery. Circ Res. 2001; 89: 923–929.[Abstract/Free Full Text]

32. Xu SZ, Beech DJ. TRPC1 is a membrane-spanning subunit of store-operated Ca2+ channels in native vascular smooth muscle cells. Circ Res. 2001; 88: 84–87.[Abstract/Free Full Text]

33. Golovina VA, Platoshyn O, Bailey CL, Wang J, Limsuwan A, Facemire CS, Mohler PJ, Arendshorst WJ. Expression and relative abundance of short transient receptor potential channels in the rat renal microcirculation. Am J Physiol Renal Physiol. 2004; 286: F546–F551.[Abstract/Free Full Text]

34. Wang J, Shimoda LA, Sylvester JT. Capacitative calcium entry and TRPC channel proteins are expressed in rat distal pulmonary arterial smooth muscle. Am J Physiol Lung Cell Mol Physiol. 2004; 286: L848–L858.[Abstract/Free Full Text]

35. Inoue R, Okada T, Onoue H, Hara Y, Shimizu S, Naitoh S, Ito Y, Mori Y. The transient receptor potential protein homologue TRP6 is the essential component of vascular {alpha}1-adrenoceptor-activated Ca2+-permeable cation channel. Circ Res. 2001; 88: 325–332.[Abstract/Free Full Text]

36. Jung S, Strotmann R, Schultz G, and Plant TD. TRPC6 is a candidate channel involved in receptor-stimulated cation currents in A7r5 smooth muscle cells. Am J Physiol Cell Physiol. 2002; 282: C347–C359.[Abstract/Free Full Text]

37. Muraki K, Iwata Y, Katanosaka Y, Ito T, Ohya S, Shigekawa M, Imaizumi Y. TRPV2 is a component of osmotically sensitive cation channels in murine aortic myocytes. Circ Res. 2003; 93: 829–838.[Abstract/Free Full Text]

38. Corteling RL, Li S, Giddings J, Westwick J, Poll C, Hall IP. Expression of transient receptor potential C6 and related transient receptor potential family members in human airway smooth muscle and lung tissue. Am J Respir Cell Mol Biol. 2004; 30: 145–154.[Abstract/Free Full Text]

39. Yip H, Chan WY, Leung PC, Kwan HY, Liu C, Huang Y, Michel V, Yew DT, Yao X. Expression of TRPC homologs in endothelial cells and smooth muscle layers of human arteries. Histochem Cell Biol. 2004; 122: 553–561.[CrossRef][Medline] [Order article via Infotrieve]

40. Facemire CS, Mohler PJ, Arendshorst WJ. Expression and relative abundance of short transient receptor potential channels in the rat renal microcirculation. Am J Physiol Renal Physiol. 2004; 286: F546–F551.[Abstract/Free Full Text]

41. Earley S, Waldron BJ, Brayden JE. Critical role for transient receptor potential channel TRPM4 in myogenic constriction of cerebral arteries. Circ Res. 2004; 95: 922–929.[Abstract/Free Full Text]

42. Earley S, Heppner TJ, Nelson MT, Brayden JE. TRPV4 forms a novel Ca2+ signaling complex with ryanodine receptors and BKCa channels. Circ Res. 2005; 97: 1270–1279.[Abstract/Free Full Text]

43. He Y, Yao G, Savoia C, Touyz RM. Transient receptor potential melastatin 7 ion channels regulate magnesium homeostasis in vascular smooth muscle cells: role of angiotensin II. Circ Res. 2005; 96: 207–215.[Abstract/Free Full Text]

44. Yang XR, Lin MJ, McIntosh LS, Sham JS. Functional expression of transient receptor potential melastatin- and vanilloid-related channels in pulmonary arterial and aortic smooth muscle. Am J Physiol Lung Cell Mol Physiol. 2006; 290: L1267–L1276.[Abstract/Free Full Text]

45. Zhang S, Remillard CV, Fantozzi I, Yuan JX. ATP-induced mitogenesis is mediated by cyclic AMP response element-binding protein-enhanced TRPC4 expression and activity in human pulmonary artery smooth muscle cells. Am J Physiol Cell Physiol. 2004; 287: C1192–C1201.[Abstract/Free Full Text]

46. Golovina VA, Platoshyn O, Bailey CL, Wang J, Limsuwan A, Sweeney M, Rubin LJ, Yuan JX. Upregulated TRP and enhanced capacitative Ca2+ entry in human pulmonary artery myocytes during proliferation. Am J Physiol Heart Circ Physiol. 2001; 280: H746–H755.[Abstract/Free Full Text]

47. Yu Y, Sweeney M, Zhang S, Platoshyn O, Landsberg J, Rothman A, Yuan JX. PDGF stimulates pulmonary vascular smooth muscle cell proliferation by upregulating TRPC6 expression. Am J Physiol Cell Physiol. 2003; 284: C316–C330.[Abstract/Free Full Text]

48. Wang J, Weigand L, Lu W, Sylvester JT, Semenza GL, Shimoda LA. Hypoxia inducible factor 1 mediates hypoxia-induced TRPC expression and elevated intracellular Ca2+ in pulmonary arterial smooth muscle cells. Circ Res. 2006; 98: 1528–1537.[Abstract/Free Full Text]

49. Moneer Z, Pino I, Taylor EJ, Broad LM, Liu Y, Tovey SC, Staali L, Taylor CW. Different phospholipase C-coupled receptors differentially regulate capacitative and non-capacitative Ca2+ entry in A7r5 cells. Biochem J. 2005; 389: 821–829.[CrossRef][Medline] [Order article via Infotrieve]

50. Dietrich A, Kalwa H, Rost BR, Gudermann T. Functional characterization and physiological relevance of the TRPC3/6/7 subfamily of cation channels. Naunyn Schmiedebergs Arch Pharmacol. 2005; 451: 72–80.[CrossRef]

51. Maruyama Y, Nakanishi Y, Walsh EJ, Wilson DP, Welsh DG, Cole WC. Heteromultimeric TRPC6-TRPC7 channels contribute to arginine vasopressin-induced cation current of A7r5 vascular smooth muscle cells. Circ Res. 2006; 98: 1520–1527.[Abstract/Free Full Text]

52. Yao X, Garland CJ. Recent developments in vascular endothelial cell transient receptor potential channels. Circ Res. 2005; 97: 853–863.[Abstract/Free Full Text]

53. Satoh E, Ono K, Xu F, Iijima T. Cloning and functional expression of a novel splice variant of rat TRPC4. Circ J. 2002; 66: 954–958.[CrossRef][Medline] [Order article via Infotrieve]

54. Strotmann R, Harteneck C, Nunnenmacher K, Schultz G, Plant TD. OTRPC4, a nonselective cation channel that confers sensitivity to extracellular osmolarity. Nat Cell Biol. 2000; 2: 695–702.[CrossRef][Medline] [Order article via Infotrieve]

55. Peng JB, Chen XZ, Berger UV, Vassilev PM, Tsukaguchi H, Brown EM, Hediger MA. Molecular cloning and characterization of a channel-like transporter mediating intestinal calcium absorption. J Biol Chem. 1999; 274: 22739–22746.[Abstract/Free Full Text]

56. Peng JB, Chen XZ, Berger UV, Vassilev PM, Brown EM, Hediger MA. A rat kidney-specific calcium transporter in the distal nephron. J Biol Chem. 2000; 275: 28186–28194.[Abstract/Free Full Text]

57. Nijenhuis T, Hoenderop JG, van der Kemp AW, Bindels RJ. Localization and regulation of the epithelial Ca2+ channel TRPV6 in the kidney. J Am Soc Nephrol. 2003; 14: 2731–2740.[Abstract/Free Full Text]

58. Riccio A, Medhurst AD, Mattei M, Kelsell RE, Calver AR, Randall AD, Benham CD, Pangalos MN. mRNA distribution analysis of human TRPC family in CNS and peripheral tissues. Mol Brain Res. 2002; 109: 95–104.[Medline] [Order article via Infotrieve]

59. Fleming I, Busse R. Endothelium-derived epoxyeicosatrienoic acids and vascular function. Hypertension. 2006; 47: 629–633.[Abstract/Free Full Text]

60. Gibson A, McFadzean I, Wallace P, Wayman CP. Capacitative Ca2+ entry and the regulation of smooth muscle tone. Trends Pharmacol Sci. 1998; 19: 266–269.[CrossRef][Medline] [Order article via Infotrieve]

61. Albert AP, Large WA. Store-operated Ca2+-permeable non-selective cation channels in smooth muscle cells. Cell Calcium. 2003; 33: 345–356.[CrossRef][Medline] [Order article via Infotrieve]

62. Beech DJ, Xu SZ, McHugh D, Flemming R. TRPC1 store-operated cationic channel subunit. Cell Calcium. 2003; 33: 433–440.[CrossRef][Medline] [Order article via Infotrieve]

63. Kunichika N, Yu Y, Remillard CV, Platoshyn O, Zhang S, Yuan JX. Overexpression of TRPC1 enhances pulmonary vasoconstriction induced by capacitative Ca2+ entry. Am J Physiol Lung Cell Mol Physiol. 2004; 287: L962–L929.[Abstract/Free Full Text]

64. Bergdahl A, Gomez MF, Dreja K, Xu SZ, Adner M, Beech DJ, Broman J, Hellstrand P, Sward K. Cholesterol depletion impairs vascular reactivity to endothelin-1 by reducing store-operated Ca2+ entry dependent on TRPC1. Circ Res. 2003; 93: 839–847.[Abstract/Free Full Text]

65. Lockwich TP, Liu X, Singh BB, Jadlowiec J, Weiland S, Ambudkar IS. Assembly of Trp1 in a signaling complex associated with caveolin-scaffolding lipid raft domains. J Biol Chem. 2000; 275: 11934–11942.[Abstract/Free Full Text]

66. Yuan JP, Kiselyov K, Shin DM, Chen J, Shcheynikov N, Kang SH, Dehoff MH, Schwarz MK, Seeburg PH, Muallem S, Worley PF. Homer binds TRPC family channels and is required for gating of TRPC1 by IP3 receptors. Cell. 2003; 114: 777–789.[CrossRef][Medline] [Order article via Infotrieve]

67. Lin MJ, Leung GP, Zhang WM, Yang XR, Yip KP, Tse CM, Sham JS. Chronic hypoxia-induced upregulation of store-operated and receptor-operated Ca2+ channels in pulmonary arterial smooth muscle cells: a novel mechanism of hypoxic pulmonary hypertension. Circ Res. 2004; 95: 496–505.[Abstract/Free Full Text]

68. Hofmann T, Obukhov AG, Schaefer M, Harteneck C, Gudermann T, Schult Z. Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol. Nature. 1999; 397: 259–263.[CrossRef][Medline] [Order article via Infotrieve]

69. Trebak M, Vazquez G, Bird GS, Putney JW Jr. The TRPC3/6/7 subfamily of cation channels. Cell Calcium. 2003; 33: 451–461.[CrossRef][Medline] [Order article via Infotrieve]

70. Shi J, Mori E, Mori Y, Mori M, Li J, Ito Y, Inoue R. Multiple regulation by calcium of murine homologues of transient receptor potential proteins TRPC6 and TRPC7 expressed in HEK293 cells. J Physiol. 2004; 561: 415–432.[Abstract/Free Full Text]

71. Helliwell RM, Large WA. {alpha}1-Adrenoceptor activation of a non-selective cation current in rabbit portal vein by 1,2-diacyl-sn-glycerol. J Physiol. 1997; 499: 417–428.[Abstract/Free Full Text]

72. Aromolaran AS, Albert AP, Large WA. Evidence for myosin light chain kinase mediating noradrenaline-evoked cation current in rabbit portal vein myocytes. J Physiol. 2000; 524: 853–863.[Abstract/Free Full Text]

73. Hill AJ, Hinton JM, Cheng H, Gao Z, Bates DO, Hancox JC, Langton PD, James AF. A TRPC-like non-selective cation current activated by {alpha}l-adrenoceptors in rat mesenteric artery smooth muscle cells. Cell Calcium. 2006; 40: 29–40.[CrossRef][Medline] [Order article via Infotrieve]

74. Soboloff J, Spassova M, Xu W, He LP, Cuesta N, Gill DL. Role of endogenous TRPC6 channels in Ca2+ signal generation in A7r5 smooth muscle cells. J Biol Chem. 2005; 280: 39786–39794.[Abstract/Free Full Text]

75. Welsh DG, Morielli AD, Nelson MT, Brayden JE. Transient receptor potential channels regulate myogenic tone of resistance arteries. Circ Res. 2002; 90: 248–250.[Abstract/Free Full Text]

76. Narayanan J, Imig M, Roman RJ, Harder DR. Pressurization of isolated renal arteries increases inositol trisphosphate and diacylglycerol. Am J Physiol. 1994; 266: H1840–H1845.[Medline] [Order article via Infotrieve]

77. Osol G, Laher I, Kelley M. Myogenic tone is coupled to phospholipase C and G protein activation in small cerebral arteries. Am J Physiol. 1993; 265: H415–H420.[Medline] [Order article via Infotrieve]

78. Matsumoto H, Baron CB, Coburn RF. Smooth muscle stretch-activated phospholipase C activity. Am J Physiol. 1995; 268: C458–C465.[Medline] [Order article via Infotrieve]

79. Park KS, Kim Y, Lee YH, Earm YE, Ho WK. Mechanosensitive cation channels in arterial smooth muscle cells are activated by diacylglycerol and inhibited by phospholipase C inhibitor. Circ Res. 2003; 93: 557–564.[Abstract/Free Full Text]

80. Harder DR, Lange AR, Gebremedhin D, Birks EK, Roman RJ. Cytochrome P450 metabolites of arachidonic acid as intracellular signaling molecules in vascular tissue. J Vasc Res. 1997; 34: 237–243.[Medline] [Order article via Infotrieve]

81. Roman RJ. P-450 metabolites of arachidonic acid in the control of cardiovascular function. Physiol Rev. 2002; 82: 131–185.[Abstract/Free Full Text]

82. Basora N, Boulay G, Bilodeau L, Rousseau E, Payet MD. 20-Hydroxyeicosatetraenoic acid (20-HETE) activates mouse TRPC6 channels expressed in HEK293 cells. J Biol Chem. 2003; 278: 31709–31716.[Abstract/Free Full Text]

83. Dietrich A, Mederos Y Schnitzler M, Gollasch M, Gross V, Storch U, Dubrovska G, Obst M, Yildirim E, Salanova B, Kalwa H, Essin K, Pinkenburg O, Luft FC, Gudermann T, Birnbaumer L. Increased vascular smooth muscle contractility in TRPC6–/- mice. Mol Cell Biol. 2005; 25: 6980–6989.[Abstract/Free Full Text]

84. Morita H, Honda A, Inoue R, Ito Y, Brayden JE, Nelson MT. Membrane stretch activates a Ca2+-sensitive, non-selective cation channel via intracellular Ca2+ release in rat cerebral arterial myocytes. J Pharmacol Sci. 2004; 94 (Suppl I): 218P.

85. Jaggar JH, Porter VA, Lederer WJ, Nelson MT. Calcium sparks in smooth muscle. Am J Physiol. 2000; 278: C235–C256.

86. Watanabe H, Davis JB, Smart D, Jerman JC, Smith GD, Hayes P, Vriens J, Cairns W, Wissenbach U, Prenen J, Flockerzi V, Droogmans G, Benham CD, Nilius B. Activation of TRPV4 channels (hVRL-2/mTRP12) by phorbol derivatives. J Biol Chem. 2002; 277: 13569–13577.[Abstract/Free Full Text]

87. Kotlikoff MI. EDHF redux: EETs, TRPV4, and Ca2+ sparks. Circ Res. 2005; 97: 1209–1210.[Free Full Text]

88. Watanabe H, Vriens J, Prenen J, Droogmans G, Voets T, Nilius B. Anandamide and arachidonic acid use epoxyeicosatrienoic acids to activate TRPV4 channels. Nature. 2003; 424: 434–438.[CrossRef][Medline] [Order article via Infotrieve]

89. Li PL, Campbell WB. Epoxyeicosatrienoic acids activate K+ channels in coronary smooth muscle through a guanine nucleotide binding protein. Circ Res. 1997; 80: 877–884.[Abstract/Free Full Text]

90. Zhu D, Bousamra M 2nd, Zeldin DC, Falck JR, Townsley M, Harder DR, Roman RJ, Jacobs ER. Epoxyeicosatrienoic acids constrict isolated pressurized rabbit pulmonary arteries. Am J Physiol Lung Cell Mol Physiol. 2000; 278: L335–L343.[Abstract/Free Full Text]

91. Remillard CV, Zhang WM, Shimoda LA, Sham JS. Physiological properties and functions of Ca2+ sparks in rat intrapulmonary arterial smooth muscle cells. Am J Physiol Lung Cell Mol Physiol. 2002; 283: L433–L444.[Abstract/Free Full Text]

92. Vriens J, Owsianik G, Fisslthaler B, Suzuki M, Janssens A, Voets T, Morisseau C, Hammock BD, Fleming I, Busse R, Nilius B. Modulation of the Ca2+ permeable cation channel TRPV4 by cytochrome P450 epoxygenases in vascular endothelium. Circ Res. 2005; 97: 908–915.[Abstract/Free Full Text]

93. Ledda F, Amerini S, Filippi S, Mantelli L, Morbidelli L, Rubino A, Ziche M. Cardiovascular effects of capsaicin-sensitive neurons. Cardioscience. 1993; 4: 1–7.[Medline] [Order article via Infotrieve]

94. Holzer P. Peptidergic sensory neurons in the control of vascular functions: mechanisms and significance in the cutaneous and splanchnic vascular beds. Rev Physiol Biochem Pharmacol. 1992; 121: 49–146.[Medline] [Order article via Infotrieve]

95. Szallasi A. Vanilloid (capsaicin) receptors in health and disease. Am J Clin Pathol. 2002; 118: 110–121.[Abstract/Free Full Text]

96. Scotland RS, Chauhan S, Davis C, De Felipe C, Hunt S, Kabir J, Kotsonis P, Oh U, Ahluwalia A. Vanilloid receptor TRPV1, sensory C-fibers, and vascular autoregulation: a novel mechanism involved in myogenic constriction. Circ Res. 2004; 95: 1027–1034.[Abstract/Free Full Text]

97. Hwang SW, Cho H, Kwak J, Lee SY, Kang CJ, Jung J, Cho S, Min KH, Suh YG, Kim D, Oh U. Direct activation of capsaicin receptors by products of lipoxygenases: endogenous capsaicin-like substances. Proc Natl Acad Sci U S A. 2000; 97: 6155–6160.[Abstract/Free Full Text]

98. Hogestatt ED, Zygmunt PM. Cardiovascular pharmacology of anandamide. Prostaglandins Leukot Essent Fatty Acids. 2002; 66: 343–351.[CrossRef][Medline] [Order article via Infotrieve]

99. Zygmunt PM, Petersson J, Andersson DA, Chuang H, Sorgard M, Di Marzo V, Julius D, Hogestatt ED. Vanilloid receptors on sensory nerves mediate the vasodilator action of anandamide. Nature. 1999; 400: 452–457.[CrossRef][Medline] [Order article via Infotrieve]

100. Movahed P, Evilevitch V, Andersson TL, Jonsson BA, Wollmer P, Zygmunt PM, Hogestatt ED. Vascular effects of anandamide and N-acylvanillylamines in the human forearm and skin microcirculation. Br J Pharmacol. 2005; 146: 171–179.[CrossRef][Medline] [Order article via Infotrieve]

101. Reading SA, Earley S, Waldron BJ, Welsh DG, Brayden JE. TRPC3 mediates pyrimidine receptor-induced depolarization of cerebral arteries. Am J Physiol Heart Circ Physiol. 2005; 288: H2055–H2061.[Abstract/Free Full Text]

102. Corey DP, Garcia-Anoveros J, Holt JR, Kwan KY, Lin SY, Vollrath MA, Amalfitano A, Cheung EL, Derfler BH, Duggan A, Geleoc GS, Gray PA, Hoffman MP, Rehm HL, Tamasauskas D, Zhang DS. TRPA1 is a candidate for the mechanosensitive transduction channel of vertebrate hair cells. Nature. 2004; 432: 723–730.[CrossRef][Medline] [Order article via Infotrieve]

103. Wamhoff BR, Bowles DK, Owens GK. Excitation-transcription coupling in arterial smooth muscle. Circ Res. 2006; 98: 868–878.[Abstract/Free Full Text]

104. Bergdahl A, Gomez MF, Wihlborg AK, Erlinge D, Eyjolfson A, Xu SZ, Beech DJ, Dreja K, Hellstrand P. Plasticity of TRPC expression in arterial smooth muscle: correlation with store-operated Ca2+ entry. Am J Physiol Cell Physiol. 2005; 288: C872–C880.[Abstract/Free Full Text]

105. Kumar B, Dreja K, Shah SS, Cheong A, Xu SZ, Sukumar P, Naylor J, Forte A, Cipollaro M, McHugh D, Kingston PA, Heagerty AM, Munsch CM, Bergdahl A, Hultgardh-Nilsson A, Gomez MF, Porter KE, Hellstrand P, Beech DJ. Upregulated TRPC1 channel in vascular injury in vivo and its role in human neointimal hyperplasia. Circ Res. 2006; 98: 557–563.[Abstract/Free Full Text]

106. Yu Y, Fantozzi I, Remillard CV, Landsberg JW, Kunichika N, Platoshyn O, Tigno DD, Thistlethwaite PA, Rubin LJ, Yuan JX. Enhanced expression of transient receptor potential channels in idiopathic pulmonary arterial hypertension. Proc Natl Acad Sci U S A. 2004; 101: 13861–13866.[Abstract/Free Full Text]

107. Kunichika N, Landsberg JW, Yu Y, Kunichika H, Thistlethwaite PA, Rubin LJ, Yuan JX. Bosentan inhibits transient receptor potential channel expression in pulmonary vascular myocytes. Am J Respir Crit Care Med. 2004; 170: 1101–1107.[Abstract/Free Full Text]

108. Touyz RM, He Y, Montezano AC, Yao G, Chubanov V, Gudermann T, Callera GE. Differential regulation of transient receptor potential melastatin 6 and 7 cation channels by ANG II in vascular smooth muscle cells from spontaneously hypertensive rats. Am J Physiol Regul Integr Comp Physiol. 2006; 290: R73–R78.[Abstract/Free Full Text]

109. Altura BM, Zhang A, Altura BT. Magnesium, hypertensive vascular diseases, atherogenesis, subcellular compartmentation of Ca2+ and Mg2+ and vascular contractility. Miner Electrolyte Metab. 1993; 19: 323–336.[Medline] [Order article via Infotrieve]

110. Oancea E, Wolfe JT, Clapham DE. Functional TRPM7 channels accumulate at the plasma membrane in response to fluid flow. Circ Res. 2006; 98: 245–253.[Abstract/Free Full Text]

111. Bezzerides VJ, Ramsey IS, Kotecha S, Greka A, Clapham DE. Rapid vesicular translocation and insertion of TRP channels. Nat Cell Biol. 2004; 6: 709–720.[CrossRef][Medline] [Order article via Infotrieve]

112. Delmas P. Polycystins: polymodal receptor/ion-channel cellular sensors. Pflugers Arch. 2005; 451: 264–276.[CrossRef][Medline] [Order article via Infotrieve]

113. Geng L, Segal Y, Pavlova A, Barros EJ, Lohning C, Lu W, Nigam SK, Frischauf AM, Reeders ST, Zhou J. Distribution and developmentally regulated expression of murine polycystin. Am J Physiol. 1997; 272: F451–F459.[Medline] [Order article via Infotrieve]

114. Griffin MD, Torres VE, Grande JP, Kumar R. Vascular expression of polycystin. J Am Soc Nephrol. 1997; 8: 616–626.[Abstract]

115. Torres VE, Cai Y, Chen X, Wu GQ, Geng L, Cleghorn KA, Johnson CM, Somlo S. Vascular expression of polycystin-2. J Am Soc Nephrol. 2001; 12: 1–9.[Abstract/Free Full Text]

116. Kim K, Drummond I, Ibraghimov-Beskrovnaya O, Klinger K, Arnaout MA. Polycystin 1 is required for the structural integrity of blood vessels. Proc Natl Acad Sci U S A. 2000; 97: 1731–1736.[Abstract/Free Full Text]

117. Qian Q, Hunter LW, Li M, Marin-Padilla M, Prakash YS, Somlo S, Harris PC, Torres VE, Sieck GC. Pkd2 haploinsufficiency alters intracellular calcium regulation in vascular smooth muscle cells. Hum Mol Genet. 2003; 12: 1875–1880.[Abstract/Free Full Text]

118. Kip SN, Hunter LW, Ren Q, Harris PC, Somlo S, Torres VE, Sieck GC, Qian Q. [Ca2+]i reduction increases cellular proliferation and apoptosis in vascular smooth muscle cells: relevance to the ADPKD phenotype. Circ Res. 2005; 96: 873–880.[Abstract/Free Full Text]

119. Mullins LJ, Bailey MA, Mullins JJ. Hypertension, kidney, and transgenics: a fresh perspective. Physiol Rev. 2006; 86: 709–746.[Abstract/Free Full Text]

120. Liu D, Scholze A, Zhu Z, Krueger K, Thilo F, Burkert A, Streffer K, Holz S, Harteneck C, Zidek W, Tepel M. Transient receptor potential channels in essential hypertension. J Hypertens. 2006; 24: 1115–1124.[Medline] [Order article via Infotrieve]

121. Wang Y, Wang DH. A novel mechanism contributing to development of Dahl salt-sensitive hypertension: role of the transient receptor potential vanilloid type 1. Hypertension. 2006; 47: 609–614.[Abstract/Free Full Text]

122. Vaishnava P, Wang DH. Capsaicin sensitive-sensory nerves and blood pressure regulation. Curr Med Chem Cardiovasc Hematol Agents. 2003; 1: 177–188.[CrossRef][Medline] [Order article via Infotrieve]

123. Rosker C, Graziani A, Lukas M, Eder P, Zhu MX, Romanin C, Groschner K. Ca2+ signaling by TRPC3 involves Na+ entry and local coupling to the Na+/Ca2+ exchanger. J Biol Chem. 2004; 279: 13696–13704.[Abstract/Free Full Text]

124. Groschner K, Rosker C. TRPC3: a versatile transducer molecule that serves integration and diversification of cellular signals. Naunyn Schmiedebergs Arch Pharmacol. 2005; 371: 251–256.[CrossRef][Medline] [Order article via Infotrieve]

125. Pogwizd SM, Bers DM. Cellular basis of triggered arrhythmias in heart failure. Trends Cardiovasc Med. 2004; 14: 61–66.[CrossRef][Medline] [Order article via Infotrieve]

126. Maroto R, Raso A, Wood TG, Kurosky A, Martinac B, Hamill OP. TRPC1 forms the stretch-activated cation channel in vertebrate cells. Nat Cell Biol. 2005; 7: 105–107.[CrossRef][Medline] [Order article via Infotrieve]

127. Vandebrouck C, Martin D, Colson-Van Schoor M, Debaix H, Gailly P. Involvement of TRPC in the abnormal calcium influx observed in dystrophic (mdx) mouse skeletal muscle fibers. J Cell Biol. 2002; 158: 1089–1096.[Abstract/Free Full Text]

128. Yeung EW, Whitehead NP, Suchyna TM, Gottlieb PA, Sachs F, Allen DG Effects of stretch-activated channel blockers on [Ca2+]i and muscle damage in the mdx mouse. J Physiol. 2005; 562: 367–380.[Abstract/Free Full Text]

129. Hamill OP, McBride DW Jr. The pharmacology of mechanogated membrane ion channels. Pharmacol Rev. 1996; 48: 231–252.[Abstract]

130. Franz MR, Bode F. Mechano-electrical feedback underlying arrhythmias: the atrial fibrillation case. Prog Biophys Mol Biol. 2003; 82: 163–174.[CrossRef][Medline] [Order article via Infotrieve]

131. Guinamard R, Chatelier A, Lenfant J, Bois P. Activation of the Ca2+-activated nonselective cation channel by diacylglycerol analogues in rat cardiomyocytes. J Cardiovasc Electrophysiol. 2004; 15: 342–348.[Medline] [Order article via Infotrieve]

132. Guinamard R, Chatelier A, Demion M, Potreau D, Patri S, Rahmati M, Bois P. Functional characterization of a Ca2+-activated non-selective cation channel in human atrial cardiomyocytes. J Physiol. 2004; 558: 75–83.[Abstract/Free Full Text]

133. Zakharov SI, Smani T, Leno E, Macianskiene R, Mubagwa K, Bolotina VM. Monovalent cation (MC) current in cardiac and smooth muscle cells: regulation by intracellular Mg2+ and inhibition by polycations. Br J Pharmacol. 2003; 138: 234–244.[CrossRef][Medline] [Order article via Infotrieve]

134. Gwanyanya A, Amuzescu B, Zakharov SI, Macianskiene R, Sipido KR, Bolotina VM, Vereecke J, Mubagwa K. Magnesium-inhibited, TRPM6/7-like channel in cardiac myocytes: permeation of divalent cations and pH-mediated regulation. J Physiol. 2004; 559: 761–776.[Abstract/Free Full Text]

135. Pacher P, Batkai S, Kunos G. Haemodynamic profile and responsiveness to anandamide of TRPV1 receptor knock-out mice. J Physiol. 2004; 558: 647–657.[Abstract/Free Full Text]

136. Kanzaki M, Zhang YQ, Mashima H, Li L, Shibata H, Kojima I. Translocation of a calcium-permeable cation channel induced by insulin-like growth factor-I. Nat Cell Biol. 1999; 1: 165–170.[CrossRef][Medline] [Order article via Infotrieve]

137. Iwata Y, Katanosaka Y, Arai Y, Komamura K, Miyatake K, Shigekawa M. A novel mechanism of myocyte degeneration involving the Ca2+-permeable growth factor-regulated channel. J Cell Biol. 2003; 161: 957–967.[Abstract/Free Full Text]

138. Pennekamp P, Karcher C, Fischer A, Schweickert A, Skryabin B, Horst J, Blum M, Dworniczak B. The ion channel polycystin-2 is required for left-right axis determination in mice. Curr Biol. 2002; 12: 938–943.[CrossRef][Medline] [Order article via Infotrieve]

139. Volk T, Schwoerer AP, Thiessen S, Schultz JH, Ehmke H. A polycystin-2-like large conductance cation channel in rat left ventricular myocytes. Cardiovasc Res. 2003; 58: 76–88.[Abstract/Free Full Text]

140. Murakami M, Ohba T, Xu F, Shida S, Satoh E, Ono K, Miyoshi I, Watanabe H, Ito H, Iijima T. Genomic organization and functional analysis of murine PKD2L1. J Biol Chem. 2005; 280: 5626–5635.[Abstract/Free Full Text]

141. Li Q, Dai Y, Guo L, Liu Y, Hao C, Wu G, Basora N, Michalak M, Chen XZ. Polycystin-2 associates with tropomyosin-1, an actin microfilament component. J Mol Biol. 2003; 325: 949–962.[CrossRef][Medline] [Order article via Infotrieve]

142. Li Q, Liu Y, Shen PY, Dai XQ, Wang S, Smillie LB, Sandford R, Chen XZ. Troponin I binds polycystin-L and inhibits its calcium-induced channel activation. Biochemistry. 2003; 42: 7618–7625.[CrossRef][Medline] [Order article via Infotrieve]

143. Nauli SM, Alenghat FJ, Luo Y, Williams E, Vassilev P, Li X, Elia AE, Lu W, Brown EM, Quinn SJ, Ingber DE, Zhou J. Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells. Nat Genet. 2003; 33: 129–137.[CrossRef][Medline] [Order article via Infotrieve]

144. Scott J. Pathophysiology and biochemistry of cardiovascular disease. Curr Opin Genet Dev. 2004; 14: 271–279.[CrossRef][Medline] [Order article via Infotrieve]

145. McKinsey TA, Olson EN. Toward transcriptional therapies for the failing heart: chemical screens to modulate genes. J Clin Invest. 2005; 115: 538–546.[CrossRef][Medline] [Order article via Infotrieve]

146. Piper RC, Luzio JP. CUPpling calcium to lysosomal biogenesis. Trends Cell Biol. 2004; 14: 471–473.[CrossRef][Medline] [Order article via Infotrieve]

147. Seth M, Sumbilla C, Mullen SP, Lewis D, Klein MG, Hussain A, Soboloff J, Gill DL, Inesi G. Sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA) gene silencing and remodeling of the Ca2+ signaling mechanism in cardiac myocytes. Proc Natl Acad Sci U S A. 2004; 101: 16683–16688.[Abstract/Free Full Text]

148. Wilkins BJ, Molkentin JD. Calcium-calcineurin signaling in the regulation of cardiac hypertrophy. Biochem Biophys Res Commun. 2004; 322: 1178–1191.[CrossRef][Medline] [Order article via Infotrieve]

149. Xu SZ, Muraki K, Zeng F, Li J, Sukumar P, Shah S, Dedman AM, Flemming PK, McHugh D, Naylor J, Cheong A, Bateson AN, Munsch CM, Porter KE, Beech DJ. A sphingosine-1-phosphate-activated calcium channel controlling vascular smooth muscle cell motility. Circ Res. 2006; 98: 1381–1389.[Abstract/Free Full Text]

150. Inoue R. TRP channels as a newly emerging non-voltage-gated Ca2+ entry channel superfamily. Curr Pharm Design. 2005; 11: 1899–1914.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
T. Ditting, G. Tiegs, K. Rodionova, P. W. Reeh, W. Neuhuber, W. Freisinger, and R. Veelken
Do distinct populations of dorsal root ganglion neurons account for the sensory peptidergic innervation of the kidney?
Am J Physiol Renal Physiol, November 1, 2009; 297(5): F1427 - F1434.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
M. T. Schley, M. Casutt, C. Haberthur, M. Dusch, R. Rukwied, M. Schmelz, J. Schmeck, G. K. Schupfer, and C. J. Konrad
Long-Acting Local Anesthetics Attenuate FMLP-induced Acute Lung Injury in Rats
Anesth. Analg., September 1, 2009; 109(3): 880 - 885.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Inoue and Z.-G. Xiong
Silencing TRPM7 promotes growth/proliferation and nitric oxide production of vascular endothelial cells via the ERK pathway
Cardiovasc Res, August 1, 2009; 83(3): 547 - 557.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. Wang, Y. Zhang, W. G. Wier, X. Yu, M. Zhao, H. Hu, L. Sun, X. He, Y. Wang, B. Wang, et al.
Role of store-operated Ca2+ entry in adenosine-induced vasodilatation of rat small mesenteric artery
Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H347 - H354.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Inoue, L. J. Jensen, Z. Jian, J. Shi, L. Hai, A. I. Lurie, F. H. Henriksen, M. Salomonsson, H. Morita, Y. Kawarabayashi, et al.
Synergistic Activation of Vascular TRPC6 Channel by Receptor and Mechanical Stimulation via Phospholipase C/Diacylglycerol and Phospholipase A2/{omega}-Hydroxylase/20-HETE Pathways
Circ. Res., June 19, 2009; 104(12): 1399 - 1409.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. D. Johnson, D. Melanaphy, A. Purse, S. A. Stokesberry, P. Dickson, and A. V. Zholos
Transient receptor potential melastatin 8 channel involvement in the regulation of vascular tone
Am J Physiol Heart Circ Physiol, June 1, 2009; 296(6): H1868 - H1877.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. Yu, S. H. Keller, C. V. Remillard, O. Safrina, A. Nicholson, S. L. Zhang, W. Jiang, N. Vangala, J. W. Landsberg, J.-Y. Wang, et al.
A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension
Circulation, May 5, 2009; 119(17): 2313 - 2322.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. Iribe, C. W. Ward, P. Camelliti, C. Bollensdorff, F. Mason, R. A.B. Burton, A. Garny, M. K. Morphew, A. Hoenger, W. J. Lederer, et al.
Axial Stretch of Rat Single Ventricular Cardiomyocytes Causes an Acute and Transient Increase in Ca2+ Spark Rate
Circ. Res., March 27, 2009; 104(6): 787 - 795.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H.-Y. Kwan, B. Shen, X. Ma, Y.-C. Kwok, Y. Huang, Y.-B. Man, S. Yu, and X. Yao
TRPC1 Associates With BKCa Channel to Form a Signal Complex in Vascular Smooth Muscle Cells
Circ. Res., March 13, 2009; 104(5): 670 - 678.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. Yogi, G. E. Callera, R. Tostes, and R. M. Touyz
Bradykinin regulates calpain and proinflammatory signaling through TRPM7-sensitive pathways in vascular smooth muscle cells
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2009; 296(2): R201 - R207.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
F. Gao, D. Sui, R. M. Garavito, R. M. Worden, and D. H. Wang
Salt Intake Augments Hypotensive Effects of Transient Receptor Potential Vanilloid 4: Functional Significance and Implication
Hypertension, February 1, 2009; 53(2): 228 - 235.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. Liu, D. Yang, H. He, X. Chen, T. Cao, X. Feng, L. Ma, Z. Luo, L. Wang, Z. Yan, et al.
Increased Transient Receptor Potential Canonical Type 3 Channels in Vasculature From Hypertensive Rats
Hypertension, January 1, 2009; 53(1): 70 - 76.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. Gomis, S. Soriano, C. Belmonte, and F. Viana
Hypoosmotic- and pressure-induced membrane stretch activate TRPC5 channels
J. Physiol., December 1, 2008; 586(23): 5633 - 5649.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Xia, Z.-Z. Mei, H.-J. Mao, W. Yang, L. Dong, H. Bradley, D. J. Beech, and L.-H. Jiang
Identification of Pore Residues Engaged in Determining Divalent Cationic Permeation in Transient Receptor Potential Melastatin Subtype Channel 2
J. Biol. Chem., October 10, 2008; 283(41): 27426 - 27432.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. Takahashi, H. Lin, N. Geshi, Y. Mori, Y. Kawarabayashi, N. Takami, M. X. Mori, A. Honda, and R. Inoue
Nitric oxide-cGMP-protein kinase G pathway negatively regulates vascular transient receptor potential channel TRPC6
J. Physiol., September 1, 2008; 586(17): 4209 - 4223.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. N. Willette, W. Bao, S. Nerurkar, T.-l. Yue, C. P. Doe, G. Stankus, G. H. Turner, H. Ju, H. Thomas, C. E. Fishman, et al.
Systemic Activation of the Transient Receptor Potential Vanilloid Subtype 4 Channel Causes Endothelial Failure and Circulatory Collapse: Part 2
J. Pharmacol. Exp. Ther., August 1, 2008; 326(2): 443 - 452.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
H Liu, N Schuelert, J J McDougall, and S S Lee
Central neural activation of hyperdynamic circulation in portal hypertensive rats depends on vagal afferent nerves
Gut, July 1, 2008; 57(7): 966 - 973.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Alvarez, A. Coulombe, O. Cazorla, M. Ugur, J.-M. Rauzier, J. Magyar, E.-L. Mathieu, G. Boulay, R. Souto, P. Bideaux, et al.
ATP/UTP activate cation-permeable channels with TRPC3/7 properties in rat cardiomyocytes
Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H21 - H28.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. Shan, R. B. Marchase, and J. C. Chatham
Overexpression of TRPC3 increases apoptosis but not necrosis in response to ischemia-reperfusion in adult mouse cardiomyocytes
Am J Physiol Cell Physiol, March 1, 2008; 294(3): C833 - C841.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. M. Touyz
Transient receptor potential melastatin 6 and 7 channels, magnesium transport, and vascular biology: implications in hypertension
Am J Physiol Heart Circ Physiol, March 1, 2008; 294(3): H1103 - H1118.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Wu, X. Gao, R. C. Brown, S. Heller, and R. G. O'Neil
Dual role of the TRPV4 channel as a sensor of flow and osmolality in renal epithelial cells
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1699 - F1713.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. A. Lee, E. B. Baek, K. S. Park, H. J. Jung, J. I. Kim, S. J. Kim, and Y. E Earm
Mechanosensitive nonselective cation channel facilitation by endothelin-1 is regulated by protein kinase C in arterial myocytes
Cardiovasc Res, November 1, 2007; 76(2): 224 - 235.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Nishida, N. Onohara, Y. Sato, R. Suda, M. Ogushi, S. Tanabe, R. Inoue, Y. Mori, and H. Kurose
G{alpha}12/13-mediated Up-regulation of TRPC6 Negatively Regulates Endothelin-1-induced Cardiac Myofibroblast Formation and Collagen Synthesis through Nuclear Factor of Activated T Cells Activation
J. Biol. Chem., August 10, 2007; 282(32): 23117 - 23128.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. A. Hill and M. J. Davis
Coupling a change in intraluminal pressure to vascular smooth muscle depolarization: still stretching for an explanation
Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2570 - H2572.
[Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. Nilius, G. Owsianik, T. Voets, and J. A. Peters
Transient Receptor Potential Cation Channels in Disease
Physiol Rev, January 1, 2007; 87(1): 165 - 217.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F.-R. E. Curry and C. A. Glass
TRP Channels and the Regulation of Vascular Permeability: New Insights From the Lung Microvasculature
Circ. Res., October 27, 2006; 99(9): 915 - 917.
[Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. V. Remillard and J. X.-J. Yuan
Transient Receptor Potential Channels and Caveolin-1: Good Friends in Tight Spaces
Mol. Pharmacol., October 1, 2006; 70(4): 1151 - 1154.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Inoue, R.
Right arrow Articles by Ito, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inoue, R.
Right arrow Articles by Ito, Y.
Related Collections
Right arrow Remodeling
Right arrow Cell signalling/signal transduction
Right arrow Growth factors/cytokines
Right arrow Ion channels/membrane transport
Right arrow Pulmonary biology and circulation
Right arrow Smooth muscle proliferation and differentiation
Right arrow Autonomic, reflex, and neurohumoral control of circulation