| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Institute of Clinical Chemistry, University Hospital of Zurich and Center for Integrative Human Physiology, University of Zurich, Switzerland.
Correspondence to Arnold von Eckardstein, Institute of Clinical Chemistry, University Hospital of Zurich and Center for Integrative Human Biology, University of Zurich, Raemistrasse 100, CH-8091 Zurich, Switzerland. E-mail arnold.voneckardstein{at}usz.ch
| Abstract |
|---|
|
|
|---|
Key Words: high-density lipoproteins endothelium apolipoprotein A-I transcytosis ABCA1
| Introduction |
|---|
|
|
|---|
Two principal mechanisms of transendothelial protein transport have been controversially discussed: porous transport and transcytosis. Porous transport refers to the passive and convective transport of proteins across large pores located either paracellularly or transcellularly.9,10 Transcytosis designates the shuttling of proteins in plasmalemmal vesicles across the endothelium.9,11,12 Recently, we have reported that endothelial cells bind, internalize, and transport apoA-I in a specific manner.13 In addition, within the first 30 minutes, approximately 50% of apoA-I that associates with the cells is transcytosed, which indicates that apoA-I transcytosis is a major process. Finally, apoA-Ispecific transport was temperature dependent, and apoA-I was modified during transport. Thus, this phenomenological study provided the first evidence that apoA-I is transcytosed through endothelial cells. However, the receptor or transporter modulating apoA-I transcytosis has not yet been identified.
ATP-binding cassette transporter A1 (ABCA1)14 and scavenger receptor BI (SR-BI)15 are known apoA-I or HDL-binding proteins. ABCA1 belongs to the ATP-binding cassette transporter family and mediates the efflux of phospholipids and cholesterol onto apoA-I. Its activity is rate limiting for HDL biogenesis in the liver and helps to maintain the cholesterol homeostasis of macrophages in the vascular wall.16,17 SR-BI belongs to the scavenger receptor family. In the liver, it mediates the selective uptake of cholesteryl esters from HDLs, via a mechanism that is still unclear.15 In addition, SR-BI contributes to the activation of endothelial nitric oxide synthase by HDLs.18
The present study addresses the question of whether ABCA1 and SR-BI modulate apoA-I binding, internalization, and transport.
| Materials and Methods |
|---|
|
|
|---|
Isolation and Labeling of ApoA-I
Lipid-free human apoA-I was isolated from plasma HDL and labeled with 125I using the Iodo-Beads iodination reagent (Pierce) as described previously.13
Pharmacological Treatments
ABCA1 expression was stimulated by a mixture of 22-R-hydroxycholesterol (HC) and 9-cis-retinoic acid (RA) (Sigma) 10 µmol/L each for 30 hours. ABCA1 was trapped on the cell surface after incubation with 20 µmol/L cyclosporin A (CsA) (Sigma) for 4 hours.
Small Interfering RNA Transfection
BAECs were transfected when 80% to 90% confluent. BLOCK-iT fluorescent oligo (67 nmol/L) and 100 nmol/L Stealth small interfering RNA (siRNA) (Invitrogen) against either SR-BI (GTCAGCAAGGTCAACTATTGGCATT) or ABCA1 (GGGACTTAGTGGGACGAAATCTCTT) were transfected with Lipofectamine 2000 in OPTIMEM according to the protocol of the manufacturer. Six hours after transfection, the medium was replaced by DMEM 5% FCS. Binding, internalization, and transport assays were conducted 2 to 3 days after transfection. The efficiency of the silencing was evaluated by quantitative RT-PCR and Western blotting.
Quantitative RT-PCR
RNA was isolated with RNeasy mini (Qiagen) according to the protocol of the manufacturer. Reverse transcription was performed with Superscript II RT (Invitrogen) following the standard procedure. Quantitative PCR was performed with LightCycler FastStart DNA Master SYBR Green I (Roche). ABCA1 (GTCATTATCATCTTCATCTGCTTCC, CCTCACATCTTCATCTTCATCATTC, 60°C, 5 mmol/L MgCl2) and SR-BI (GGAATCCCCATGAACTG, CTTGGGAGCTGATGTCATC, 58°C, 5 mmol/L MgCl2) transcription levels were normalized to GAPDH (GTCTTCACTACCATGGAGAAGG, TCATGGATGACCTTGGCCAG, 58°C, 4 mmol/L MgCl2).
Western Blotting
BAECs were lysed in radioimmunoprecipitation assay (RIPA) buffer (10 mmol/L Tris [pH 7.4], 150 mmol/L NaCl, 1% Nonidet P-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, Complete protease inhibitors from Roche). Total protein (50 µg) was loaded on the gel. The expression of ABCA1 (anti-ABCA1; ab18180, Abcam, Cambridge, UK) and SR-BI (anti-SR-BI; ab3, Abcam) was evaluated and compared with the expression of actin (anti-actin AC-15, Sigma).
125I-ApoA-I Binding
Cells (1x105 cells/well) were seeded in a 24-well dish 2 days before the assay. After rinsing the cells twice with DMEM, they were incubated at 4°C for 2 hours with 5 µg/mL 125I apoA-I in DMEM HEPES 1% BSA without (total binding) or with (nonspecific binding) a 40-fold excess of unlabeled apoA-I. After incubation, the cells were washed twice with Tris wash buffer (50 mmol/L Tris [pH 7.4], 0.15 mol/L NaCl) containing 2 mg/mL BSA and once with Tris wash buffer without BSA. The cells were then lysed with 0.1 mol/L NaOH, and the amount of bound 125I-apoA-I was determined and normalized by the total protein content.
125I-ApoA-I Cell Association
125I-apoA-I cell association was determined similarly as 125I-apoA-I binding, except that the assay was conducted at 37°C and the cells were incubated with 125I-apoA-I for 30 minutes.
125I-ApoA-I Internalization
125I-apoA-I (0.2 mg) was biotinylated with 100 µg of EZ-Link Sulfo-NHS-SS-Biotin (Pierce) for 1 hour at room temperature and purified through a Sephadex G-25 NAP-5 column (GE Healthcare). Cells were incubated at 37°C with 5 µg/mL biotin-SS/125I-apoA-I in DMEM HEPES 1% BSA. After 30 minutes of incubation, cells were chilled on ice for 15 minutes and washed as previously described. The biotin moiety of the cell surfacebound biotin-SS/125I-apoA-I was cleaved with 50 mmol/L dithiothreitol (DTT) in PBS, 0.1 mmol/L CaCl2, and 1 mmol/L MgCl2. The cells were lysed in RIPA buffer. Biotin-SS/125I-apoA-I was captured with streptavidin beads and the amount of internalized biotin-SS/125I-apoA-I determined by counting radioactivity of the beads.
125I-ApoA-I Transport
Transport assays were performed as previously described.13 In brief, 1x105 cells were seeded 2 days in advance on the upper side of porous filter inserts (0.4 µm, BD Biosciences) precoated with collagen type I (BD Biosciences). The apical medium contained 5 µg/mL 125I-apoA-I, and transport from the apical to the basolateral compartment was measured after 30 minutes.
Inulin Permeability
Inulin permeability was determined as previously described.13 In brief, 2 mCi/mL 3H-inulin was added in the apical compartment, and the filtrated radioactivity was collected in the basolateral compartment after 30 minutes.
ABCA1-GFP Expression
The ABCA1-GFP plasmid,19 a kind gift from Jonathan D. Smith (Department of Cell Biology, Cleveland Clinic, Ohio), was transiently transfected in endothelial cells seeded on coverslips using Lipofectamine 2000 (Invitrogen) and following the standard protocol of the manufacturer. ABCA1-GFPexpressing cells were characterized by confocal fluorescence microscopy.
Confocal Fluorescence Microscopy
Cells were incubated for 30 minutes with 5 µg/mL apoA-I labeled with alexa-546, washed 6 times 5 minutes in PBS, fixed in 3% paraformaldehyde for 15 minutes, and permeabilized in 0.5% Triton X-100. Late endosomes were stained with LAMP-1 (lysosome-associated membrane protein-1) antibodies (ab19294, Abcam). Confocal microscopy was performed with a x63 oil-immersion lens in the sequential mode.
| Results |
|---|
|
|
|---|
ABCA1 and SR-BI Are Expressed in Endothelial Cells
The expression of ABCA1 and SR-BI in BAECs was evaluated by RT-PCR and Western blotting (Figure 1). Both apoA-I candidate receptors were found to be expressed in BAECs. Moreover, the effect of known modulators of ABCA1 was tested in these cells. First, we verified that the expression of ABCA1 is stimulated by a mixture of HC and RA (Figure 1A). Second, in cells treated with CsA, a broad-spectrum multidrug-resistance modulator, the cell surface expression of ABCA1 was enhanced (Figure 1C). Third, expression of both ABCA1 and SR-BI was diminished by RNA interference (Figure 1B). Both candidate receptors were knocked down with an efficiency of more than 90% on the RNA level. The remaining protein expression of ABCA1 and SR-BI after silencing was approximately 50%, as assessed by Western blotting.
|
ABCA1, but Not SR-BI, Is Involved in ApoA-I Binding and Cell Association
The role of ABCA1 and SR-BI in apoA-I binding (4°C) and cell association (37°C) in BAECs was assessed after pharmacological treatments and siRNA-mediated silencing. First, apoA-I binding and cell association were increased by 50% and 35%, respectively, when the cells were stimulated with HC and RA (Figures 2A and 3
A). Second, after 4 hours of treatment with CsA, apoA-I binding and cell association to BAECs were also augmented by 50% and 45%, respectively (Figures 2B and 3
B), consistent with the previous finding that CsA traps ABCA1 on the cell surface.20 These 2 results indicated that an ABC transporter modulates apoA-I binding and cell association to endothelial cells. Third, reducing the expression of SR-BI by RNA interference affected neither apoA-Ispecific binding (Figure 2C) nor apoA-Ispecific cell association (Figure 3C). However, silencing ABCA1 reduced apoA-I binding by 40% (Figure 2C) and apoA-I cell association by 50% (Figure 3C). Therefore, we studied further only the implication of ABCA1 in apoA-I internalization and transcytosis in endothelial cells.
|
|
ABCA1 Plays a Role in ApoA-I internalization
The contribution of ABCA1 to apoA-I internalization was further investigated using the treatments described above. ApoA-I uptake in cells stimulated with HC and RA was twice as high as in unstimulated cells (Figure 4A). In contrast, treating the cells with the ABC transporter inhibitor CsA reduced apoA-I internalization by 45% (Figure 4B). In addition, after reducing ABCA1 expression specifically by RNA interference, apoA-I uptake was lowered by approximately 60% (Figure 4C). Furthermore, the colocalization of apoA-I with ABCA1 in endothelial cells was assessed after expressing an ABCA1-GFP fusion protein. ABCA1 was observed both on the cell surface and intracellularly. Fluorescently labeled apoA-I was found in intracellular vesicles that seemed to colocalize with ABCA1-GFP (Figure 5A). These results suggest that ABCA1 modulates not only apoA-I binding and cell association but also apoA-I internalization in BAECs. In fibroblasts, ABCA1 colocalizes with apoA-I in late endosomes.21 In endothelial cells, however, apoA-I was observed in vesicles that did not colocalize with the late endosome marker LAMP-1 (Figure 5B).
|
|
ABCA1 Modulates ApoA-I Transcytosis
Finally, we characterized the implication of ABCA1 in apoA-I transport through a monolayer of endothelial cells. In BAECs treated with CsA, apoA-I transport was reduced by a factor 2 as compared with untreated cells (Figure 6A). When ABCA1 expression was decreased by RNA interference, we observed an up to 70% reduction in apoA-I transport (Figure 6B). In addition, inulin permeability was measured to evaluate the integrity of the endothelial cell monolayer after treatment with CsA and siRNA transfection (Figure 6C and 6D). Both interventions did not affect inulin permeability, demonstrating that the effects previously described are specific for apoA-I. Taken together, these results indicate that apoA-I transport is modulated by ABCA1.
|
| Discussion |
|---|
|
|
|---|
After confirming the expression of ABCA1 in endothelial cells,2224 we assessed the role of ABCA1 in apoA-I binding and cell association, using pharmacological treatments and RNA interference. Initially, we verified that, as in macrophages,25,26 the expression of ABCA1 is upregulated in cells incubated with a mixture of HC and RA (Figure 1A). We also confirmed that ABCA1 is trapped on the cell surface of cells treated with CsA (Figure 1C), as previously reported for macrophages.20 After either treatment, apoA-I binding (Figure 2A and 2B) and apoA-I cell association (Figure 3A and 3B) were increased. Although these treatments are not specifically modulating ABCA1, they provided evidence that an ABC transporter is involved in apoA-I binding and cell association to endothelial cells. Furthermore, when the expression of ABCA1 was specifically reduced by RNA interference, both apoA-I binding (Figure 2C) and apoA-I cell association (Figure 3C) were lowered. Thus, our results and the literature agree that ABCA1 modulates apoA-I binding. Indeed, overexpression of ABCA1 in macrophages increases apoA-I binding to the cell surface.27 However, it is still controversially discussed whether ABCA1 binds directly apoA-I or whether it modifies the lipid distribution at the plasma membrane facilitating apoA-I docking.28 Hence, it is likewise unclear whether ABCA1 can be considered as a receptor for apoA-I in endothelial cells.
We further evaluated the involvement of ABCA1 in apoA-I internalization (Figure 4). Similarly to apoA-I binding and cell association, apoA-I internalization was increased after stimulating ABCA1 with HC and RA. On the contrary, CsA inhibited apoA-I uptake. When ABCA1 expression was reduced by RNA interference, apoA-I uptake was also diminished. Furthermore, in endothelial cells expressing the fusion protein ABCA1-GFP, apoA-I seemed to colocalize with ABCA1 intracellularly (Figure 5A). Thus, it seems that ABCA1 plays a critical role in apoA-I internalization, which is consistent with data obtained previously in macrophages and fibroblasts.20,21 In macrophages, CsA inhibits apoA-I uptake and resecretion by trapping ABCA1 on the cell surface.20 In fibroblasts, apoA-I colocalizes with ABCA1 intracellularly and was found in late endosomes.21 In endothelial cells, however, apoA-Icontaining vesicles did not colocalize with the late endosomal marker LAMP-1 (Figure 5B). Similar results have been previously reported for the interaction of HDL with endothelial cells.29 Therefore, it seems that the fate of HDL and apoA-I in endothelial cells differs from their fate in fibroblasts (ie, lipid efflux). Interestingly, although both processes require a functional ABCA1, they do not involve the same intracellular compartment.
It seems that ABCA1 also critically modulates apoA-I transcytosis. Treatment with CsA and knock-down of ABCA1 expression specifically reduced apoA-I transport (Figure 6). ABCA1 might modulate apoA-I transcytosis, only because of its role in apoA-I binding and internalization. Consequently, the transporter would not regulate later events such as apoA-I intracellular trafficking or apoA-I secretion at the basolateral membrane. Nevertheless, a contribution of ABCA1 to apoA-I intracellular trafficking cannot be excluded and is even suggested by the finding that ABCA1 and apoA-I are colocalized intracellularly (Figure 5A). Moreover, when CsA was added into only the basolateral compartment, it inhibited apoA-I transport, although apoA-I cell association and, hence, ABCA1 availability on the apical site remained unchanged (data not shown). Thus, ABCA1 might modulate not only the uptake of apoA-I but also its intracellular trafficking and, possibly, its resecretion. Further research, however, will have to characterize the role of ABCA1 in these processes.
In addition, we found that SR-BI is expressed in endothelial cells, as previously published by others.18,30,31 Its expression could be diminished by RNA interference (Figure 1B). After reduction of SR-BI expression, apoA-I binding (4°C) and cell association (37°C) to endothelial cells were not changed (Figures 2C and 3
C). On the contrary, HDL binding was reduced (data not shown). Therefore and because SR-BI has already been reported to bind lipidated apoA-I and HDL, rather than lipid-free apoA-I,32,33 we did not investigate further the implication of SR-BI in apoA-I transcytosis.
At first sight, our findings assign a novel function to ABCA1, which is known to mediate efflux of phospholipids and cholesterol onto apoA-I.14 However, it is important to recall that the mechanism by which ABCA1 mediates lipid efflux is not yet resolved.28 Most authors assume that ABCA1 acts on the cell surface and translocates phospholipids and cholesterol from the inner leaflet to the outer leaflet of the plasma membrane onto apoA-I. However, lipid efflux from macrophages onto apoA-I has also been suggested to involve retroendocytosis, where apoA-I is internalized, interacts with intracellular lipid pools, and is resecreted as lipidated particle.34 In human and murine macrophages that lack ABCA1, this process is defective.35,36 Furthermore, after transcytosis through endothelial cells, apoA-I seems to be lipidated.13 Therefore, our finding that ABCA1 modulates apoA-I internalization and transport in endothelial cells may indirectly support the retroendocytosis hypothesis of cholesterol efflux.
According to the current opinion, ABCA1 helps protecting against the development of atherosclerosis by 2 major mechanisms. It catalyzes a limiting step in HDL biogenesis in the liver, and it mediates cholesterol efflux from macrophages.16 Many of the antiatherogenic effects of apoA-I and HDL are to be executed within the vascular wall. Therefore, by modulating the transport of apoA-I through the endothelium into the arterial wall, ABCA1 may exert an additional atheroprotective activity. In this context, it is important to note that several mutations in ABCA1 were associated with cardiovascular risk independently of HDL cholesterol.37
Porous transport and transcytosis are the 2 major mechanisms controversially discussed for the transendothelial transport of proteins.9,10 The identification of ABCA1 as a rate-limiting factor in apoA-I transport through endothelial cells supports the concept that proteins are transcytosed through the endothelium. However, future research will have to show the physiological and pathological relevance of the ABCA1-mediated transendothelial transport of apoA-I.
In summary, ABCA1, but not SR-BI, modulates apoA-I binding, internalization, and transcytosis through aortic endothelial cells. This study is the first molecular characterization of the transendothelial transport of apoA-I. More generally, the identification of ABCA1 as a modulator of apoA-I transcytosis provides evidence that transcytosis is a relevant mechanism for the transendothelial transport of proteins.
| Acknowledgments |
|---|
Sources of Funding
This work is supported by a grant from the Swiss National Research Foundation (3100A0-100693/1).
Disclosures
None.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Lyly, S. K. Marjavaara, A. Kyttala, K. Uusi-Rauva, K. Luiro, O. Kopra, L. O. Martinez, K. Tanhuanpaa, N. Kalkkinen, A. Suomalainen, et al. Deficiency of the INCL protein Ppt1 results in changes in ectopic F1-ATP synthase and altered cholesterol metabolism Hum. Mol. Genet., May 15, 2008; 17(10): 1406 - 1417. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Hassan, D. Bailey, D.-Y. D. Lee, I. Iatan, A. Hafiane, I. Ruel, L. Krimbou, and J. Genest Quantitative Analysis of ABCA1-dependent Compartmentalization and Trafficking of Apolipoprotein A-I: IMPLICATIONS FOR DETERMINING CELLULAR KINETICS OF NASCENT HIGH DENSITY LIPOPROTEIN BIOGENESIS J. Biol. Chem., April 25, 2008; 283(17): 11164 - 11175. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Hassan, M. Denis, D.-Y. D. Lee, I. Iatan, D. Nyholt, I. Ruel, L. Krimbou, and J. Genest Identification of an ABCA1-dependent phospholipid-rich plasma membrane apolipoprotein A-I binding site for nascent HDL formation: implications for current models of HDL biogenesis J. Lipid Res., November 1, 2007; 48(11): 2428 - 2442. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y.K. Lee, H.-F. Tse, C.-W. Siu, S.-G. Zhu, R. Y.K. Man, and P. M. Vanhoutte Genomic Changes in Regenerated Porcine Coronary Arterial Endothelial Cells Arterioscler. Thromb. Vasc. Biol., November 1, 2007; 27(11): 2443 - 2449. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |