| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Departments of Medicine and Molecular and Cellular Biology (W.W., X.R.H., E.C., K.O., H.Y.L.), Baylor College of Medicine, Houston, Tex; Department of Pathology (L.D.T.), Methodist Hospital, Houston, Texas; Genetics of Development and Disease Branch (C.D.), Digestive and Kidney Diseases, National Cancer Institute, National Institutes of Health, Bethesda, Md; Vanderbilt-Ingram Cancer Center (N.A.B.), Vanderbilt University School of Medicine, Nashville, Tenn; and Department of Medicine-Renal Division (W.J., E.P.B.), Mount Sinai Medical School, New York, NY.
Correspondence to Hui Y. Lan, MD, PhD, Department of Medicine- Nephrology, Alkek N520, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. E-mail hlan{at}bcm.tmc.edu
| Abstract |
|---|
|
|
|---|
Key Words: angiotensin TGF-ß Smads vascular fibrosis
| Introduction |
|---|
|
|
|---|
Beyond its hemodynamic effects, Ang II is recognized as a cytokine with an active role in cardiovascular remodeling. It is well known that Ang II signals through its Ang II receptor 1 (AT1) receptor to exert most of its biological functions.7 After binding to the AT1 receptor, Ang II activates multiple downstream intracellular signaling pathways, including tyrosine kinase, mitogen-activated protein kinase (MAPK), p38, and Janus family kinase (JNK).8 Activation of these pathways leads to numerous heterogeneous downstream events that play essential roles in the biological activities of Ang II, such as cell growth and migration, ECM production, and apoptosis.8
It has long been thought that Ang II induces vascular fibrosis by stimulating transforming growth factor-ß (TGF-ß). According to this view, TGF-ß induction is the initial step in promoting fibrosis during vascular remodeling in response to Ang II. The recent discovery of the TGFß/Smad signaling pathway provides insights into the molecular signaling mechanisms of TGF-ß in vascular fibrosis. TGF-ß is known to mediate its fibrotic effects by activating receptor-associated Smads, including Smad2 and Smad3, which are counter-regulated by inducing inhibitory Smads (ie, Smad6 and Smad7).9 A recent study indicates that Ang II is able to activate the TGF-ß/Smad signaling via the p38 MAPK pathway.10 This finding strongly suggests that an additional signaling mechanism may be required for the development of vascular fibrosis in response to Ang II. In the present study, we demonstrated that Ang II is able to activate an early Smad signaling pathway in vascular smooth muscle cells (VSMCs) directly via the extracellular signal-regulated kinase 1/2 (ERK1/2) MAPK signaling pathway in addition to the late classic TGF-ß signaling pathway. More important, we also provide new evidence that Smad3 but not Smad2 is a key downstream mediator of TGF-ß/Smad signaling in vascular fibrosis in response to Ang II.
| Materials and Methods |
|---|
|
|
|---|
Immunohistochemistry
Immunohistochemistry was performed using a microwave-based antigen retrieval technique as described previously.11 Briefly, paraffin-embedded tissue sections (4 µm) from patients with hypertensive nephropathy or periodate-lysine-paraformaldehyde (PLP)-fixed VSMCs after culturing in 8-chamber glass slides were stained with antibodies to TGF-ß1, collagen I, and phosphorylated (p)-Smad2/3 (Santa Cruz Biotechnology) using a three-layer peroxidase antiperoxidase method.
Quantitative analyses of TGF-ß1 and collagen I expression were performed using a quantitative image analysis system (Metamorph). Because the pattern of expression of TGF-ß1 and collagen I are diffuse in nature, the percentage of positive staining in the vascular wall was quantified under a x20 power field of microscope. Briefly, up to 10 random areas of renal arteries with the early stage (media:intima
1) and advanced stage (media:intima <1) were chosen from each tissue section and examined. The examined area was outlined, the positive staining patterns were identified, and the percent positive area in the examined area was then measured. Data were expressed as the percentage of mean±SEM. For analysis of Smad2/3 activation in human renal arteries, nucleus positive for p-Smad2/3 cells within the arterial walls were identified and counted under a x40 power field of microscope in 10 random areas of renal arteries using a 0.02-mm2 graticule fitted in the eyepiece of a microscope as described previously.11 Data were expressed as cells/mm2. The arterial lumen and periarterial areas were excluded from the study. For analysis of Smad2/3 activation in cultured VSMCs, nucleus positive stain for p-Smad2/3 was counted in 500 cells and expressed as percentage. All examinations were performed blindly on coded slides.
Cell Culture
Primary cultures of VSMCs at passages 2 or 3 were used for studies as described below. Cells were serum starved for 16 hours, followed by treatment with Ang II (1 µmol/L) for periods of 5, 15, 30, and 60 minutes and 2, 4, 12, 18, 20, 24, and 48 hours. To study the signaling mechanism involving AT1 and ERK1/2 MAPK signaling pathway, VSMCs that overexpressed adenovirus (Adv)-dominant-negative (DN)-ERK1/2 MAPK were stimulated with Ang II or were treated with AT1 receptor blocker (losartan; 1 µmol/L) and a specific inhibitor to ERK1/2 (PD98059; 20 µmol/L; R&D Systems Inc.) at 1 hour before Ang II stimulation. To study the signaling mechanism involving the TGF-ßdependent signaling pathway, VSMCs that overexpressed retrovirus (Rv)-DN-TGF-ß receptor II (TßRII) or had conditional KO for TßRII were stimulated with Ang II as described above. In addition, a neutralizing rabbit antiTGF-ß antibody (Ab; 10 µg/mL; R&D Systems Inc.) was introduced into the medium 1 hour before Ang II stimulation. Furthermore, the functional role of Smad2 and Smad3 in Ang IIinduced vascular fibrosis was determined in Smad3 wild-type (WT) and knockout (KO) VSMCs and in those with conditional KO for Smad2. The secretion of TGF-ß by VSMCs was measured in the supernatant by using a commercial TGF-ß quantitative ELISA kit (R&D Systems Inc.).
Western Blot Analysis
The Western blot was performed as described previously.12 Briefly, samples were heated at 99°C for 5 minutes and then transferred to a polyvinylidene difluoride membrane. After blocking with 5% BSA, the membranes were then incubated overnight at 4°C with primary antibodies against collagen I (Southern Biotech Inc.), p-ERK1/2, ERK1/2 (Santa Cruz Biotechnology), or GAPDH (Chemicon Inc.). After washing, the membranes were incubated with a peroxidase-conjugated secondary Ab for 1 hour, and signals were visualized by an enhanced chemiluminescence system (Amersham).
Immunoprecipitation
Cell lysates were immunoprecipitated at least 4 hours at 4°C with 0.4 µg of antiSmad-2/3 (Santa Cruz Biotechnology), followed by precipitation with 20 µL of protein A/G Plus-Agarose (Santa Cruz Biotechnology) overnight at 4°C. After washing, the immunoprecipitates were boiled for 5 minutes in 2xsodium dodecyl sulfate sample buffer as described above. The resulting precipitated complexes were separated on sodium dodecyl sulfatepolyacrylamide gels and blotted with antiSmad-4 (Santa Cruz Biotechnology), antiphosphoserine (EMD Biosciences), and anti-Smad2/3 (BD Bioscience Inc.), respectively.
Real-Time Polymerase Chain Reaction
Total RNA was isolated using the RNeasy kit, according to manufacturer instructions (Qiagen Inc.). The cDNA was synthesized as described previously.13 Real-time polymerase chain reaction (PCR) was run with the Opticon real-time PCR machine as described previously (MJ Research Inc.).12 The specificity of real-time PCR was confirmed via routine agarose gel electrophoresis and Melting-curve analysis. Housekeeping gene GAPDH was used as an internal standard. The primers used in this study are: collagen type I: forward 5' TGCCGTGACCTCAAGATGTG, reverse 5'- CACAAGCGTGCTGTAGGTGA; TGF-ß1 forward 5'-CAACAATTCCTGGCGTTACCTTGG, reverse 5'- GAAAGCCCTGTATTCCGTCTCCTT. GAPDH, forward 5'- CCTGGAGAAACCTGCCAAGTATGA, reverse 5'- TTGAAGTCACAGGAGACAACCTGG.
Transient Transfection and Promoter Activity Assay
Primary VSMCs were transiently transfected with a Smad3/4-responsive construct, p(CAGA)12-Luc (a gift from Dr Peter ten Dijke, Ludwig Institute for Cancer Research, Uppsala, Sweden).14 A control plasmid, pCMVß-galactosidase (Clontech), was cotransfected into the cells for the control of transfection efficiency. The transfection procedure was performed using Lipofectamine (Invitrogen) according to manufacturer instruction. The luciferase and ß-gal activities were analyzed by luciferase reporter gene assay kit and ß-gal reporter gene assay kit, respectively (Roche Inc.) according to manufacturer instructions. The Smad3-responsive promoter activity was reported as the luciferase activity normalized to ß-gal activity.
Statistical Analyses
Data obtained from this study are expressed as the mean±SEM. Statistical analyses were performed using one-way ANOVA from GraphPad Prism 3.0 (GraphPad Software, Inc.).
| Results |
|---|
|
|
|---|
|
Ang II Is Able to Activate an Early and a Late TGF-ß/Smad Signaling in VSMCs
We next examined the intracellular mechanisms by which Ang II activates Smad2/3 in VSMCs. Immunohistochemistry showed that Ang II was able to activate Smad2/3 (identified by nuclear location of p-Smad2/3) in VSMCs as early as 5 minutes, peaked at 15 to 30 minutes, and then declined to the basal level at 2 hours but formed the second peak at 24 hours (Figure 2A). Similar results were also demonstrated by immunoprecipitation (Figure 2B). Furthermore, Ang IIinduced activation of Smad2/3 at the early (5 to 30 minutes) and late (18 to 24 hours) stage was physically associated with Smad4 (Figure 2B), indicating the formation of Smad2/3/4 complex, which is required for Smads entering to nuclear translation.9
|
Ang II Activates Smad Signaling via the AT1-Mediated, ERK MAPK-Dependent, and TGF-ßDependent Pathways
We next dissected the signaling mechanisms whereby Ang II induces the early and late activation of Smad signaling. As shown in Figure 3A and 3B, immunohistochemistry showed that addition of losartan (1 µmol/L) and ERK1/2 MAPK inhibitor (PD98059; 20 µmol/L) almost completely blocked Ang II (1 µmol/L)induced Smad2/3 phosphorylation and nuclear translocation at 15 minutes, whereas treatment with a neutralizing TGF-ß Ab (10 µg/mL) prevented Ang IIinduced Smad2/3 activation at 24 hours. Consistently, Ang II induced significant TGF-ß1 expression until 24 hours, at both mRNA and protein levels, and the increased TGF-ß1 expression was blocked by addition of losartan but not by ERK1/2 MAPK inhibitor (PD98059; Figure 3C). These observations suggest that Ang II may signal through the AT1 receptor to activate the early Smad signaling pathway via the ERK1/2 MAPK-dependent mechanism and the late TGF-ß/Smad signaling pathway by the classic TGF-ßdependent Smad signaling pathway. This was further confirmed by blocking the activity of ERK1/2 MAPK with Adv-ERK-DN and the TGF-ß signaling pathway with overexpression of Rv-TßRII-DN or a neutralizing antiTGF-ß Ab. As shown in Figure 4, immunoprecipitation showed that Ang IIinduced early activation of Smad2/3 at 30 minutes was completely blocked by overexpression of Adv-ERK-DN but not by Rv-TßRII-DN, whereas Ang IIinduced late Smad2/3 activation at 24 hours was blocked by overexpression of Rv-TßRII-DN and a neutralizing TGF-ß Ab. The specificity of Adv-ERK-DN in inhibition of Ang IIinduced Smad2/3 activation at 30 minutes was confirmed by its ability to inhibit Ang IIinduced ERK1/2 phosphorylation but not by the control Adv-ß-gal. The specificity of Rv-TßRII-DN in inhibition of Ang IIinduced late Smad2/3 activation at 24 hours was demonstrated by its ability to block TGF-ß but not Ang IIinduced Smad2/3 activation at 30 minutes.
|
|
To further confirm that Ang II activated the early Smad signaling pathway via a TGF-ßindependent mechanism, a genetic approach using conditional KO TßRII was applied because deletion of TßRII is embryonic lethal.16 As shown in Figure 5A and 5B, VSMCs isolated from TßRIIf/f mice were infected with Adv-Cre recombinase, and conditional KO TßRII VSMCs were generated. Deletion of TßRII produced no inhibitory effect on Ang IIinduced ERK1/2 and Smad2/3 phosphorylation at 30 minutes, which was blocked by the AT1 blocker (losartan) and an inhibitor to ERK MAPK (PD98059; Figure 5C). In contrast, TGF-ß signaling was defective and TGF-ßinduced Smad2/3 phosphorylation at 24 hours was prevented in conditional KO TßRII VSMCs (Figure 5C).
|
The Early ERK MAPKSmad Signaling Pathway Is Necessary for Ang IIInduced Vascular Fibrosis
Although it is well known that Ang II acts by stimulating TGF-ß to induce collagen matrix synthesis in VSMCs,1 it is not known whether the TGF-ßindependent ERK1/2 MAPKSmad signaling pathway is functionally important and contributes to vascular fibrosis in response to Ang II. This was examined in VSMCs that were conditionally deleted for TßRII. As shown in Figure 6, Ang II was able to induce a specific Smad3/4 promoter activity as well as collagen type I mRNA expression at 6 hours in both floxed and conditional KO VSMCs, which was blocked by addition of losartan and an ERK1/2 inhibitor. In contrast, deletion of TßRII prevented TGF-ßinduced Smad3/4 promoter activity and collagen I mRNA expression (Figure 6A and 6B). These results demonstrate that the early ERK MAPKSmad signaling pathway is necessary for Ang IIinduced vascular fibrosis.
|
Smad3, But Not Smad2, Is a Critical Mediator of Smad Signaling for Vascular Sclerosis in Response to Ang II
After identifying the TGF-ßdependent and independent Ang IISmad signaling pathways in VSMCs, we next asked the question as to how important the Smad signaling pathway is in vascular fibrosis in response to Ang II. This was tested in VSMCs that lack Smad3 or conditional KO for Smad2. As shown in Figure 7, Ang II was able to induce collagen expression in a time-dependent manner in Smad3 WT VSMCs. Strikingly, Ang II and TGF-ß (positive control)induced collagen I expression was completely abolished in VSMCs null for Smad3, demonstrating a critical role for Smad3 in vascular sclerosis in response to Ang II.
|
What is the specific role for Smad2 in Ang IIinduced vascular fibrosis? Because mice lacking Smad2 is embryonic lethal,17 we generated conditional KO Smad2 VSMCs by infecting Smad2f/f VSMCs with Cre-expressing adenovirus (Figure 8A and B). Interestingly, deletion of Smad2 produced no inhibitory effect on Ang II and TGF-ßinduced collagen I expression (Figure 8D) but was blocked by addition of losartan and an ERK1/2 inhibitor (PD98059), demonstrating that Smad2 may be not required in Ang II as well as TGF-ßmediated vascular sclerosis.
|
| Discussion |
|---|
|
|
|---|
It is known that Ang II signals through the AT1 receptor to activate ERK1/2, p38, and JNK MAPK to exert its biological effects in VSMCs via transactivation of the epithelial growth factor receptor.18 In the present study, the identification of Ang IIinduced ERK1/2 MAPKSmad signaling cross-talk pathway in VSMCs provides a new signaling mechanism by which Ang II mediates vascular remodeling in pathophysiologic conditions. It has been shown that activation of ERK1/2 is involved in TGF-ßinduced Smad2 phosphorylation and aggrecanin and furin gene expression,19 implying that Smad proteins can act as signal integrators. This is further confirmed by the finding that Smads can be phosphorylated by other signaling pathways, including MAPKs and the calmodulin-dependent protein kinase II.2024 Our results show that the ERK1/2-Smad signaling cross-talk pathway appears to be a critical mechanism of Ang IImediated vascular fibrosis. However, discrepancy exists in the role of ERKSmad cross-talk pathway between our study and Rodriguez-Vitas study.10 This discrepancy might be attributable to the differences of species of VSMCs or strategies to block the ERK1/2 activities. Nevertheless, our findings using the combination of pharmaceutical ERK1/2 inhibitor, molecular blockade by overexpressing DN-ERK1/2 or DN-TßRII, and genetic deletion of TßRII to indicate that Ang II can activate Smads directly via the ERK MAPK-dependent mechanism.
Another significant finding in the present study is that Smad3 but not Smad2 is necessary for the Ang IIinduced collagen matrix production in VSMCs. Although Smad2 and Smad3 have >90% homology in their amino acid sequences and both are mediators of the functions of TGF-ß, Smad3 but not Smad2 has binding sequences for COL1A2, COL2A1, COL3A1, COL5A1, COL6A1, and COL6A3 genes25 and can bind directly to DNA to regulate gene transcription.26 These differences may lead to a distinctive role for Smad2 and Smad3 in Ang IImediated vascular fibrosis. Developmentally, deletion of Smad2 leads to early embryonic death,17 whereas Smad3 KO mice are viable.27 Pathophysiologically, Smad3 is responsible for the induction of c-fos, Smad7, TGF-ß, and tissue inhibitor of metalloproteinase-1 (TIMP-1), whereas induction of matrix metalloproteinase-2 by TGF-ß is Smad2 dependent.2830 All these findings suggest that Smad3 may be a key mediator in the process of fibrosis. This is consistent with Kobayashi et als report that lack of Smad3 decreased ECM deposition in Ang IIinduced vascular injury while enhancing neointimal hyperplasia.31 Indeed, TGF-ß has multiple functions. TGF-ß can counteract proliferative effect of Ang II on VSMCs, another deleterious effect of Ang II in arteriosclerosis. It seems that Smad3 plays a critical role in the antiproliferation effect of TGF-ß.
In summary, Smad signaling is activated in association with arteriosclerosis in patients with hypertension. Ang II is able to activate an early Smad signaling directly via the AT1 receptormediated ERK1/2 MAPK pathway, in addition to the late TGF-ßdependent mechanism. Activation of Smad3 but not Smad2 was a key mechanism of arteriosclerosis in response to Ang II. Findings from this study indicate that inhibition of Smad signaling may be one mechanism by which blockade of Ang II angiotensin-converting enzyme inhibitor or AT1 receptor blockers can prevent or slow the progression of chronic cardiovascular diseases.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Miao CY, Tao X, Gong K, Zhang SH, Chu ZX, Su DF. Arterial remodeling in chronic sinoaortic-denervated rats. J Cardiovasc Pharmacol. 2001; 37: 615.[CrossRef][Medline] [Order article via Infotrieve]
3. Lombardi DM, Viswanathan M, Vio CP, Saavedra JM, Schwartz SM, Johnson RJ. Renal and vascular injury induced by exogenous angiotensin II is AT1 receptor-dependent. Nephron. 2001; 87: 6674.[CrossRef][Medline] [Order article via Infotrieve]
4. Hayashi T, Sohmiya K, Ukimura A, Endoh S, Mori T, Shimomura H, Okabe M, Terasaki F, Kitaura Y. Angiotensin II receptor blockade prevents microangiopathy and preserves diastolic function in the diabetic rat heart. Heart. 2003; 89: 12361242.
5. Kakinuma Y, Kawamura T, Bills T, Yoshioka T, Ichikawa I, Fogo A. Blood pressure-independent effect of angiotensin inhibition on vascular lesions of chronic renal failure. Kidney Int. 1992; 42: 4655.[Medline] [Order article via Infotrieve]
6. Boffa JJ, Lu Y, Placier S, Stefanski A, Dussaule JC, Chatziantoniou C, Tharaux PL, Ardaillou R. Regression of renal vascular and glomerular fibrosis: role of angiotensin II receptor antagonism and matrix metalloproteinases. J Am Soc Nephrol. 2003; 14: 11321144.
7. Zhuo J, Moeller I, Jenkins T, Chai SY, Allen AM, Ohishi M, Mendelsohn FA. Mapping tissue angiotensin-converting enzyme and angiotensin AT1, AT2 and AT4 receptors. J Hypertens. 1998; 16: 20272037.[CrossRef][Medline] [Order article via Infotrieve]
8. Touyz RM, Berry C. Recent advances in angiotensin II signaling. Braz J Med Biol Res. 2002; 35: 10011015.[Medline] [Order article via Infotrieve]
9. Massague J. TGF-beta signal transduction. Annu Rev Biochem. 1998; 67: 753791.[CrossRef][Medline] [Order article via Infotrieve]
10. Rodriguez-Vita J, Sanchez-Lopez E, Esteban V, Ruperez M, Egido J, Ruiz-Ortega M. Angiotensin II activates the Smad pathway in vascular smooth muscle cells by a transforming growth factor-beta-independent mechanism. Circulation. 2005; 111: 25092517.
11. Li JH, Huang XR, Zhu HJ, Oldfield M, Cooper M, Truong LD, Johnson RJ, Lan HY. Advanced glycation end products activate Smad signaling via TGF-beta-dependent and independent mechanisms: implications for diabetic renal and vascular disease. FASEB J. 2004; 18: 176178.
12. Wang W, Huang XR, Li AG, Liu F, Li JH, Truong LD, Wang XJ, Lan HY. Signaling mechanism of TGF-{beta}1 in prevention of renal inflammation: role of Smad7. J Am Soc Nephrol. 2005; 16: 13711383.
13. Wang W, Tzanidis A, Divjak M, Thomson NM, Stein-Oakley AN. Altered signaling and regulatory mechanisms of apoptosis in focal and segmental glomerulosclerosis. J Am Soc Nephrol. 2001; 12: 14221433.
14. Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S, Gauthier JM. Direct binding of Smad3 and Smad4 to critical TGF beta-inducible elements in the promoter of human plasminogen activator inhibitor-type 1 gene. EMBO J. 1998; 17: 30913100.[CrossRef][Medline] [Order article via Infotrieve]
15. Chatziantoniou C, Boffa JJ, Tharaux PL, Flamant M, Ronco P, Dussaule JC. Progression and regression in renal vascular and glomerular fibrosis. Int J Exp Pathol. 2004; 85: 111.[CrossRef][Medline] [Order article via Infotrieve]
16. Oshima M, Oshima H, Taketo MM. TGF-beta receptor type II deficiency results in defects of yolk sac hematopoiesis and vasculogenesis. Dev Biol. 1996; 179: 297302.[CrossRef][Medline] [Order article via Infotrieve]
17. Nomura M, Li E. Smad2 role in mesoderm formation, left-right patterning and craniofacial development. Nature. 1998; 393: 786790.[CrossRef][Medline] [Order article via Infotrieve]
18. Lautrette A, Li S, Alili R, Sunnarborg SW, Burtin M, Lee DC, Friedlander G, Terzi F. Angiotensin II and EGF receptor cross-talk in chronic kidney diseases: a new therapeutic approach. Nat Med. 2005; 11: 867874.[CrossRef][Medline] [Order article via Infotrieve]
19. Blanchette F, Rivard N, Rudd P, Grondin F, Attisano L, Dubois CM. Cross-talk between the p42/p44 MAP kinase and Smad pathways in transforming growth factor beta 1-induced furin gene transactivation. J Biol Chem. 2001; 276: 3398633994.
20. Funaba M, Zimmerman CM, Mathews LS. Modulation of Smad2-mediated signaling by extracellular signal-regulated kinase. J Biol Chem. 2002; 277: 4136141368.
21. Kretzschmar M, Doody J, Timokhina I, Massague J. A mechanism of repression of TGFbeta/ Smad signaling by oncogenic Ras. Genes Dev. 1999; 13: 804816.
22. Engel ME, McDonnell MA, Law BK, Moses HL. Interdependent SMAD and JNK signaling in transforming growth factor-beta-mediated transcription. J Biol Chem. 1999; 274: 3741337420.
23. Wicks SJ, Lui S, Abdel-Wahab N, Mason RM, Chantry A. Inactivation of smad-transforming growth factor beta signaling by Ca(2+)-calmodulin-dependent protein kinase II. Mol Cell Biol. 2000; 20: 81038111.
24. Furukawa F, Matsuzaki K, Mori S, Tahashi Y, Yoshida K, Sugano Y, Yamagata H, Matsushita M, Seki T, Inagaki Y, Nishizawa M, Fujisawa J, Inoue K. p38 MAPK mediates fibrogenic signal through Smad3 phosphorylation in rat myofibroblasts. Hepatology. 2003; 38: 879889.[CrossRef][Medline] [Order article via Infotrieve]
25. Chen SJ, Yuan W, Mori Y, Levenson A, Trojanowska M, Varga J. Stimulation of type I collagen transcription in human skin fibroblasts by TGF-beta: involvement of Smad 3. J Invest Dermatol. 1999; 112: 4957.[CrossRef][Medline] [Order article via Infotrieve]
26. Yagi K, Goto D, Hamamoto T, Takenoshita S, Kato M, Miyazono K. Alternatively spliced variant of Smad2 lacking exon 3. Comparison with wild-type Smad2 and Smad3. J Biol Chem. 1999; 274: 703709.
27. Yang X, Letterio JJ, Lechleider RJ, Chen L, Hayman R, Gu H, Roberts AB, Deng C. Targeted disruption of SMAD3 results in impaired mucosal immunity and diminished T cell responsiveness to TGF-beta. EMBO J. 1999; 18: 12801291.[CrossRef][Medline] [Order article via Infotrieve]
28. Piek E, Ju WJ, Heyer J, Escalante-Alcalde D, Stewart CL, Weinstein M, Deng C, Kucherlapati R, Bottinger EP, Roberts AB. Functional characterization of transforming growth factor beta signaling in Smad2- and Smad3-deficient fibroblasts. J Biol Chem. 2001; 276: 1994519953.
29. Yuan W, Varga J. Transforming growth factor-beta repression of matrix metalloproteinase-1 in dermal fibroblasts involves Smad3. J Biol Chem. 2001; 276: 3850238510.
30. Verrecchia F, Chu ML, Mauviel A. Identification of novel TGF-beta /Smad gene targets in dermal fibroblasts using a combined cDNA microarray/promoter transactivation approach. J Biol Chem. 2001; 276: 1705817062.
31. Kobayashi K, Yokote K, Fujimoto M, Yamashita K, Sakamoto A, Kitahara M, Kawamura H, Maezawa Y, Asaumi S, Tokuhisa T, Mori S, Saito Y. Targeted disruption of TGF-beta-Smad3 signaling leads to enhanced neointimal hyperplasia with diminished matrix deposition in response to vascular injury. Circ Res. 2005; 96: 904912.
32. Ju W, Ogawa A, Heyer J, Nierhof D, Yu L, Kucherlapati R, Shafritz DA, Bottinger EP. Deletion of Smad2 in mouse liver reveals novel functions in hepatocyte growth and differentiation. Mol Cell Biol. 2006; 26: 654667.
Related Article:
Circ. Res. 2006 98: 988-989.
This article has been cited by other articles:
![]() |
N. Sawada, H. Itoh, K. Miyashita, H. Tsujimoto, M. Sone, K. Yamahara, Z. P. Arany, F. Hofmann, and K. Nakao Cyclic GMP Kinase and RhoA Ser188 Phosphorylation Integrate Pro- and Antifibrotic Signals in Blood Vessels Mol. Cell. Biol., November 15, 2009; 29(22): 6018 - 6032. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Yang, A. C.K. Chung, X. R. Huang, and H. Y. Lan Angiotensin II Induces Connective Tissue Growth Factor and Collagen I Expression via Transforming Growth Factor-{beta}-Dependent and -Independent Smad Pathways: The Role of Smad3 Hypertension, October 1, 2009; 54(4): 877 - 884. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ikeda, K.-i. Aihara, S. Yoshida, T. Sato, S. Yagi, T. Iwase, Y. Sumitomo, T. Ise, K. Ishikawa, H. Azuma, et al. Androgen-Androgen Receptor System Protects against Angiotensin II-Induced Vascular Remodeling Endocrinology, June 1, 2009; 150(6): 2857 - 2864. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Garamszegi, S. P. Garamszegi, L. A. Shehadeh, and S. P. Scully Extracellular Matrix-Induced Gene Expression in Human Breast Cancer Cells Mol. Cancer Res., March 1, 2009; 7(3): 319 - 329. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Haydont, B. L. Riser, J. Aigueperse, and M.-C. Vozenin-Brotons Specific signals involved in the long-term maintenance of radiation-induced fibrogenic differentiation: a role for CCN2 and low concentration of TGF-{beta}1 Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1332 - C1341. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yagi, K.-i. Aihara, Y. Ikeda, Y. Sumitomo, S. Yoshida, T. Ise, T. Iwase, K. Ishikawa, H. Azuma, M. Akaike, et al. Pitavastatin, an HMG-CoA Reductase Inhibitor, Exerts eNOS-Independent Protective Actions Against Angiotensin II Induced Cardiovascular Remodeling and Renal Insufficiency Circ. Res., January 4, 2008; 102(1): 68 - 76. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Page, D. A. Chan, A. J. Giaccia, M. Levine, and D. E. Richard Hypoxia-inducible Factor-1{alpha} Stabilization in Nonhypoxic Conditions: Role of Oxidation and Intracellular Ascorbate Depletion Mol. Biol. Cell, January 1, 2008; 19(1): 86 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. V. Esguerra, L. Nelles, L. Vermeire, A. Ibrahimi, A. D. Crawford, R. Derua, E. Janssens, E. Waelkens, P. Carmeliet, D. Collen, et al. Ttrap is an essential modulator of Smad3-dependent Nodal signaling during zebrafish gastrulation and left-right axis determination Development, December 15, 2007; 134(24): 4381 - 4393. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ruiz-Ortega, J. Rodriguez-Vita, E. Sanchez-Lopez, G. Carvajal, and J. Egido TGF-{beta} signaling in vascular fibrosis Cardiovasc Res, May 1, 2007; 74(2): 196 - 206. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Jeon, H. J. Moon, M. J. Lee, H. Y. Song, Y. M. Kim, Y. C. Bae, J. S. Jung, and J. H. Kim Sphingosylphosphorylcholine induces differentiation of human mesenchymal stem cells into smooth-muscle-like cells through a TGF-{beta}-dependent mechanism J. Cell Sci., December 1, 2006; 119(23): 4994 - 5005. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Milliat, A. Francois, M. Isoir, E. Deutsch, R. Tamarat, G. Tarlet, A. Atfi, P. Validire, J. Bourhis, J.-C. Sabourin, et al. Influence of Endothelial Cells on Vascular Smooth Muscle Cells Phenotype after Irradiation: Implication in Radiation-Induced Vascular Damages Am. J. Pathol., October 1, 2006; 169(4): 1484 - 1495. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sorescu Smad3 Mediates Angiotensin II- and TGF-{beta}1-Induced Vascular Fibrosis: Smad3 Thickens the Plot Circ. Res., April 28, 2006; 98(8): 988 - 989. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |