Published online before print March 16, 2006, doi: 10.1161/01.RES.0000217402.73402.cd
© 2006 American Heart Association, Inc.
Clinical Research |
Positive Inotropic Effects by Uridine Triphosphate (UTP) and Uridine Diphosphate (UDP) via P2Y2 and P2Y6 Receptors on Cardiomyocytes and Release of UTP in Man During Myocardial Infarction
From the Departments of Cardiology (A.-K.W., L.W., C.B., D.E.) and Experimental Medical Science (J.B., A.A.), Lund University, Sweden; the Molecular Recognition Section (B.V.J., K.A.J.), National Institutes of Health, Bethesda, Md; the Department of Medicine (E.L.), University of North Carolina, School of Medicine, Chapel Hill; and the Department of Physiology and Pharmacology (Y.D., A.A.), Karolinska Institutet, Stockholm, Sweden.
Correspondence to Dr Anna-Karin Wihlborg, Department of Cardiology, Tornavägen 10 BMC:C12, Lund 22237, Sweden. E-mail anna-karin.wihlborg{at}kard.lu.se
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The aim of this study was to examine a possible role for extracellular pyrimidines as inotropic factors for the heart. First, nucleotide plasma levels were measured to evaluate whether UTP is released in patients with coronary heart disease. Then, inotropic effects of pyrimidines were examined in isolated mouse cardiomyocytes. Finally, expression of pyrimidine-selective receptors (a subgroup of the P2 receptors) was studied in human and mouse heart, using real time polymerase chain reaction, Western blot, and immunohistochemistry. Venous plasma levels of UTP were increased (57%) in patients with myocardial infarction. In electrically stimulated cardiomyocytes the stable P2Y2/4 agonist UTP
S increased contraction by 52%, similar to ß1-adrenergic stimulation with isoproterenol (65%). The P2Y6-agonist UDPßS also increased cardiomyocyte contraction (35%), an effect abolished by the P2Y6-blocker MRS2578. The phospholipase C inhibitor U73122 inhibited both the UDPßS and the UTPS-induced inotropic effect, indicating an IP3-mediated effect via P2Y6 receptors. The P2Y14 agonist UDP-glucose was without effect. Quantification of mRNA with real time polymerase chain reaction revealed P2Y2 as the most abundant pyrimidine receptor expressed in cardiomyocytes from man. Presence of P2Y6 receptor mRNA was detected in both species and confirmed at protein level with Western blot and immunohistochemistry in man. In conclusion, UTP levels are increased in humans during myocardial infarction, giving the first evidence for UTP release in man. UTP is a cardiac inotropic factor most likely by activation of P2Y2 receptors in man. For the first time we demonstrate inotropic effects of UDP, mediated by P2Y6 receptors via an IP3-dependent pathway. Thus, the extracellular pyrimidines (UTP and UDP) could be important inotropic factors involved in the development of cardiac disease.
Key Words: P2-receptors • inotropy • heart • UTP • UDP
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The cardiac effects of purines such as adenosine, adenosine triphosphate (ATP), and adenosine diphosphate (ADP) have been extensively studied since the first functional findings by Drury and Szent-Györgi in 1929.1 Purines were subsequently found to have specific receptors in the surface membrane of the cardiac myocytes. However, only a few studies have focused on the effect of pyrimidines, such as uridine triphosphate (UTP) and uridine diphosphate (UDP), in the heart.
UTP alone has been shown to have inotropic effects in the heart, but previous studies have been performed with unstable nonselective agonists, and receptor characterization has not been possible. Furthermore, even though the release of purines has been extensively studied in different models, the release of pyrimidines has never been examined in human patients.
The extracellular nucleotides, ATP and ADP, are released from sympathetic nerves, activated platelets, erythrocytes, cardiac tissue, inflammatory, endothelial, and smooth muscle cells.4–6 In the heart, hypoxic conditions are prominent activators of ATP release.6,7 There is limited knowledge considering release of pyrimidines. Continuous release of UDP-glucose from endothelial cells has been detected, however no correlation to ATP release has been observed.8 Using a pig model we recently demonstrated that UTP is released from the heart during ischemia.9 However, the release of pyrimidines from the human heart under ischemic conditions has not been studied.
The extracellular nucleotides activate membrane-bound purine receptors (P2 receptors), which is one of the largest known receptor families.10 P2 receptors are divided into two classes: ligand-gated intrinsic ion channels, called P2X receptors, and G protein–coupled P2Y receptors.10 New P2Y receptor subtypes activated not only by purines but also pyrimidines have been identified. UTP, UDP, and UDP glucose activates at least four subtypes of P2Y receptors: P2Y2, P2Y4, P2Y6, and P2Y14.2,3 UTP is an agonist for P2Y213 and P2Y4 receptors.14 P2Y6 is activated by UDP13,15 and UTP glucose activates P2Y14 receptors.16 P2Y2 is activated by both UTP and ATP.
The P2Y family is divided into two structurally-distinct subfamilies. The first is composed of P2Y1, P2Y2, P2Y4, P2Y6, and P2Y11 receptors, all coupled to Gq, which promotes phospholipase C (PLC) and subsequent mobilization of intracellular calcium.11,12 The members of the second subfamily P2Y12, P2Y13, and P2Y14 are coupled to Gi, inhibiting adenylate cyclase.
Extracellular ATP is known to increase cytosolic calcium in cardiac myocytes and to have inotropic effects.5,17,18 We recently examined the effects of purines in cardiomyocytes and found potent inotropic ATP effects mediated via a P2Y11-like receptor.18 Regarding pyrimidines, the unstable agonist UTP has been shown to induce a positive inotropic effect in rat atria and in rat and guinea pig ventricular cardiomyocytes,19–22 but the effects of UDP and UDP-glucose has not been investigated. Furthermore, there is a need to characterize which receptor mediates the inotropic effect of UTP.
We wanted to examine whether pyrimidines are released in man, evaluate their inotropic effects, and investigate which pyrimidine selective receptors are expressed in the human heart. The first objective was to quantify the plasma level of uridine nucleotides in patients with acute ischemic heart disease. The second objective was to examine the inotropic effects of selective pyrimidine receptor agonists. Because of the limited availability of human cardiomyocytes, pharmacological characterization of pyrimidine selective P2Y receptor function was done in cardiomyocytes from mice. The third objective was to analyze expression of P2-receptors in the heart using quantitative real-time polymerase chain reaction (PCR), Western blot, and immunohistochemistry.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Patients Enrolled for UTP Measurements
Sixty-four patients were enrolled from the patients admitted for chest pain to the emergency ward, Lund University Hospital 2001 to 2003. Patients with chest pain within the last hour before admittance were eligible for inclusion in this study. Exclusion criteria were: patients treated with aspirin, clopidogrel, dipyridamole, nonsteroidal antiinflammatory drugs, heparin, low molecular heparin, or warfarin. Even patients who received a bolus dose of aspirin in the ambulance on their way to hospital were excluded. Furthermore, patients were excluded if they had a platelet count <140x109/L, hemoglobin <90 g/L, renal failure (creatinine >140 µmol/L), or hemolysis in blood samples. Based on the diagnosis at discharge, three prespecified subgroups were compared: chest pain with no sign of cardiac disease (NCD), non–ST elevation myocardial infarction (NSTEMI), and ST elevation myocardial infarction (STEMI). The study included 43 men and 21 women in the mean age of 68±12 years. The NCD group was composed of patients with normal ECGs (or no new changes compared with a previous ECG), normal values of cardiac markers (TroponinT), and when appropriate, a negative exercise test. This UTP measurement study was a substudy of a larger study on ATP release during ischemic heart disease.23 For more methodological details see below.
Quantification of Nucleotides
UTP was measured in all 64 patients. Based on diagnosis 64 patients were grouped into STEMI (16 patients), NSTEMI (16 patients), and NCD (32 patients). Sampling was done at admission. Blood (5 mL) was added to tubes containing citrate and immediately centrifuged for 10 minutes at 1200g, 4°C. Platelet contamination was excluded by Bürker chamber examination. The plasma was aspirated and mixed with an equal amount of 10% trichloroacetic acid (TCA) to precipitate all proteins and inactivate ectonucleotidases. Samples were treated and UTP was quantified as previously described.18,24
Animals
Adult female NMRI mice (B&K AB, Sollentuna, Sweden), 5 to 6 months old, were used for isolation of cardiomyocytes. The animals were kept in the university animal facilities with free access to food and water according to regulations of the local animal ethics committee.
Isolation and Contraction of Cardiomyocytes
The mice were euthanized by cervical dislocation. The cardiomyocytes were isolated as previously described.18
Cardiomyocyte Contraction
The cells could be kept with unaltered contractile properties for up to 4 hours in a Hepes-buffered saline solution (1.8 mmol/L Ca2+) in room temperature.25 To observe the cell shortening we used an inverted microscope and a video recording system. The cells were analyzed in a Krebs-Henseleit solution (1.8 mmol/L Ca2+) composition adjusted to give pH 7.4 when oxygenated with O2/CO2 (95%/5%) at room temperature. Stimulation voltage was set to 20% above threshold and impulse duration was 4 ms at 0.5Hz. The cell length during shortening was analyzed using an optical edge tracking method. The shortening, measured in pixels, was compared before and after addition of drug to the electrically stimulated cardiomyocyte in the cuvette. The shortening responses were expressed relative to the amplitude of responses determined in the cells before addition of drug. The extent of shortening was approximately 5% of total cell length. The cells were stimulated with additions of the agonists UTPS or UDPßS. To further investigate the signaling pathway of the response to stimulation with UDPßS the contracting cardiomyocytes were incubated with the P2Y6 blocker MRS2578. The signaling pathway mediating the effect of UDPßS was also studied by exposure to a PLC inhibitor, U73133, and an adenylyl cyclase inhibitor, SQ22563. The cells were preincubated for 5 minutes with inhibitors before addition of agonist.
RT-PCR Assay and Real-Time PCR
Total RNA was prepared from the mouse cardiomyocytes using the RNAeasy column (Qiagen) and the RNA was reverse-transcribed using Multiscribe RT Kit (Qiagen). Real time-PCR reactions on mouse RNA were performed with primers designed using the VectorNTI software (Invitrogen). The transcribed cDNA was amplified in a LightCycler using 1xLightCycler DNA Master SYBR Green I mix (Roche Diagnostics). The procedure has previously been described.18 The amount of receptor was expressed relative to the housekeeping gene GAPDH. To amplify the receptors the following primers were used; P2Y2 forward (fw) GCTTCAACGAGGACTTCAAG, reversed (rw) GTAATAAACCAACAGCGGCA P2Y4 fw TCACTTGCCATGACACCTCGG, rw AATGGTGCGCACAGACTTGC P2Y6: fw TGACCCGTTCCGCTGTGTAC, rw GCGCTGGAAGCTAATGCAGG, GAPDH fw GGTCATCCCAGAGCTGAACG, rw TTGCTGTTGAAGTCGCAGGA.
Human Heart Tissue Preparation
Hearts were explanted in the process of heart transplantation from 5 patients who were between 52 and 64 years of age and experienced ischemic heart disease or dilated cardiomyopathy. Samples were not taken from infarcted areas. The hearts were immediately examined in the operating room and myocardial tissue samples from the wall of the left and right ventricles and the left and right atria were removed gently and immersed in cold oxygenated Hepes-buffered saline solution. The epicardial and endocardial parts were removed from the pieces from the ventricles. Tissue samples were snap-frozen in liquid nitrogen or fixed in formalin immediately after acquisition. Total cellular RNA was extracted as above. The real-time PCR reactions on human RNA were performed as described earlier.26
Western Blot
Protein electrophoresis was performed on 10% Tris-HCl polyacrylamide ready gels (Bio-Rad Laboratories) and electroblotted onto Hybond-C nitrocellulose membranes (0.45 µm; Amersham Pharmacia Biotech). Protein loading of 15 µg for each well was diluted with 4xSDS-reducing sample buffer. The membranes were incubated with rabbit antihuman P2Y6 (1:250; GlaxoSmithKline); thereafter, they were incubated with a secondary antibody (anti-rabbit Ig, horseradish peroxidase-linked, 1:1500; Amersham Life Science). The proteins were visualized by chemiluminescence using the ECLTM Western blotting RPN 2108 system (Amersham Pharmacia Biotech).
Immunocytochemistry
Human heart tissue samples were fixed in formalin, embedded in paraffin, and cut in 5-µm sections. The avidin-biotin-peroxidase complex method for antibody detection was used. After incubation with normal serum, sections were incubated with anti-P2Y6 antibodies. Anti-P2Y6 antibody was produced by GlaxoSmithKline. Bound primary antibody was detected using VECTASTAIN Elite ABC kit and developed with DAB substrate kit for peroxidase. After counterstaining with VECTOR hematoxylin QS nuclear counterstain (Modified Mayer Formula), the slides were examined microscopically.
Drugs
Isoproterenol, SQ22563, and U73122 were purchased from Sigma. UTPS and UDPS were gifts from Inspire Pharmaceuticals (Chapel Hill, NC); MRS2578 was a gift from KA Jacobson (National Institutes of Health, Bethesda, Md). All the drugs were dissolved in 0.9% saline.
Ethics
The Ethics Committee of Lund University approved the project involving human subjects. The project complies with the Declaration of Helsinki and all patients gave written consent to participation in the study. The animal study conforms to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publication No. 85-23, revised 1996). The animal experiments were approved by the local animal ethics committee.
Calculation and Statistics
Calculations and statistics were performed using the Graph-Pad Prism 3.02 software. n denotes the number of cells if otherwise not stated. Statistical significance was accepted when P<0.05. Raw data from cardiomyocyte experiments were analyzed with paired Student t test, and cardiomyocyte shortening after drug addition was compared with cardiomyocyte shortening before addition of the drug, referred to as the control. Values are presented as mean±SEM. UTP levels were compared with Kruskal–Wallis test followed by Dunnett multiple comparisons. Spearman rank correlation coefficient test was used for regression analysis.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human venous plasma levels of UTP were significantly increased in STEMI (22±3, n=17 nmol/L, P<0.05) compared with NCD (14±3nmol/L, n=32) (Figure 1a). There was no difference between patients with NSTEMI compared with controls (NCD). There was no difference between patients with diabetes mellitus or on aspirin treatment compared with controls. No difference in nucleotide concentration was found between males and females. Regression analysis of the whole material revealed a correlation between UTP and ATP (r2=0.44, P<0.001). UTP was present at
10% of the ATP concentration (Figure 1b).
|
Effects of ß-adrenergic and uridine nucleotide stimulation on shortening responses of mouse cardiomyocytes are shown in Figure 2. Isoproterenol (1 µmol/L) caused a 65±17% (n=24) increase in the cardiomyocyte contraction. The P2Y2/4 receptor agonist UTPS (1 µmol/L) caused an increase of 52±20% (n=20; Figure 2). The specific P2Y6 receptor agonist UDPßS (1 µmol/L) caused a 37±15% (n=19) increase in the myocyte contraction (Figure 2). The specific P2Y14 receptor agonist UDP glucose had no inotropic effects (Figure 2). The inotropic response to UDPßS was abolished by the selective P2Y6 blocker MRS2578 (10 µmol/L) and by the PLC inhibitor U73122 (10 µmol/L) (Figure 3). The UTPS-induced response was unaffected by the presence of the adenylyl cyclase inhibitor, SQ22563, but the effect was inhibited by U73122 (Figure 3). No effects were observed on cardiomyocyte shortening when MRS2578, U73122, and SQ22563 were administered separately (data not shown). Absolute values of cell contractions were (% cell shortening of total cell length): control (5.0±0.4%), isoproterenol (8.8±1.2%), UTPS (8.1±1.4%), UDPßS (7.7±0.8), U73122 (5.2±0.8%), UDPßS+U73122 (4.4±0.8%), and SQ22563 (5.1±0.6%); data presented as mean±SEM.
|
|
The expression of P2 receptor mRNA in mouse cardiomyocytes was quantified using real-time PCR. P2Y2 and P2Y4 were the most abundant pyrimidine selective receptors (P2Y4 133±19% expressed as percent of P2Y2 receptor mRNA) whereas expression of the P2Y6 receptor mRNA was lower (25±5%). The ADP responsive P2Y1 receptor had the highest expression among the P2Y receptors in the mouse heart. The results are shown in Figure 4.
|
The expression of P2 receptor mRNA was also quantified in the human heart (Figure 5). In the left ventricle P2Y2 was by far the highest expressed receptor followed by P2Y1 (52±11% expressed as percent of P2Y2 receptor mRNA). P2Y6 (8.2±0.3%) and P2Y11 (l7±2%) were also present in significant amounts, but the P2Y4 receptor had very low expression. The expression pattern was similar in the right ventricle and in the atria.
|
P2Y6 was detected using specific antibodies in immunohistochemistry and Western blot. The receptor was detected in both ventricles and atria of the human heart with a band of approximately 45 kD, which is in agreement with the expected size (Figure 6a). No band was found in the control membrane, indicating that the band represents the P2Y6 receptor. The same antibody was used in immunohistochemistry of human left ventricular heart tissue obtained from the explant heart at transplantation. Positive staining was seen for P2Y6 that was absent when control peptide was added or in controls without the primary antibody (Figure 6b). P2Y6 expression was only seen in cardiomyocytes and not in interstitial cells. The P2Y6 receptor expression was seen in the whole cardiomyocyte, with increased expression at the intercalated discs.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In our study we demonstrate that the plasma levels of UTP are significantly elevated in patients with acute myocardial infarction. A combination of pharmacology and mRNA quantification indicates that UTP is probably acting via P2Y2 receptors in man, and via both P2Y2 and P2Y4 receptors on cardiomyocytes from mice. Our results indicate that UDP is a novel inotropic factor acting via P2Y6 receptors.
The first demonstration of UTP release used [3H]uridine-labeled endothelial cells. In the study, [3H]UTP release occurred in response to increased flow.27 Since the development of the first sensitive quantitative assay for UTP, its release has been measured from a variety of cells including platelets, leukocytes, primary airway epithelial cells, rat astrocytes, and several other cell lines.24 To our knowledge, we are now the first to quantify UTP levels in human plasma. UTP levels correlated significantly with ATP, indicating corelease of the nucleotides. The UTP levels were 1:10 of the ATP levels, which is in the vicinity of the relationship between UTP and ATP in most cell types (usually approximately 1:5).24 Patients with acute myocardial infarction had significantly higher UTP levels, indicating release during ischemia. It was only possible to measure UTP from venous samples and thus it is not possible to establish the source of the released UTP. However, we recently performed animal studies in which the release was measured in blood from the cardiac vein, demonstrating UTP release from the heart during cardiac ischemia.9 UTP is therefore likely to be released from the heart by cardiomyocytes, but endothelial and red blood cells may also contribute. Platelets are less likely as a source because they contain minor amounts of UTP.24
On the surface of cardiac cells there are ectonucleotidases rapidly hydrolyzing nucleotides (UTP to UDP to UMP to uridine).28 Because UTP is rapidly degraded to UDP, these findings of cardiac UTP release indicate that UDP will be present in the circulation with possible actions on the heart via P2Y6 receptors. This rapid degradation also results in much lower plasma levels than the actual nucleotide concentrations at the cell surface. Measuring UTP release from the heart during cardiac ischemia the nucleotide concentrations in plasma are in 10–7 mol/L range.9 In this experiment we therefore choose the concentration of 10–6 mol/L, that may represent a physiologically relevant concentration.
Extracellular pyrimidines have several effects in the cardiovascular system. In the vasculature UDP and UTP induce vasoconstriction through P2Y receptor stimulation on vascular smooth muscle cells, but also dilatation acting on P2Y receptors on endothelial cells, thereby regulating vascular tone and blood pressure.3,4,29–31 Extracellular UTP and UDP have also been shown to mediate growth stimulation and cell migration in vascular smooth muscle cells and intimal hyperplasia.32–35 In rat cardiomyocytes, UTP has also been shown to cause hypertrophic growth.36 Furthermore, UTP is known to be a positive inotropic agent in rat atria and rat and guinea pig ventricular cardiomyocytes.19–22
UTP is selective to P2Y2/4 and UDP to P2Y6 in both man and mouse. Earlier studies have been performed with rapidly degradable UTP, making receptor characterization difficult. UTP is degraded to UDP and may even transfer phosphate groups to generate ATP. Experience from blood vessels and other tissues have shown that it is necessary to use stable and selective compounds.37 To analyze the inotropic effect of pyrimidine selective receptors stimulation, without interfering with degradation products, we used the stable pyrimidines: UTPS for selective stimulation of P2Y2 and P2Y4 receptors and UDPßS to selectively stimulate the P2Y6 receptor.35,37 UDP-glucose occurs naturally but is resistant to degradation and selective for P2Y14 receptors.
In the present study UTPS was nearly as strong an inotropic stimulator as the same concentration of isoproterenol. The selectivity of UTPS firmly establishes that the effect is mediated via P2Y2 or P2Y4 receptors. UDPßS also induced a positive inotropic effect in the cardiomyocytes, although slightly weaker. Recently, a selective P2Y6 receptor blocker, MRS2578, was developed by Jacobson and coworkers.38 Using this novel antagonist, the UDPßS response was totally blocked. This strongly indicates that UDP is a positive inotropic factor acting on the P2Y6 receptor. The P2Y14 receptor is coupled to Gi, which inhibits adenylyl cyclase resulting in a decreased cAMP level. This would theoretically result in a negative inotropic effect, but no inhibitory or stimulatory effect was observed when exposing the cardiomyocytes to UDP-glucose.
The inotropic mechanisms were studied using selective inhibitors of the intracellular pathways. The receptors P2Y2, P2Y4, and P2Y6 are Gq-coupled receptors mediating their response via PLC, resulting in increased IP3 and increased intracellular Ca2+ levels. UTP has previously been shown to be a positive inotropic agent in the heart mediating its effect via a PLC pathway.19 There is also some evidence that UTP induce cAMP elevation.39 The inotropic response induced by UTP was confirmed using the stable analogue, UTPS, confirming activation of the receptors P2Y2 or P2Y4. The PLC dependent pathway of P2Y2/4 was confirmed by the decreased inotropic effect of UTPS in presence of U73122. The possible involvement of cAMP was excluded because the adenylyl cyclase inhibitor SQ22563 did not attenuate the response to UTPS. The response to UDPßS was blocked by the PLC inhibitor U73122, confirming the involvement of a Gq-coupled receptor acting via IP3 generation.
To help discriminating between P2Y2 and P2Y4 effects and to establish cardiac expression patterns in man, we used real-time PCR to quantify the mRNA expression of P2 receptors in heart tissue from man and mouse. The P2Y2 receptor was abundant in both human and mouse heart tissue. The P2Y4 receptor was absent in man whereas in mouse it was present to about the same extent as P2Y2. This is similar to heart tissue from rat where P2Y2 and P2Y4 have shown to be expressed to the same extent.40 mRNA for the P2Y6 receptor was present in both mouse and man, but at a relatively low level. It is well known that the mRNA expression may not correlate directly with functional importance. Furthermore, the P2Y6 receptor has previously been shown to be more potently activated in vascular smooth muscles compared with the P2Y2 receptor, even though the receptors were expressed to about the similar extent at the mRNA level.26,30,40 This is probably because the P2Y6 receptor is resistant to desensitization during continued agonist stimulation.41,42 Detecting P2Y6 in human tissue by immunohistochemistry verified expression on the protein level and the functional pharmacology clearly demonstrated P2Y6 receptor mediated effects.
Apart from the pyrimidine selective receptors we also detected the ATP receptor P2Y11 in the human heart. This is consistent with recent published functional data from mouse cardiomyocytes.18 The murine P2Y11 receptor is not yet cloned, preventing quantification of its mRNA in mouse. P2Y1 was abundantly expressed in both species. However, previous functional studies of this receptor have not revealed any inotropic function in mouse cardiomyocytes.18
The presence of pyrimidines in the circulation and receptors by which UTP and UDP can activate IP3 in cardiomyocytes stimulating both inotropy and hypertrophy could indicate a similar role for pyrimidines as for angiotensin II. Angiotensin II receptor antagonists and angiotensin converting enzyme (ACE) inhibitors have been clinically successful in the treatment of hypertension and heart failure. Similar beneficial effects could possibly be found for selective UTP and UDP receptor antagonists, inhibiting peripheral resistance, inotropy, and cardiac hypertrophy. Another interesting aspect is protection during hypoxia. Yitzhaki and coworkers recently found that UTP protects rat cardiomyocytes against hypoxic injury.43 Together with our recent finding of UTP release during preconditioning9 it suggests that UTP could be involved in the preconditioning mechanism, ie, partly explaining why a brief period of ischemia protects against a subsequent period of hypoxia. Our receptor quantification in the human heart suggests that it is the P2Y2 receptor that is the appropriate target for drug therapy aiming at cardiac protection during myocardial infarction. The parallel release of UTP together with ATP could be important both by providing additional inotropic pathways but also by having other effects on the cardiomyocyte such as hypertrophic growth or protection against hypoxic stress. Furthermore, ATP effects are often counteracted by its degradation product adenosine. This is not the case for UTP.
In conclusion, patients with myocardial infarction have higher plasma levels of UTP. UTP and UDP induce a pronounced inotropic effect on mouse cardiomyocytes. mRNA quantification indicates that the inotropic effects of UTP are mediated via P2Y2 and/or P2Y4 receptors in mice and probably mediated by P2Y2 in man. We provide novel evidence for inotropic effects of UDP acting on the P2Y6 receptor on mouse cardiomyocytes. The mechanisms are mediated via PLC-mediated signaling and independent of cAMP. The extracellular pyrimidines UTP and UDP may be inotropic factors in man acting on P2Y2 and P2Y6 receptors. Synthetic agonists could thus be used as inotropic agents during circulatory shock, and antagonists may have effects similar to angiotensin II receptor blockers being beneficial in the treatment of hypertension and congestive heart failure.
|
Acknowledgments |
|---|
This study was supported by grants from the Swedish research council (AA:04X8268, DE:04X13130), the Swedish heart lung foundation, and Franke and Margareta Bergqvist Foundation, Lund University.
|
Footnotes |
|---|
*Both authors contributed equally to this study.
Original received June 15, 2005; revision received February 14, 2006; accepted March 2, 2006.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Drury A, Szent-Györgyi A. The physiological activity of adenine compounds with special reference to their action upon the mammalian heart. J Physiol (Lond). 1929; 68: 213–237.
2. Chambers JK, Macdonald LE, Sarau HM, Ames RS, Freeman K, Foley JJ, Zhu Y, McLaughlin MM, Murdock P, McMillan L, Trill J, Swift A, Aiyar N, Taylor P, Vawter L, Naheed S, Szekeres P, Hervieu G, Scott C, Watson JM, Murphy AJ, Duzic E, Klein C, Bergsma DJ, Wilson S, Livi GP. A G protein-coupled receptor for UDP-glucose. J Biol Chem. 2000; 275: 10767–10771.
3. Ralevic V, Burnstock G. Receptors for purines and pyrimidines. Pharmacol Rev. 1998; 50: 413–492.
4. Gordon JL. Extracellular ATP. effects, sources and fate. Biochem J. 1986; 233: 309–319.[Medline] [Order article via Infotrieve]
5. Vassort G. Adenosine 5'-triphosphate: a P2-purinergic agonist in the myocardium. Physiol Rev. 2001; 81: 767–806.
6. Clemens MG, Forrester T. Appearance of adenosine triphosphate in the coronary sinus effluent from isolated working rat heart in response to hypoxia. J Physiol. 1981; 312: 143–158.
7. Vial C, Owen P, Opie LH, Posel D. Significance of release of adenosine triphosphate and adenosine induced by hypoxia or adrenaline in perfused rat heart. J Mol Cell Cardiol. 1987; 19: 187–197.[CrossRef][Medline] [Order article via Infotrieve]
8. Lazarowski ER, Shea DA, Boucher RC, Harden TK. Release of cellular UDP-glucose as a potential extracellular signaling molecule. Mol Pharmacol. 2003; 63: 1190–1197.
9. Erlinge D, Harnek J, van Heusden C, Olivecrona G, Jern S, Lazarowski E. Uridine triphosphate (UTP) is released during cardiac ischemia. Int J Cardiol. 2005; 100: 427–433.[Medline] [Order article via Infotrieve]
10. Burnstock G. Introduction: P2 receptors. Curr Top Med Chem. 2004; 4: 793–803.[CrossRef][Medline] [Order article via Infotrieve]
11. Nicholas RA, Lazarowski ER, Watt WC, Li Q, Boyer J, Harden TK. Pharmacological and second messenger signalling selectivities of cloned P2Y receptors. J Auton Pharmacol. 1996; 16: 319–323.[Medline] [Order article via Infotrieve]
12. Communi D, Govaerts C, Parmentier M, Boeynaems JM. Cloning of a human purinergic P2Y receptor coupled to phospholipase C and adenylyl cyclase. J Biol Chem. 1997; 272: 31969–31973.
13. Nicholas RA, Watt WC, Lazarowski ER, Li Q, Harden K. Uridine nucleotide selectivity of three phospholipase C-activating P2 receptors: identification of a UDP-selective, a UTP-selective, and an ATP- and UTP-specific receptor. Mol Pharmacol. 1996; 50: 224–229.[Abstract]
14. Communi D, Motte S, Boeynaems JM, Pirotton S. Pharmacological characterization of the human P2Y4 receptor. Eur J Pharmacol. 1996; 317: 383–389.[CrossRef][Medline] [Order article via Infotrieve]
15. Communi D, Parmentier M, Boeynaems JM. Cloning, functional expression and tissue distribution of the human P2Y6 receptor. Biochem Biophys Res Commun. 1996; 222: 303–308.[CrossRef][Medline] [Order article via Infotrieve]
16. Freeman K, Tsui P, Moore D, Emson PC, Vawter L, Naheed S, Lane P, Bawagan H, Herrity N, Murphy K, Sarau HM, Ames RS, Wilson S, Livi GP, Chambers JK. Cloning, pharmacology, and tissue distribution of G-protein-coupled receptor GPR105 (KIAA0001) rodent orthologs. Genomics. 2001; 78: 124–128.[CrossRef][Medline] [Order article via Infotrieve]
17. Christie A, Sharma VK, Sheu SS. Mechanism of extracellular ATP-induced increase of cytosolic Ca2+ concentration in isolated rat ventricular myocytes. J Physiol. 1992; 445: 369–388.
18. Balogh J, and Wihlborg AK, Isackson H, Joshi BV, Jacobson KA, Arner A, Erlinge D. Phospholipase C and cAMP-dependent positive inotropic effects of ATP in mouse cardiomyocytes via P2Y11-like receptors. J Mol Cell Cardiol. 2005; 39: 223–230.[CrossRef][Medline] [Order article via Infotrieve]
19. Podrasky E, Xu D, Liang BT. A novel phospholipase C- and cAMP-independent positive inotropic mechanism via a P2 purinoceptor. Am J Physiol. 1997; 273: H2380–H2387.[Medline] [Order article via Infotrieve]
20. Froldi G, Pandolfo L, Chinellato A, Ragazzi E, Caparrotta L, Fassina G. Dual effect of ATP and UTP on rat atria: which types of receptors are involved? Naunyn Schmiedebergs Arch Pharmacol. 1994; 349: 381–386.[Medline] [Order article via Infotrieve]
21. Froldi G, Ragazzi E, Caparrotta L. Do ATP and UTP involve cGMP in positive inotropism on rat atria? Comp Biochem Physiol C Toxicol Pharmacol. 2001; 128: 265–274.[Medline] [Order article via Infotrieve]
22. Froldi G, Varani K, Chinellato A, Ragazzi E, Caparrotta L, Borea PA. P2X-purinoceptors in the heart: actions of ATP and UTP. Life Sci. 1997; 60: 1419–1430.[Medline] [Order article via Infotrieve]
23. Borna C, Lazarowski E, van Heusden C, Ohlin H, Erlinge D. Resistance to aspirin is increased by ST-elevation myocardial infarction and correlates with adenosine diphosphate levels. Thromb J. 2005; 3: 10.[CrossRef][Medline] [Order article via Infotrieve]
24. Lazarowski ER, Harden TK. Quantitation of extracellular UTP using a sensitive enzymatic assay. Br J Pharmacol. 1999; 127: 1272–1278.[CrossRef][Medline] [Order article via Infotrieve]
25. Liu B, Wohlfart B, Johansson BW. Effects of low temperature on contraction in papillary muscles from rabbit, rat, and hedgehog. Cryobiology. 1990; 27: 539–546.[CrossRef][Medline] [Order article via Infotrieve]
26. Wang L, Karlsson L, Moses S, Hultgardh-Nilsson A, Andersson M, Borna C, Gudbjartsson T, Jern S, Erlinge D. P2 receptor expression profiles in human vascular smooth muscle and endothelial cells. J Cardiovasc Pharmacol. 2002; 40: 841–853.[CrossRef][Medline] [Order article via Infotrieve]
27. Saiag B, Bodin P, Shacoori V, Catheline M, Rault B, and Burnstock G. Uptake and flow-induced release of uridine nucleotides from isolated vascular endothelial cells. Endothelium. 1995; 2: 279–285.
28. Harden TK, Lazarowski ER, Boucher RC. Release, metabolism and interconversion of adenine and uridine nucleotides: implications for G protein-coupled P2 receptor agonist selectivity. Trends Pharmacol Sci. 1997; 18: 43–46.[Medline] [Order article via Infotrieve]
29. Hrafnkelsdottir T, Erlinge D, Jern S. Extracellular nucleotides ATP and UTP induce a marked acute release of tissue-type plasminogen activator in vivo in man. Thromb Haemost. 2001; 85: 875–881.[Medline] [Order article via Infotrieve]
30. Malmsjo M, Hou M, Harden TK, Pendergast W, Pantev E, Edvinsson L, Erlinge D. Characterization of contractile P2 receptors in human coronary arteries by use of the stable pyrimidines uridine 5'-O-thiodiphosphate and uridine 5'-O-3-thiotriphosphate. J Pharmacol Exp Ther. 2000; 293: 755–760.
31. Wihlborg AK, Malmsjö M, Eyjolfsson A, Gustafsson R, Jacobson K, Erlinge D. Extracellular nucleotides induce vasodilatation in human arteries via prostaglandins, nitric oxide and endothelium-derived hyperpolarising factor. Br J Pharmacol. 2003; 138: 1451–1458.[CrossRef][Medline] [Order article via Infotrieve]
32. Pillois X, Chaulet H, Belloc I, Dupuch F, Desgranges C, Gadeau AP. Nucleotide receptors involved in UTP-induced rat arterial smooth muscle cell migration. Circ Res. 2002; 90: 678–681.
33. Seye CI, Kong Q, Erb L, Garrad RC, Krugh B, Wang M, Turner JT, Sturek M, Gonzalez FA, Weisman GA. Functional P2Y2 nucleotide receptors mediate uridine 5'-triphosphate-induced intimal hyperplasia in collared rabbit carotid arteries. Circulation. 2002; 106: 2720–2726.
34. Erlinge D, Yoo H, Edvinsson L, Reis DJ, Wahlestedt C. Mitogenic effects of ATP on vascular smooth muscle cells vs. other growth factors and sympathetic cotransmitters. Am J Physiol. 1993; 265: H1089–H1097.[Medline] [Order article via Infotrieve]
35. Hou M, Harden TK, Kuhn CM, Baldetorp B, Lazarowski E, Pendergast W, Moller S, Edvinsson L, Erlinge D. UDP acts as a growth factor for vascular smooth muscle cells by activation of P2Y(6) receptors. Am J Physiol Heart Circ Physiol. 2002; 282: H784–H792.
36. Pham TM, Morris JB, Arthur JF, Post GR, Brown JH, Woodcock EA. UTP but not ATP causes hypertrophic growth in neonatal rat cardiomyocytes. J Mol Cell Cardiol. 2003; 35: 287–292.[CrossRef][Medline] [Order article via Infotrieve]
37. Malmsjo M, Adner M, Harden TK, Pendergast W, Edvinsson L, Erlinge D. The stable pyrimidines UDPbetaS and UTPgammaS discriminate between the P2 receptors that mediate vascular contraction and relaxation of the rat mesenteric artery. Br J Pharmacol. 2000; 131: 51–56.[CrossRef][Medline] [Order article via Infotrieve]
38. Mamedova LK, Joshi BV, Gao ZG, von Kugelgen I, Jacobson KA. Diisothiocyanate derivatives as potent, insurmountable antagonists of P2Y6 nucleotide receptors. Biochem Pharmacol. 2004; 67: 1763–1770.[CrossRef][Medline] [Order article via Infotrieve]
39. Flitney FW, Singh J. Inotropic responses of the frog ventricle to adenosine triphosphate and related changes in endogenous cyclic nucleotides. J Physiol. 1980; 304: 21–42.
40. Hou M, Malmsjo M, Moller S, Pantev E, Bergdahl A, Zhao XH, Sun XY, Hedner T, Edvinsson L, Erlinge D. Increase in cardiac P2X1-and P2Y2-receptor mRNA levels in congestive heart failure. Life Sci. 1999; 65: 1195–1206.[CrossRef][Medline] [Order article via Infotrieve]
41. Robaye B, Boeynaems JM, Communi D. Slow desensitization of the human P2Y6 receptor. Eur J Pharmacol. 1997; 329: 231–236.[Medline] [Order article via Infotrieve]
42. Borna C, Wang L, Gudbjartsson T, Karlsson L, Jern S, Malmsjo M, Erlinge D. Contractions in human coronary bypass vessels stimulated by extracellular nucleotides. Ann Thorac Surg. 2003; 76: 50–57.
43. Yitzhaki S, Shneyvays V, Jacobson KA, Shainberg A. Involvement of uracil nucleotides in protection of cardiomyocytes from hypoxic stress. Biochem Pharmacol. 2005; 69: 1215–1223.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  T. Moore-Morris, A. Varrault, M. E. Mangoni, A. Le Digarcher, V. Negre, C. Dantec, L. Journot, J. Nargeot, and B. Couette Identification of Potential Pharmacological Targets by Analysis of the Comprehensive G Protein-Coupled Receptor Repertoire in the Four Cardiac Chambers Mol. Pharmacol., May 1, 2009; 75(5): 1108 - 1116. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. B. Rosenmeier, G. G. Yegutkin, and J. Gonzalez-Alonso Activation of ATP/UTP-selective receptors increases blood flow and blunts sympathetic vasoconstriction in human skeletal muscle J. Physiol., October 15, 2008; 586(20): 4993 - 5002. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Alvarez, A. Coulombe, O. Cazorla, M. Ugur, J.-M. Rauzier, J. Magyar, E.-L. Mathieu, G. Boulay, R. Souto, P. Bideaux, et al. ATP/UTP activate cation-permeable channels with TRPC3/7 properties in rat cardiomyocytes Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H21 - H28. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. P. Fricks, S. Maddileti, R. L. Carter, E. R. Lazarowski, R. A. Nicholas, K. A. Jacobson, and T. K. Harden UDP Is a Competitive Antagonist at the Human P2Y14 Receptor J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 588 - 594. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Gergs, P. Boknik, W. Schmitz, A. Simm, R.-E. Silber, and J. Neumann A positive inotropic effect of ATP in the human cardiac atrium Am J Physiol Heart Circ Physiol, April 1, 2008; 294(4): H1716 - H1723. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Domeier, A. V. Zima, J. T. Maxwell, S. Huke, G. A. Mignery, and L. A. Blatter IP3 receptor-dependent Ca2+ release modulates excitation-contraction coupling in rabbit ventricular myocytes Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H596 - H604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wee, J. N. Peart, and J. P. Headrick P2 Purinoceptor-Mediated Cardioprotection in Ischemic-Reperfused Mouse Heart J. Pharmacol. Exp. Ther., December 1, 2007; 323(3): 861 - 867. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Dou, P. Arlock, and A. Arner Blebbistatin specifically inhibits actin-myosin interaction in mouse cardiac muscle Am J Physiol Cell Physiol, September 1, 2007; 293(3): C1148 - C1153. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Winter and K. A. Dora Spreading dilatation to luminal perfusion of ATP and UTP in rat isolated small mesenteric arteries J. Physiol., July 1, 2007; 582(1): 335 - 347. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Jalvy, M.-A. Renault, L. Lam Shang Leen, I. Belloc, A. Reynaud, A.-P. Gadeau, and C. Desgranges CREB Mediates UTP-Directed Arterial Smooth Muscle Cell Migration and Expression of the Chemotactic Protein Osteopontin via Its Interaction with Activator Protein-1 Sites Circ. Res., May 11, 2007; 100(9): 1292 - 1299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Burnstock Physiology and Pathophysiology of Purinergic Neurotransmission Physiol Rev, April 1, 2007; 87(2): 659 - 797. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||