| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Division of Infectious Diseases (J.-W.C., S.J.S., J.M.B.), Childrens Hospital of Philadelphia and Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia; Departments of Pediatrics (B.Z., K.J., H.S.B.) (Cardiology) and Cell and Developmental Biology (H.S.B.), Vanderbilt University Medical Center, Nashville, Tenn; Biomedical Imaging Core Laboratory (Q.-C.Y.), University of Pennsylvania School of Medicine, Philadelphia; and Center for Cardiovascular Development (M.D.S.), Baylor College of Medicine, Houston, Tex.
Correspondence to H. Scott Baldwin, B3307 Medical Center North, Vanderbilt University Medical Center, Nashville, TN 37232-2572. E-mail scott.baldwin{at}vanderbilt.edu
| Abstract |
|---|
|
|
|---|
-myosin heavy chain promoter), animals survived to adulthood and did not have evident cardiac abnormalities. These results indicate that during a specific temporal window, CAR expression on cardiomyocytes is essential for normal cardiac development. In addition, the results suggest that CAR-mediated intercellular contacts may regulate proliferation and differentiation of cardiomyocytes within the embryonic left ventricular wall.
Key Words: adhesion molecules cardiac development cardiomyopathy coxsackievirus receptor hyperplasia intercellular junctions mouse heart development
| Introduction |
|---|
|
|
|---|
CAR expression is highly regulated during development, with high levels in the embryonic brain and heart, and significantly reduced levels after birth,5,1114 and we suspected that CAR might function during embryonic development. To gain further insight into the biological function of CAR, we generated mice deficient in CAR expression. Both germline CAR-null animals and animals with early cardiomyocyte-specific CAR deletion developed hyperplasia of the left ventricular myocardium and died by embryonic day 12 (E12); however, CAR deletion later in embryonic life did not result in embryonic death. These results indicate that CAR is essential for early events in normal formation of the left ventricle and suggest that CAR-mediated signals may be important for the regulation of cardiomyocyte proliferation.
| Materials and Methods |
|---|
|
|
|---|
myosin heavy chain (MHC)Cre mice17 heterozygous for the CAR-null allele (CAR+/) or for the CARF allele (CAR+/F). In both mating strategies, heart-specific gene deletion is expected in 25% of progeny (MHC conditional mutants).
CAR RNA and Protein Detection
For detection of wild-type and exon 2deleted CAR transcripts, total RNA was isolated from E10.5 embryos, and cDNA synthesis was performed with random hexanucleotide primers. PCR was performed with primers flanking exon 2 (del5 [GCTCCCAGCCGAGATCGTTTA] and del3 [GGGCTTTCTTCACTTTGCACT]). Wild-type RNA was detected by amplification of a 428-bp fragment, and deletion of exon 2 resulted in a 261-bp fragment.
For immunoblot analysis, E10.5 embryos were lysed in ice-cold PBS containing protease inhibitors and 1% Triton X-100. Then 30 µg of total protein was subjected to electrophoresis, blotted to polyvinylidene fluoride membranes, and probed with affinity-purified rabbit anti-CAR antibody4 or with control polyclonal rabbit antiß-catenin antibody (Zymed) and horseradish peroxidaseconjugated anti-rabbit immunoglobulin secondary antibody (Santa Cruz Biotechnology).
Histology, Electron Microscopy, and Immunocytochemistry
Methods for histology and electron microscopy examination are described in the online supplement. For immunofluorescence analysis, embryos were embedded in Tissue-Tek OCT (Sakura), and frozen sections were stained with primary and secondary antibodies (details in online supplement). For analysis of cell proliferation, sections from 3 sets of CAR/ and CAR+/+ littermates were stained in parallel (3 to 4 sections per embryo), and images were captured using identical exposure conditions. Among cardiomyocytes identified by MF20 staining, 4',6-diamidino-2-phenylindolestained nuclei were counted, as were the numbers of cells expressing Ki67 antigen and cleaved caspase 3.
RNA In Situ Hybridization
Whole-mount in situ hybridization18 and hybridization to tissue sections19 were performed as described; hybridization probes are described in the online supplement. No hybridization was seen with sense control probes.
| Results |
|---|
|
|
|---|
|
CAR Expression Is Essential for Normal Embryonic Development
When the genotype of live-born animals was determined at 4 weeks of age (Figure 1C), only one of 139 pups examined was homozygous for the CAR-null allele, suggesting that CAR-null homozygotes died during embryonic life or shortly after birth; in contrast, CAR+/ and CAR+/+ littermates were present in the expected Mendelian proportions (2:1). To determine when death occurred, we examined embryos at E9.5 to E14.5. CAR-null homozygotes were present in the expected proportion at E9.5 and E10.5, and fetal heartbeat was detectable in almost all embryos. At E11.5, most CAR-null embryos were alive; in contrast, at E12.5 and beyond, all CAR/ animals were dead and undergoing resorption. These results indicate that CAR-null animals died between E11.5 and E12.5.
Cardiac Abnormalities in CAR-Null Embryos
In normal embryos at E9 to E10, CAR mRNA detected by in situ hybridization was expressed predominantly in the heart and central nervous system (Figure 2). Within the heart, CAR RNA was evident in the myocardium of the atria and ventricles, as well as in the sinus venosus and outflow tract; however, in whole-mount specimens, expression appeared most intense within the proximal portion of the looped heart tube, which gives rise to the future left ventricle.
|
Gross and microscopic examination of CAR-null embryos at E9.5 revealed no evident abnormalities (data not shown). However, at E10.5 (Figure 1D) and E11.5 (data not shown), CAR-null embryos could be identified by marked prominence of the left ventricular silhouette and engorgement of the cardinal veins, suggestive of severe cardiac dysfunction. No gross abnormality of cranial structures was observed, but development of E11 null embryos appeared to be globally delayed. On histological examination, the left ventricular wall was abnormally thickened, with partial obliteration of the ventricular lumen. In many embryos, there was moderate thickening of the atrial myocardium, but no definite abnormalities were seen in the endocardial cushions, the right ventricular wall, the right ventricular outflow tract, or in other derivatives of the secondary heart field.21 The yolk sac and yolk sac vessels appeared normal.
Ventricular Hyperplasia and Absence of Sinuatrial Valves in CAR-Null Embryos
Staining with antibody specific for muscle myosin (monoclonal antibody MF20) revealed that the thickened left ventricular wall was composed of cardiomyocytes (Figure 1E). Increased numbers of nuclei present within the ventricular wall suggested that the thickening resulted predominantly from increased cell numbers rather than from cellular hypertrophy. Consistent with this, the proliferation rate of left ventricular cardiomyocytes, as determined by the percentage of cells expressing a proliferation marker, Ki67 nuclear antigen, was twice that seen in the wild-type ventricle (CAR+/+ 42.3±6.2%; CAR/ 86.8±9.3%). In contrast, little or no increase in the percentage of Ki67-positive nuclei was seen in sections of the right ventricular wall (CAR+/+ 40.7±9.2%; CAR/ 46.9±7.5%), which did not show evidence of hyperplasia. There was no increased number of apoptotic cardiomyocytes, as determined by staining for cleaved caspase 3 (CAR+/+ 0.20±0.13%; CAR/ 0.19±0.05%). These results indicate that CAR deficiency results in regional overproliferation of cardiomyocytes and hyperplasia of the left ventricle. Although the hyperplastic myocardium was loosely organized and thus resembled trabecular tissue, persistent expression of N-myc, a marker of compact myocardium,22 as well as attenuated expression of the trabecular marker bone morphogenic protein 1023 and the atrial and trabecular marker atrial natriuretic factor (ANF24; Figure 3), indicated that the proliferating cardiomyocytes had failed to differentiate and form normal trabeculae. Expression patterns of Smpx-2 (Figure 3) and E-hand, D-hand, Neureglin, ErbB1, Tbx2, Tbx5, Tbx20, and Cited1 (data not shown), as determined by in situ hybridization, were all unremarkable in the CAR-null embryos.
|
An additional abnormality in CAR-null embryos was noted at the junction between the sinus venosus, the major route of blood return, and the atrium. In normal embryos, thin valvular structures restrict the backward flow of blood that would occur during atrial contraction. These sinuatrial valves, present in wild-type littermates, were not seen in CAR-null homozygotes (Figure 4).
|
Abnormal Cardiomyocyte Junctions in CAR-Null Embryos
In electron micrographs of CAR-null embryos, junctions between left ventricular cardiomyocytes appeared abnormal. Whereas wild-type cells had long stretches of membrane contact (Figure 5A and 5B), often with electron density at contact sites (Figure 5D), cardiomyocytes in CAR-null embryos had relatively scant, short contacts (Figure 5C) and little electron-dense material at more extensive contact sites (Figure 5E). In contrast, normal junctions were seen between epicardial cells and between endocardial cells (data not shown). Within the atrium and right ventricle, junctional abnormalities in the CAR-null animals were much less evident, although there appeared to be somewhat less electron dense material at sites of cellcell contact. These results indicate that CAR is important for the formation or maintenance of normal cardiomyocyte junctions, particularly within the left ventricle. In an effort to define the junctional abnormalities, we stained E10 heart sections with antibodies specific for N-cadherin (an adherens junction component) and desmoplakin (a component of desmosomes) as well with ZO-1, a component of both intercalated discs and epithelial tight junctions. Each of these proteins was evident at sites of cellcell contact in both CAR-null and wild-type embryos (data not shown).
|
Adherens junctions serve as anchor sites during the assembly of myofibrils, and many of the best-defined junctional structures seen in CAR knockout animals were at sites of myofibril insertion (Figure 5F and 5G). Consistent with a recent report by Doerner et al,25 myofilament bundles in CAR-null mice were thinner than those in wild-type embryos (very few >1 µm in width) and appeared less compact.
Cardiac Abnormalities in Embryos With Early Cardiomyocyte-Specific CAR Deletion
To abrogate CAR expression specifically in cardiomyocytes, we bred CAR-floxed homozygotes to mice expressing Cre under the control of cardiomyocyte-specific TNT and
-MHC promoters (and carrying either CARF or CAR alleles). TNT-Cre induces cardiac-specific gene deletion and reduction in target gene expression by E9.5,16 and MHC-Cre induces gene deletion before E11.5.17 As expected, when MHC-Cre and TNT-Cre mice were mated to ROSA26 indicator mice, Cre-dependent expression of the ß-galactosidase indicator gene was restricted to the myocardium (Figure 6A); TNT-Cre appeared to induce indicator gene expression at least a day earlier than did MHC-Cre.
|
In crosses between CAR-floxed and Cre mice, 25% of progeny (either Cre+CARF/ or Cre+CARF/F) were expected to undergo heart-specific CAR gene deletion; we refer to these as conditional mutants. When TNT-Cre CARF/+ mice were crossed to floxed homozygotes, no live TNT conditional mutants were identified among 58 animals genotyped 4 weeks after birth. At E10.5, the phenotype of TNT conditional mutant embryos was identical to that seen in CAR-null embryoshyperplasia of the proximal heart tube (Figure 6B), engorgement of cardinal veins, and absence of the sinuatrial valves (Figure 6D), with no abnormalities seen in the endocardial cushions, right ventricular wall, or outflow tract (data not shown). The cardiac phenotype seen in CAR-null animals thus resulted from deficient CAR expression within the heart itself.
In contrast, when CAR-floxed homozygotes were bred to MHC-Cre CAR+/ or MHC-Cre CARF/, MHC conditional mutant embryos showed only mild or no abnormal ventricular thickening (Figure 6B), with little or no increased percentage of Ki67-positive cells (CARF/F 39.9±4.1%; CARF/F-MHC-Cre 48.7±7.3%). The appearance of the sinuatrial valves was variable, with three of four MHC conditional mutant embryos examined showing mild abnormalities and only one showing absence or attenuation comparable to that seen in null mice (Figure 6D). A significant number of MHC conditional mutants were born alive (20 of the first 102 examined) and survived to adulthood. RT-PCR and immunoblot analysis confirmed that wild-type RNA and CAR protein were absent from the heart but not from the pancreas in surviving animals (Figure 6C). Evaluation of these surviving mice is ongoing, and we have not yet determined whether or not they have nonlethal functional or anatomic abnormalities. Nonetheless, the survival of MHC-Cre conditional mutants indicates that beyond a critical developmental window, cardiomyocyte-specific CAR expression is no longer essential for survival.
| Discussion |
|---|
|
|
|---|
The hyperplasia of the left ventricular wall and the increased numbers of proliferating cardiomyocytes we observed in CAR-deficient embryos suggest that CAR may regulate cardiomyocyte proliferation during embryonic life. Persistent expression of N-myc in hyperplastic myocardium and attenuated expression of the trabecular markers ANF and bone morphogenic protein 10 further suggest that CAR may be involved in regulating the transition that occurs as proliferating compact layer cardiomyocytes differentiate and form mature trabeculae, a process that begins between E10 and E11.26 N-myc is essential for normal myocardial development in the early embryo;22,27,28 in the developing lung, N-myc functions directly to regulate epithelial cell proliferation,29 and recent evidence implicates N-myc regulation in the regional control of cardiomyocyte proliferation.30 It is thus possible that persistent N-myc expression may be directly responsible for the ventricular hyperplasia we observed.
Although altered pressure loads might result in concentric thickening of the ventricle, CAR-deficient embryos showed no clear abnormalities of the endocardial cushions or outflow tract that might affect ventricular load. In addition, if ventricular hyperplasia were secondary to altered hemodynamics, one would expect to see hyperplasia of both left and right ventricles; at this stage of development, ventricular septation is not complete, and hemodynamic load is equally distributed between the primitive ventricles. We observed hyperplasia involving only the proximal heart tube (the primitive left ventricle) and no defects were seen in the primitive right ventricle or other structures derived from the secondary heart field. We are not aware of other genetic models in which embryonic myocardial hyperplasia is restricted to the left ventricular wall.
CAR is a junctional molecule known to mediate homotypic4 and heterotypic6 cell interactions; in polarized epithelial cells, CAR is a transmembrane component of the tight junction, and its cytoplasmic domain interacts with a complex of cytoplasmic scaffolding proteins.3 In CAR-null animals, junctions between cardiomyocytes were morphologically abnormal; however, the distribution of several junctional proteins, including ZO-1, connexin 43, desmoplakin, and N-cadherin, appeared normal. We suspect that CAR is required for recruitment of an undefined protein to junctions between developing cardiomyocytes. It is notable that whereas we observed that CAR deficiency was associated with cardiomyocyte hyperproliferation, targeted deletion of other cardiomyocyte junctional proteins, such as N-cadherin31 and plakoglobin,32 results in myocardial thinning and instability.
Several groups have reported that CAR inhibits the growth of transfected cells in culture and have related the inhibitory effect to the adhesive properties of CAR.9,10,33 In bladder carcinoma cells,8 CAR expression results in Rb hypophosphorylation and upregulation of the cyclin-dependent kinase inhibitor p21CIP; the inhibitory effect is proportional to the level of CAR expression, requires sequences within the CAR C terminus, and is blocked by a monoclonal antibody that prevents CAR-mediated cell adhesion. We believe that abnormal junctions between cardiomyocytes, which were noted primarily within the left ventricle, may contribute to the regional hyperproliferation observed in CAR-deficient animals; within the developing myocardium, homophilic CAR interactions may induce direct transmission of an intracellular inhibitory signal, or CAR-mediated adhesion may permit other inhibitory signaling molecules to engage. However, we cannot exclude the possibility that regional hyperproliferation involves the participation of another localized factor, and we have not confirmed that the hyperproliferation and the junctional abnormalities are directly linked.
In addition to defects in left ventricular development, we observed defects in the formation of the sinuatrial valves. Although these valves are not of functional importance in children or adults, valvar incompetence in the early embryo may permit backward blood flow during atrial contraction and thus contribute to the distention of the cardinal veins seen in CAR-deficient embryos. Absence of sinuatrial valves would exacerbate venous congestion resulting from the decreased ventricular compliance (diastolic dysfunction) associated with ventricular hyperplasia in the embryo.34 We do not yet know whether the ventricular hyperplasia and sinuatrial valve defects occur by related mechanisms. The valvular defects observed could be a primary effect of CAR deletion or a secondary effect resulting from altered hemodynamics. We are unaware of other genetic defects that specifically affect the sinuatrial valves. However, absence of these valves, associated with dilation of the cardinal veins, is seen in rat embryos deprived of retinoic acid.35 Because retinoic acid is an important stimulus for cardiomyocyte proliferation between E9.5 and E10.5,36 it will be interesting to determine whether CAR interacts with retinoic acid signals during early heart development.
While this manuscript was being prepared, two other groups of investigators described lethal cardiac abnormalities in CAR-null mice.25,37 Asher et al reported extensive apoptosis within the myocardium, resulting in myocardial rupture and intrathoracic hemorrhage.37 We did not observe these abnormalities in the CAR-null or cardiomyocyte-specific CAR mutants we examined. The differences between our observations and those of Asher et al may be related to differences in genetic background or differences in targeting strategy (TK replacement as opposed to Cre-mediated deletion of exon 2); another possibility is that those authors examined embryos when they were closer to death. Although Asher et al do not describe ventricular hyperplasia, their Figure 5C appears to show a significantly thickened left ventricular wall in an E11 embryo, consistent with our results.
Dorner et al25 observed dilation of the cardinal veins, as we did, and did not report apoptosis or hemorrhage; in addition, they observed myofibril disorganization and subtle abnormalities of the a-v canal and endocardial cushions. Although these authors emphasize different findings from ours, Figure 5C in their article shows evident thickening of the left ventricular wall, and we believe that their observations and ours may provide complementary views of the same phenotype. We looked specifically for sinuatrial valve defects to explain the striking engorgement of cardinal veins, and these abnormalities might easily be missed. Because the a-v canal and endocardial cushions undergo significant changes between E10 and E11, and because CAR-null embryos appear somewhat developmentally delayed, it is likely that slight differences in embryonic age could explain inconsistent observations related to persistence of the single a-v inlet and apparent thickening of the endocardial cushions. Adherens junctions serve as anchors for developing myofibrils,38 and the junctional abnormalities we observed may account for the disorganization of myofibers reported by Dorner25 and seen by us as well. Although the phenotype of CAR-deficient animals appears to be complex, it is clear that CAR expression is essential for early cardiac development; our results demonstrate that cardiomyocyte-specific CAR expression is required for normal development and point out a likely role for CAR in the control of cardiomyocyte proliferation. The different results we obtained with MHC-Cre and TNT-Cre conditional mutants suggest that CAR is essential during a specific developmental window and may be dispensable after day 11 when trabeculation is well under way; this could not be discerned in either of the studies using null mice.
Coxsackieviruses and adenoviruses are the pathogens most commonly associated with inflammatory heart disease; it is striking that these two viruses have evolved independently to interact with a receptor that is itself important for normal heart development. CAR expression within the myocardium is highest during embryonic life and appears to be downregulated after birth. However, expression within the heart is increased in disease states, including certain forms of cardiomyopathy,7,39 and after myocardial infarction.40 It is possible that the function of CAR during myocardial development is recapitulated in cardiac diseases and that CAR may act to inhibit cardiomyocyte proliferation after myocardial injury.
| Acknowledgments |
|---|
| Footnotes |
|---|
Original received September 13, 2005; revision received January 24, 2006; accepted March 7, 2006.
| References |
|---|
|
|
|---|
vß3 and
vß5 on the cardiomyocyte sarcolemma and upregulated in dilated cardiomyopathy. Circulation. 2001; 104: 275280.This article has been cited by other articles:
![]() |
M. Mirza, C. Petersen, K. Nordqvist, and K. Sollerbrant Coxsackievirus and Adenovirus Receptor Is Up-Regulated in Migratory Germ Cells during Passage of the Blood-Testis Barrier Endocrinology, November 1, 2007; 148(11): 5459 - 5469. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shono, H. Tsukaguchi, E. Yaoita, M. Nameta, H. Kurihara, X.-S. Qin, T. Yamamoto, and T. Doi Podocin Participates in the Assembly of Tight Junctions between Foot Processes in Nephrotic Podocytes J. Am. Soc. Nephrol., September 1, 2007; 18(9): 2525 - 2533. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Song, W. Yan, X. Chen, C.-x. Deng, Q. Wang, and K. Jiao Myocardial Smad4 Is Essential for Cardiogenesis in Mouse Embryos Circ. Res., August 3, 2007; 101(3): 277 - 285. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |