Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2006;98:923-930
Published online before print March 16, 2006, doi: 10.1161/01.RES.0000218041.41932.e3
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
98/7/923    most recent
01.RES.0000218041.41932.e3v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.-W.
Right arrow Articles by Bergelson, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.-W.
Right arrow Articles by Bergelson, J. M.
Related Collections
Right arrow Animal models of human disease
Right arrow Developmental biology
Right arrow Myocardial cardiomyopathy disease
(Circulation Research. 2006;98:923.)
© 2006 American Heart Association, Inc.


Molecular Medicine

Cardiomyocyte-Specific Deletion of the Coxsackievirus and Adenovirus Receptor Results in Hyperplasia of the Embryonic Left Ventricle and Abnormalities of Sinuatrial Valves

Jin-Wen Chen*, Bin Zhou*, Qian-Chun Yu, Sangyoon J. Shin, Kai Jiao, Michael D. Schneider, H. Scott Baldwin, Jeffrey M. Bergelson

From the Division of Infectious Diseases (J.-W.C., S.J.S., J.M.B.), Children’s Hospital of Philadelphia and Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia; Departments of Pediatrics (B.Z., K.J., H.S.B.) (Cardiology) and Cell and Developmental Biology (H.S.B.), Vanderbilt University Medical Center, Nashville, Tenn; Biomedical Imaging Core Laboratory (Q.-C.Y.), University of Pennsylvania School of Medicine, Philadelphia; and Center for Cardiovascular Development (M.D.S.), Baylor College of Medicine, Houston, Tex.

Correspondence to H. Scott Baldwin, B3307 Medical Center North, Vanderbilt University Medical Center, Nashville, TN 37232-2572. E-mail scott.baldwin{at}vanderbilt.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The coxsackievirus and adenovirus receptor (CAR), which mediates infection by the viruses most commonly associated with myocarditis, is a transmembrane component of specialized intercellular junctions, including the myocardial intercalated disc; it is known to mediate cell–cell recognition, but its natural function is poorly understood. We used conditional gene targeting to investigate the possible functions of CAR during embryonic development, generating mice with both germline and tissue-specific defects in CAR expression. Homozygous germline deletion of CAR exon 2 or cardiomyocyte-specific gene deletion at embryonic day 10 (E10) mediated by Cre recombinase expressed under the control of the cardiac troponin T promoter resulted in death by E12.5; embryos showed marked cardiac abnormalities by E10.5, with hyperplasia of the left ventricular myocardium, distention of the cardinal veins, and abnormalities of sinuatrial valves. Within the hyperplastic left ventricle, increased numbers of proliferating cells were evident; persistent expression of N-myc in the hyperplastic myocardium and attenuated expression of the trabecular markers atrial natriuretic factor and bone morphogenic protein 10 indicated that proliferating cardiomyocytes had failed to differentiate and form normal trabeculae. In electron micrographs, individual CAR-deficient cardiomyocytes within the left ventricle appeared normal, but intercellular junctions were ill-formed or absent, consistent with the known function of CAR as a junctional molecule; myofibrils were also poorly organized. When cardiomyocyte-specific deletion occurred somewhat later (by E11, mediated by Cre under control of the {alpha}-myosin heavy chain promoter), animals survived to adulthood and did not have evident cardiac abnormalities. These results indicate that during a specific temporal window, CAR expression on cardiomyocytes is essential for normal cardiac development. In addition, the results suggest that CAR-mediated intercellular contacts may regulate proliferation and differentiation of cardiomyocytes within the embryonic left ventricular wall.


Key Words: adhesion molecules • cardiac development • cardiomyopathy • coxsackievirus receptor • hyperplasia • intercellular junctions • mouse heart development


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The coxsackievirus and adenovirus receptor (CAR) is a 46-kDa cell surface protein that mediates attachment and infection by group B coxsackieviruses and many adenoviruses.1,2 CAR has been conserved during vertebrate evolution, with homologs identified in mammals, birds, frogs, and fish,3 but its natural functions are not well understood. Recent work demonstrates that CAR mediates homotypic4,5 and heterotypic6 intercellular interactions and that it is a component of specialized intercellular junctions, including the epithelial tight junction4 and the cardiac intercalated disc.7 Although distinct CAR-mediated signals have not been defined, CAR expression in tumor cell lines leads to changes in the activity of cell cycle regulators that are associated with slower growth and reduced tumorigenicity in animals.8–10

CAR expression is highly regulated during development, with high levels in the embryonic brain and heart, and significantly reduced levels after birth,5,11–14 and we suspected that CAR might function during embryonic development. To gain further insight into the biological function of CAR, we generated mice deficient in CAR expression. Both germline CAR-null animals and animals with early cardiomyocyte-specific CAR deletion developed hyperplasia of the left ventricular myocardium and died by embryonic day 12 (E12); however, CAR deletion later in embryonic life did not result in embryonic death. These results indicate that CAR is essential for early events in normal formation of the left ventricle and suggest that CAR-mediated signals may be important for the regulation of cardiomyocyte proliferation.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Generation of CAR-Deficient Animals
Generation of animals in which CAR exon 2 was flanked by loxP sites ("CAR-floxed") is described in the online supplement, available at http://circres.ahajournals.org. Floxed mice were bred to protamine-Cre deleter mice,15 and male progeny carrying the CAR-null allele were bred to female C57BL/6J mice to obtain progeny with a germline CAR-null allele. Polymerase chain reaction (PCR) amplification of a 360-bp DNA fragment with primers f1 (AATGGTGCCCAGGGAACGAAC) and r1 (GCTTGTTGTTTGGTTGGGTTT) was used to identify the wild-type allele; the null allele was identified by amplification of an 833-bp fragment with primers f1 and r2 (TTGTGCTGTTGCTGCTGTTGT); the floxed allele was identified by a 655-bp fragment generated with primers f2 (TGACAGTCTGGGTGTGCATGT) and r2. For tissue-specific gene deletion, homozygous floxed mice were bred to cardiac troponin T (TNT)–Cre mice16 heterozygous for the CAR-floxed allele; in these crosses, myocardial cells in 25% of progeny would be expected to undergo deletion of CAR exon 2. Homozygous CAR-floxed mice were also bred both to cardiac {alpha}–myosin heavy chain (MHC)–Cre mice17 heterozygous for the CAR-null allele (CAR+/–) or for the CARF allele (CAR+/F). In both mating strategies, heart-specific gene deletion is expected in 25% of progeny (MHC conditional mutants).

CAR RNA and Protein Detection
For detection of wild-type and exon 2–deleted CAR transcripts, total RNA was isolated from E10.5 embryos, and cDNA synthesis was performed with random hexanucleotide primers. PCR was performed with primers flanking exon 2 (del5 [GCTCCCAGCCGAGATCGTTTA] and del3 [GGGCTTTCTTCACTTTGCACT]). Wild-type RNA was detected by amplification of a 428-bp fragment, and deletion of exon 2 resulted in a 261-bp fragment.

For immunoblot analysis, E10.5 embryos were lysed in ice-cold PBS containing protease inhibitors and 1% Triton X-100. Then 30 µg of total protein was subjected to electrophoresis, blotted to polyvinylidene fluoride membranes, and probed with affinity-purified rabbit anti-CAR antibody4 or with control polyclonal rabbit anti–ß-catenin antibody (Zymed) and horseradish peroxidase–conjugated anti-rabbit immunoglobulin secondary antibody (Santa Cruz Biotechnology).

Histology, Electron Microscopy, and Immunocytochemistry
Methods for histology and electron microscopy examination are described in the online supplement. For immunofluorescence analysis, embryos were embedded in Tissue-Tek OCT (Sakura), and frozen sections were stained with primary and secondary antibodies (details in online supplement). For analysis of cell proliferation, sections from 3 sets of CAR–/– and CAR+/+ littermates were stained in parallel (3 to 4 sections per embryo), and images were captured using identical exposure conditions. Among cardiomyocytes identified by MF20 staining, 4',6-diamidino-2-phenylindole–stained nuclei were counted, as were the numbers of cells expressing Ki67 antigen and cleaved caspase 3.

RNA In Situ Hybridization
Whole-mount in situ hybridization18 and hybridization to tissue sections19 were performed as described; hybridization probes are described in the online supplement. No hybridization was seen with sense control probes.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Generation of Germline CAR-Null Animals
We used Cre-mediated recombination to generate CAR-deficient mice (Figure 1). Mice were produced in which CAR exon 2 was flanked by loxP sites recognized by Cre recombinase ("floxed"). Exon 2 encodes part of the CAR secretion signal sequence (residues 15 to 19), as well as much of the extracellular immunoglobulin-like domain 1 (residues 20 to 70);20 its deletion, which results in a frame shift and premature termination within the leader sequence, creates a null allele. To induce germline deletion of CAR exon 2 (CAR-null allele), floxed animals were bred to transgenic mice expressing Cre under the control of the protamine promoter. CAR-null heterozygotes (CAR+/–) appeared normal and were intercrossed to obtain mice homozygous for the germline CAR-null allele (CAR–/–). CAR expression was evaluated in embryos at 10.5 days postcoitus (E10.5): in CAR-null homozygotes, no wild-type CAR RNA was detected by RT-PCR using primers that distinguished wild-type RNA from RNA with exon 2 deletion; no CAR protein was detected by immunoblot (Figure 1B).


Figure 1
View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Ventricular abnormality in CAR-null embryos. A, Targeting strategy. Exon 2 (red) and flanking genomic DNA sequences (black) were inserted in a targeting vector (green) downstream of neomycin and thymidine kinase cassettes. LoxP sites (green arrowheads) flank exon 2; FRT sites recognized by Flp recombinance (green ovals) flank the neomycin gene. After homologous recombination in embryonic stem (ES) cells, Southern blot hybridization with probe E resulted in a 7.6-kb EcoRI fragment (10 kb in wild-type); hybridization with probe P resulted in a 3.4-kb PstI fragment (9 kb in wild-type). The structures of the floxed (CARF) and null (CAR) alleles are shown. Primers used for PCR genotyping are described in the Methods. B, CAR gene deletion and ablated CAR expression at E10.5. Left panel, DNA PCR to detect germline deletion of exon 2; wild-type allele was detected with primers f1 and r1, and deleted CAR allele was detected with f1 and r2. Center panel, RT-PCR to detect deletion of exon 2 in CAR mRNA; primers flanking the deleted exon were used to amplify a 428-bp fragment from wild-type and a 261-bp fragment from deleted RNA. Right panel, Immunoblot detection of CAR protein; 30 µg of protein was blotted and probed with affinity-purified anti-CAR antibody; CAR typically appears as a doublet at 42/46 kDa. Blots were reprobed with ß-catenin (cat) antibody to confirm equal loading. WT indicates wild-type; {Delta}, deleted; C, GAPDH control. C, CAR-null embryos die in utero. CAR+/– heterozygotes were crossed, and genotypes of live progeny were determined at E9 to E14 and 4 weeks after birth. No live CAR–/– progeny were detected after E11.5. D, Cardiac abnormality in E10.5 CAR-deficient embryos. Left panels, Wild-type (+/+); right panels, CAR-null (–/–). Top panels, gross morphology: CAR-null embryo with accentuated left ventricular contour, and engorgement of cardinal veins. Lower panels, hematoxylin/eosin-stained sagittal sections: yellow arrow marks thickened left ventricular wall in CAR-null embryo. V indicates ventricle; A, atrium. E, Myocardial hyperplasia and cardiomyocyte proliferation in E10.5 CAR-deficient embryos. Sections through the left ventricle of wild-type (+/+) and CAR-null (–/–) embryos stained with 4',6-diamidino-2-phenylindole (DAPI) to visualize cell nuclei, with antimyosin monoclonal antibody MF20 to identify cardiomyocytes, and with antibody to nuclear antigen Ki67 to detect proliferating cells. V indicates ventricle; A, atrium; OFT, outflow tract.

CAR Expression Is Essential for Normal Embryonic Development
When the genotype of live-born animals was determined at 4 weeks of age (Figure 1C), only one of 139 pups examined was homozygous for the CAR-null allele, suggesting that CAR-null homozygotes died during embryonic life or shortly after birth; in contrast, CAR+/– and CAR+/+ littermates were present in the expected Mendelian proportions (2:1). To determine when death occurred, we examined embryos at E9.5 to E14.5. CAR-null homozygotes were present in the expected proportion at E9.5 and E10.5, and fetal heartbeat was detectable in almost all embryos. At E11.5, most CAR-null embryos were alive; in contrast, at E12.5 and beyond, all CAR–/– animals were dead and undergoing resorption. These results indicate that CAR-null animals died between E11.5 and E12.5.

Cardiac Abnormalities in CAR-Null Embryos
In normal embryos at E9 to E10, CAR mRNA detected by in situ hybridization was expressed predominantly in the heart and central nervous system (Figure 2). Within the heart, CAR RNA was evident in the myocardium of the atria and ventricles, as well as in the sinus venosus and outflow tract; however, in whole-mount specimens, expression appeared most intense within the proximal portion of the looped heart tube, which gives rise to the future left ventricle.


Figure 2
View larger version (82K):
[in this window]
[in a new window]
 
Figure 2. CAR RNA expression in wild-type embryos. A through C, Whole-mount in situ hybridization at E9.0. Right-side (A), frontal (B), and left-side (C) views. CAR expression, prominent in the central nervous system and heart, is less intense within the right-sided cardiac structures derived from the secondary heart field heart (marked by broken yellow lines) than within the primitive left ventricle. D and E, E9.5, section through left (D) and right (E) heart. F and G, E10.5, section through left (F) and right (G) sides of embryonic heart. Sv indicates sinus venosus; ne, neural epithelium; fb, forebrain; a, atrium; v, ventricle; oft, outflow tract; lv, liver.

Gross and microscopic examination of CAR-null embryos at E9.5 revealed no evident abnormalities (data not shown). However, at E10.5 (Figure 1D) and E11.5 (data not shown), CAR-null embryos could be identified by marked prominence of the left ventricular silhouette and engorgement of the cardinal veins, suggestive of severe cardiac dysfunction. No gross abnormality of cranial structures was observed, but development of E11 null embryos appeared to be globally delayed. On histological examination, the left ventricular wall was abnormally thickened, with partial obliteration of the ventricular lumen. In many embryos, there was moderate thickening of the atrial myocardium, but no definite abnormalities were seen in the endocardial cushions, the right ventricular wall, the right ventricular outflow tract, or in other derivatives of the secondary heart field.21 The yolk sac and yolk sac vessels appeared normal.

Ventricular Hyperplasia and Absence of Sinuatrial Valves in CAR-Null Embryos
Staining with antibody specific for muscle myosin (monoclonal antibody MF20) revealed that the thickened left ventricular wall was composed of cardiomyocytes (Figure 1E). Increased numbers of nuclei present within the ventricular wall suggested that the thickening resulted predominantly from increased cell numbers rather than from cellular hypertrophy. Consistent with this, the proliferation rate of left ventricular cardiomyocytes, as determined by the percentage of cells expressing a proliferation marker, Ki67 nuclear antigen, was twice that seen in the wild-type ventricle (CAR+/+ 42.3±6.2%; CAR–/– 86.8±9.3%). In contrast, little or no increase in the percentage of Ki67-positive nuclei was seen in sections of the right ventricular wall (CAR+/+ 40.7±9.2%; CAR–/– 46.9±7.5%), which did not show evidence of hyperplasia. There was no increased number of apoptotic cardiomyocytes, as determined by staining for cleaved caspase 3 (CAR+/+ 0.20±0.13%; CAR–/– 0.19±0.05%). These results indicate that CAR deficiency results in regional overproliferation of cardiomyocytes and hyperplasia of the left ventricle. Although the hyperplastic myocardium was loosely organized and thus resembled trabecular tissue, persistent expression of N-myc, a marker of compact myocardium,22 as well as attenuated expression of the trabecular marker bone morphogenic protein 1023 and the atrial and trabecular marker atrial natriuretic factor (ANF24; Figure 3), indicated that the proliferating cardiomyocytes had failed to differentiate and form normal trabeculae. Expression patterns of Smpx-2 (Figure 3) and E-hand, D-hand, Neureglin, ErbB1, Tbx2, Tbx5, Tbx20, and Cited1 (data not shown), as determined by in situ hybridization, were all unremarkable in the CAR-null embryos.


Figure 3
View larger version (56K):
[in this window]
[in a new window]
 
Figure 3. Expression of compact layer markers in CAR-deficient ventricle. In situ hybridization for N-myc, ANF, bone morphogenic protein 10, and Smpx-2 in wild-type (WT) and CAR-null (ko) embryos at E11.5. Magnified E10 images show decreased hybridization intensity associated with trabeculae (arrows). V indicates ventricle; a, atrium. Yellow arrows show N-myc and Smpx-2 expression throughout the thickened left ventricle.

An additional abnormality in CAR-null embryos was noted at the junction between the sinus venosus, the major route of blood return, and the atrium. In normal embryos, thin valvular structures restrict the backward flow of blood that would occur during atrial contraction. These sinuatrial valves, present in wild-type littermates, were not seen in CAR-null homozygotes (Figure 4).


Figure 4
View larger version (113K):
[in this window]
[in a new window]
 
Figure 4. Sinuatrial valve abnormality in CAR-deficient embryos. Sections through the sinus venosus (sv) and common atrium (ca) reveal presence of sinuatrial valves (arrows) in E10.5 wild-type embryos (wt); valves were not seen in CAR-null littermates (ko) despite careful evaluation of serial sections.

Abnormal Cardiomyocyte Junctions in CAR-Null Embryos
In electron micrographs of CAR-null embryos, junctions between left ventricular cardiomyocytes appeared abnormal. Whereas wild-type cells had long stretches of membrane contact (Figure 5A and 5B), often with electron density at contact sites (Figure 5D), cardiomyocytes in CAR-null embryos had relatively scant, short contacts (Figure 5C) and little electron-dense material at more extensive contact sites (Figure 5E). In contrast, normal junctions were seen between epicardial cells and between endocardial cells (data not shown). Within the atrium and right ventricle, junctional abnormalities in the CAR-null animals were much less evident, although there appeared to be somewhat less electron dense material at sites of cell–cell contact. These results indicate that CAR is important for the formation or maintenance of normal cardiomyocyte junctions, particularly within the left ventricle. In an effort to define the junctional abnormalities, we stained E10 heart sections with antibodies specific for N-cadherin (an adherens junction component) and desmoplakin (a component of desmosomes) as well with ZO-1, a component of both intercalated discs and epithelial tight junctions. Each of these proteins was evident at sites of cell–cell contact in both CAR-null and wild-type embryos (data not shown).


Figure 5
View larger version (153K):
[in this window]
[in a new window]
 
Figure 5. Abnormal intercellular junctions in CAR-deficient left ventricular myocardium. Electron microscopic images of E10.5 myocardial cells in wild-type embryo (A, B, D, and F) and CAR-null littermates (C, E, and G). A and B, Extensive membrane contacts (black arrows) between cardiomyocytes in wild-type embryo. C, Sparse contacts with large intercellular spaces in CAR-null. D, Electron-dense structures at contacts in wild-type. E, Less dense contacts in CAR-null. F and G, Myofibers (asterisks) often inserted into electron-dense cell contacts in both wild-type (F) and CAR-null (G) embryos but were thinner in CAR-null. Nuc indicates nucleus. Scale bar in F=1 micron, all others=2 microns.

Adherens junctions serve as anchor sites during the assembly of myofibrils, and many of the best-defined junctional structures seen in CAR knockout animals were at sites of myofibril insertion (Figure 5F and 5G). Consistent with a recent report by Doerner et al,25 myofilament bundles in CAR-null mice were thinner than those in wild-type embryos (very few >1 µm in width) and appeared less compact.

Cardiac Abnormalities in Embryos With Early Cardiomyocyte-Specific CAR Deletion
To abrogate CAR expression specifically in cardiomyocytes, we bred CAR-floxed homozygotes to mice expressing Cre under the control of cardiomyocyte-specific TNT and {alpha}-MHC promoters (and carrying either CARF or CAR alleles). TNT-Cre induces cardiac-specific gene deletion and reduction in target gene expression by E9.5,16 and MHC-Cre induces gene deletion before E11.5.17 As expected, when MHC-Cre and TNT-Cre mice were mated to ROSA26 indicator mice, Cre-dependent expression of the ß-galactosidase indicator gene was restricted to the myocardium (Figure 6A); TNT-Cre appeared to induce indicator gene expression at least a day earlier than did MHC-Cre.


Figure 6
View larger version (65K):
[in this window]
[in a new window]
 
Figure 6. Ventricular abnormalities after myocardial CAR deletion. A, TNT-Cre–mediated recombination precedes recombination mediated by {alpha}MHC-Cre. Rosa 26 indicator mice were bred to TNT-Cre or {alpha}MHC-Cre mice, and embryos were stained to detect ß-galactosidase produced after Cre-mediated activation of a disrupted lacZ indicator gene. B, Ablation of CAR expression in hearts of adult MHC-Cre conditional mutants. Heart and pancreas were subjected to immunoblotting for CAR protein and RT-PCR for detection of CAR RNA as described in Figure 1. C, Left ventricular thickening in TNT-Cre conditional mutant embryos. D, Sinuatrial valve abnormalities in conditional mutant embryos. Valves (arrows) are marked in conditional mutants and CARF/F littermate controls. Three of four MHC-Cre conditional mutants had mild abnormalities (1), and one embryo showed underdeveloped valves (2).

In crosses between CAR-floxed and Cre mice, 25% of progeny (either Cre+CARF/– or Cre+CARF/F) were expected to undergo heart-specific CAR gene deletion; we refer to these as conditional mutants. When TNT-Cre CARF/+ mice were crossed to floxed homozygotes, no live TNT conditional mutants were identified among 58 animals genotyped 4 weeks after birth. At E10.5, the phenotype of TNT conditional mutant embryos was identical to that seen in CAR-null embryos—hyperplasia of the proximal heart tube (Figure 6B), engorgement of cardinal veins, and absence of the sinuatrial valves (Figure 6D), with no abnormalities seen in the endocardial cushions, right ventricular wall, or outflow tract (data not shown). The cardiac phenotype seen in CAR-null animals thus resulted from deficient CAR expression within the heart itself.

In contrast, when CAR-floxed homozygotes were bred to MHC-Cre CAR+/– or MHC-Cre CARF/–, MHC conditional mutant embryos showed only mild or no abnormal ventricular thickening (Figure 6B), with little or no increased percentage of Ki67-positive cells (CARF/F 39.9±4.1%; CARF/F-MHC-Cre 48.7±7.3%). The appearance of the sinuatrial valves was variable, with three of four MHC conditional mutant embryos examined showing mild abnormalities and only one showing absence or attenuation comparable to that seen in null mice (Figure 6D). A significant number of MHC conditional mutants were born alive (20 of the first 102 examined) and survived to adulthood. RT-PCR and immunoblot analysis confirmed that wild-type RNA and CAR protein were absent from the heart but not from the pancreas in surviving animals (Figure 6C). Evaluation of these surviving mice is ongoing, and we have not yet determined whether or not they have nonlethal functional or anatomic abnormalities. Nonetheless, the survival of MHC-Cre conditional mutants indicates that beyond a critical developmental window, cardiomyocyte-specific CAR expression is no longer essential for survival.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
CAR was originally identified as a virus receptor, and despite extensive interest in its role as a determinant of virus tropism, its natural functions are not well understood. The experiments reported here indicate that CAR serves an essential function during development of the mammalian heart. CAR-null mice and mice with heart-specific CAR deletion before E10 (mediated by TNT-Cre) died in utero with cardiac defects including regional hyperplasia of the left ventricular wall and absence of the sinuatrial valves. In contrast, CAR deletion later in embryonic life (E11, mediated by MHC-Cre) permitted many embryos to survive to adulthood.

The hyperplasia of the left ventricular wall and the increased numbers of proliferating cardiomyocytes we observed in CAR-deficient embryos suggest that CAR may regulate cardiomyocyte proliferation during embryonic life. Persistent expression of N-myc in hyperplastic myocardium and attenuated expression of the trabecular markers ANF and bone morphogenic protein 10 further suggest that CAR may be involved in regulating the transition that occurs as proliferating compact layer cardiomyocytes differentiate and form mature trabeculae, a process that begins between E10 and E11.26 N-myc is essential for normal myocardial development in the early embryo;22,27,28 in the developing lung, N-myc functions directly to regulate epithelial cell proliferation,29 and recent evidence implicates N-myc regulation in the regional control of cardiomyocyte proliferation.30 It is thus possible that persistent N-myc expression may be directly responsible for the ventricular hyperplasia we observed.

Although altered pressure loads might result in concentric thickening of the ventricle, CAR-deficient embryos showed no clear abnormalities of the endocardial cushions or outflow tract that might affect ventricular load. In addition, if ventricular hyperplasia were secondary to altered hemodynamics, one would expect to see hyperplasia of both left and right ventricles; at this stage of development, ventricular septation is not complete, and hemodynamic load is equally distributed between the primitive ventricles. We observed hyperplasia involving only the proximal heart tube (the primitive left ventricle) and no defects were seen in the primitive right ventricle or other structures derived from the secondary heart field. We are not aware of other genetic models in which embryonic myocardial hyperplasia is restricted to the left ventricular wall.

CAR is a junctional molecule known to mediate homotypic4 and heterotypic6 cell interactions; in polarized epithelial cells, CAR is a transmembrane component of the tight junction, and its cytoplasmic domain interacts with a complex of cytoplasmic scaffolding proteins.3 In CAR-null animals, junctions between cardiomyocytes were morphologically abnormal; however, the distribution of several junctional proteins, including ZO-1, connexin 43, desmoplakin, and N-cadherin, appeared normal. We suspect that CAR is required for recruitment of an undefined protein to junctions between developing cardiomyocytes. It is notable that whereas we observed that CAR deficiency was associated with cardiomyocyte hyperproliferation, targeted deletion of other cardiomyocyte junctional proteins, such as N-cadherin31 and plakoglobin,32 results in myocardial thinning and instability.

Several groups have reported that CAR inhibits the growth of transfected cells in culture and have related the inhibitory effect to the adhesive properties of CAR.9,10,33 In bladder carcinoma cells,8 CAR expression results in Rb hypophosphorylation and upregulation of the cyclin-dependent kinase inhibitor p21CIP; the inhibitory effect is proportional to the level of CAR expression, requires sequences within the CAR C terminus, and is blocked by a monoclonal antibody that prevents CAR-mediated cell adhesion. We believe that abnormal junctions between cardiomyocytes, which were noted primarily within the left ventricle, may contribute to the regional hyperproliferation observed in CAR-deficient animals; within the developing myocardium, homophilic CAR interactions may induce direct transmission of an intracellular inhibitory signal, or CAR-mediated adhesion may permit other inhibitory signaling molecules to engage. However, we cannot exclude the possibility that regional hyperproliferation involves the participation of another localized factor, and we have not confirmed that the hyperproliferation and the junctional abnormalities are directly linked.

In addition to defects in left ventricular development, we observed defects in the formation of the sinuatrial valves. Although these valves are not of functional importance in children or adults, valvar incompetence in the early embryo may permit backward blood flow during atrial contraction and thus contribute to the distention of the cardinal veins seen in CAR-deficient embryos. Absence of sinuatrial valves would exacerbate venous congestion resulting from the decreased ventricular compliance (diastolic dysfunction) associated with ventricular hyperplasia in the embryo.34 We do not yet know whether the ventricular hyperplasia and sinuatrial valve defects occur by related mechanisms. The valvular defects observed could be a primary effect of CAR deletion or a secondary effect resulting from altered hemodynamics. We are unaware of other genetic defects that specifically affect the sinuatrial valves. However, absence of these valves, associated with dilation of the cardinal veins, is seen in rat embryos deprived of retinoic acid.35 Because retinoic acid is an important stimulus for cardiomyocyte proliferation between E9.5 and E10.5,36 it will be interesting to determine whether CAR interacts with retinoic acid signals during early heart development.

While this manuscript was being prepared, two other groups of investigators described lethal cardiac abnormalities in CAR-null mice.25,37 Asher et al reported extensive apoptosis within the myocardium, resulting in myocardial rupture and intrathoracic hemorrhage.37 We did not observe these abnormalities in the CAR-null or cardiomyocyte-specific CAR mutants we examined. The differences between our observations and those of Asher et al may be related to differences in genetic background or differences in targeting strategy (TK replacement as opposed to Cre-mediated deletion of exon 2); another possibility is that those authors examined embryos when they were closer to death. Although Asher et al do not describe ventricular hyperplasia, their Figure 5C appears to show a significantly thickened left ventricular wall in an E11 embryo, consistent with our results.

Dorner et al25 observed dilation of the cardinal veins, as we did, and did not report apoptosis or hemorrhage; in addition, they observed myofibril disorganization and subtle abnormalities of the a-v canal and endocardial cushions. Although these authors emphasize different findings from ours, Figure 5C in their article shows evident thickening of the left ventricular wall, and we believe that their observations and ours may provide complementary views of the same phenotype. We looked specifically for sinuatrial valve defects to explain the striking engorgement of cardinal veins, and these abnormalities might easily be missed. Because the a-v canal and endocardial cushions undergo significant changes between E10 and E11, and because CAR-null embryos appear somewhat developmentally delayed, it is likely that slight differences in embryonic age could explain inconsistent observations related to persistence of the single a-v inlet and apparent thickening of the endocardial cushions. Adherens junctions serve as anchors for developing myofibrils,38 and the junctional abnormalities we observed may account for the disorganization of myofibers reported by Dorner25 and seen by us as well. Although the phenotype of CAR-deficient animals appears to be complex, it is clear that CAR expression is essential for early cardiac development; our results demonstrate that cardiomyocyte-specific CAR expression is required for normal development and point out a likely role for CAR in the control of cardiomyocyte proliferation. The different results we obtained with MHC-Cre and TNT-Cre conditional mutants suggest that CAR is essential during a specific developmental window and may be dispensable after day 11 when trabeculation is well under way; this could not be discerned in either of the studies using null mice.

Coxsackieviruses and adenoviruses are the pathogens most commonly associated with inflammatory heart disease; it is striking that these two viruses have evolved independently to interact with a receptor that is itself important for normal heart development. CAR expression within the myocardium is highest during embryonic life and appears to be downregulated after birth. However, expression within the heart is increased in disease states, including certain forms of cardiomyopathy,7,39 and after myocardial infarction.40 It is possible that the function of CAR during myocardial development is recapitulated in cardiac diseases and that CAR may act to inhibit cardiomyocyte proliferation after myocardial injury.


*    Acknowledgments
 
This work was supported by grants from the National Institutes of Health (AI052281and HL54734) and by grants-in-aid and a scientist development grant from the American Heart Association (National Center and Pennsylvania-Delaware Chapter). We thank the many investigators who provided us with reagents, advice, and assistance.


*    Footnotes
 
*Both authors contributed equally to this study. Back

Original received September 13, 2005; revision received January 24, 2006; accepted March 7, 2006.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Bergelson JM, Cunningham JA, Droguett G, Kurt-Jones EA, Krithivas A, Hong JS, Horwitz MS, Crowell RL, Finberg RW. Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science. 1997; 275: 1320–1323.[Abstract/Free Full Text]

2. Tomko RP, Xu R, Philipson L. HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc Natl Acad Sci U S A. 1997; 94: 3352–3356.[Abstract/Free Full Text]

3. Coyne CB, Bergelson JM. CAR: a virus receptor within the tight junction. Adv Drug Deliv Rev. 2005; 57: 869–882.[CrossRef][Medline] [Order article via Infotrieve]

4. Cohen CJ, Shieh JT-C, Pickles RJ, Okegawa T, Hsieh J-T, Bergelson JM. The coxsackievirus and adenovirus receptor is a transmembrane component of the tight junction. Proc Natl Acad Sci U S A. 2001; 98: 15191–15196.[Abstract/Free Full Text]

5. Honda T, Saitoh H, Masuko M, Katagiri-Abe T, Tominaga K, Kozakai I, Kobayashi K, Kuminishi T, Watanabe YG, Odani S, Kuwano R. The coxsackievirus adenovirus receptor as a cell adhesion molecule in the developing mouse brain. Brain Res Mol Brain Res. 2000; 77: 19–28.[Medline] [Order article via Infotrieve]

6. Zen K, Liu Y, McCall IC, Wu T, Lee W, Babbin BA, Nusrat A, Parkos CA. Neutrophil migration across tight junctions is mediated by adhesive interactions between epithelial coxsackie and adenovirus receptor and a junctional adhesion molecule-like protein on neutrophils. Mol Biol Cell. 2005; 16: 2694–2703.[Abstract/Free Full Text]

7. Noutsias M, Fechner H, de Jonge H, Wang X, Dekkers D, Houtsmuller AB, Pauschinger M, Bergelson JM, Warraich R, Yacoub M, Hetzer R, Lamers J, Schultheiss H-P, Poller W. Human coxsackie-adenovirus-receptor is colocalized with integrins {alpha}vß3 and {alpha}vß5 on the cardiomyocyte sarcolemma and upregulated in dilated cardiomyopathy. Circulation. 2001; 104: 275–280.[Abstract/Free Full Text]

8. Okegawa T, Pong R-C, Li Y, Bergelson JM, Sagalowsy AI, Hsieh J-T. The mechanism of the growth inhibitory effect of coxsackie and adenovirus receptor (CAR) on human bladder cancer: a functional analysis of CAR protein structure. Cancer Res. 2001; 61: 6592–6600.[Abstract/Free Full Text]

9. Kim M, Sumerel LA, Belousova N, Lyons GR, Carey DE, Krasnykh V, Douglas JT. The coxsackievirus and adenovirus receptor acts as a tumour suppressor in malignant glioma cells. Br J Cancer. 2003; 88: 1411–1416.[CrossRef][Medline] [Order article via Infotrieve]

10. Okegawa T, Li Y, Pong RC, Bergelson JM, Zhou J, Hsieh JT. The dual impact of coxsackie and adenovirus receptor expression on human prostate cancer gene therapy. Cancer Res. 2000; 60: 5031–5036.[Abstract/Free Full Text]

11. Schachtner S, Buck C, Bergelson J, Baldwin H. Temporally regulated expression patterns following in utero adenovirus-mediated gene transfer. Gene Ther. 1999; 6: 1249–1257.[CrossRef][Medline] [Order article via Infotrieve]

12. Tomko RP, Johansson CB, Totrov M, Abagyan R, Frisen J, Philipson L. Expression of the adenovirus receptor and its interaction with the fiber knob. Exp Cell Res. 2000; 255: 47–55.[CrossRef][Medline] [Order article via Infotrieve]

13. Xu R, Crowell RL. Expression and distribution of the receptors for coxsackievirus B3 during fetal development of the Balb/c mouse and of their brain cells in culture. Virus Res. 1996; 46: 157–170.[CrossRef][Medline] [Order article via Infotrieve]

14. Kashimura T, Kodama M, Hotta Y, Hosoya J, Yoshida K, Ozawa T, Watanabe R, Okura Y, Kato K, Hanawa H, Kuwano R, Aizawa Y. Spatiotemporal changes of coxsackievirus and adenovirus receptor in rat hearts during postnatal development and in cultured cardiomyocytes of neonatal rat. Virchows Arch. 2004; 444: 283–292.[CrossRef][Medline] [Order article via Infotrieve]

15. O’Gorman S, Dagenais NA, Qian M, Marchuk Y. Protamine-Cre recombinase transgenes efficiently recombine target sequences in the mail germ line of mice, but not in embryonic stem cells. Proc Natl Acad Sci U S A. 1997; 94: 14602–14607.[Abstract/Free Full Text]

16. Jiao K, Kulessa H, Tompkins K, Zhou Y, Batts L, Baldwin HS, Hogan BL. An essential role of Bmp4 in the atrioventricular sepatation of the mouse heart. Genes Dev. 2003; 17: 2362–2367.[Abstract/Free Full Text]

17. Gaussin V, Van de Putte T, Mishina Y, Hanks MC, Zwijsen A, Huylebroeck D, Behringer RR, Schneider MD. Endocardial cushion and myocardial defects after cardiac myocyte-specific conditional deletion of the bone morphogenetic protein receptor ALK3. Proc Natl Acad Sci U S A. 2002; 99: 2878–2883.[Abstract/Free Full Text]

18. Baldwin HS, Shen HM, Yan HC, DeLisser HM, Chung A, Mickanin C, Trask T, Kirschbaum NE, Newman PJ, Albelda SM, et al. Platelet endothelial cell adhesion molecule-1 (PECAM-1/CD31): alternatively spliced, functionally distinct isoforms expressed during mammalian cardiovascular development. Development. 1994; 120: 2539–2553.[Abstract/Free Full Text]

19. Furuta Y, Piston DW, Hogan BL. Bone morphogenetic proteins (BMPs) as regulators of dorsal forebrain development. Development. 1997; 124: 2203–2212.[Abstract]

20. Chen JW, Ghosh R, Finberg RW, Bergelson JM. Structure and chromosomal localization of the murine coxsackievirus and adenovirus receptor gene. DNA Cell Biol. 2003: 253–259.

21. Kelly RG, Buckingham ME. The anterior heart-forming field: voyage to the arterial pole of the heart. Trends Genet. 2002; 18: 210–216.[CrossRef][Medline] [Order article via Infotrieve]

22. Moens CB, Stanton BR, Parada LF, Rossant J. Defects in heart and lung development in compound heterozygotes for two different targeted mutations at the N-myc locus. Development. 1993; 119: 485–499.[Abstract]

23. Chen H, Shi S, Acosta L, Li W, Lu J, Bao S, Chen Z, Yang Z, Schneider MD, Chien KR, Conway SJ, Yoder MC, Haneline L, Franco D, Shou W. BMP10 is essential for maintaining cardiac growth during murine cardiogenesis. Development. 2004; 131: 2219–2231.[Abstract/Free Full Text]

24. Houweling A, Somi S, Van Den Hoff M, Moorman A, Christoffels V. Developmental pattern of ANF gene expression reveals a strict localization of cardiac chamber formation in chicken. Anat Rec. 2002; 266: 93–102.[CrossRef][Medline] [Order article via Infotrieve]

25. Dorner AA, Wegmann F, Butz S, Wolburg-Buchholz K, Wolburg H, Mack A, Nasdala I, August B, Westermann J, Rathjen FG, Vestweber D. Coxsackievirus-adenovirus receptor (CAR) is essential for early embryonic cardiac development. J Cell Sci. 2005; 118: 3509–3521.[Abstract/Free Full Text]

26. Sedmera D, Pexieder T, Vuillemin M, Thompson RP, Anderson RH. Developmental patterning of the myocardium. Anat Rec. 2000; 258: 319–337.[CrossRef][Medline] [Order article via Infotrieve]

27. Charron J, Malynn BA, Fisher P, Stewart V, Jeannotte L, Goff SP, Robertson EJ, Alt FW. Embryonic lethality in mice homozygous for a targeted disruption of the N-myc gene. Genes Dev. 1992; 6: 2248–2257.[Abstract/Free Full Text]

28. Sawai S, Shimono A, Wakamatsu Y, Palmes C, Hanaoka K, Kondoh H. Defects of embryonic organogenesis resulting from targeted disruption of the N-myc gene in the mouse. Development. 1993; 117: 1445–1455.[Abstract]

29. Okubo T, Knoepfler PS, Eisenman RN, Hogan BL. Nmyc plays an essential role during lung development as a dosage-sensitive regulator of progenitor cell proliferation and differentiation. Development. 2005; 132: 1363–1374.[Abstract/Free Full Text]

30. Cai CL, Zhou W, Yang L, Bu L, Qyang Y, Zhang X, Li X, Rosenfeld MG, Chen J, Evans S. T-box genes coordinate regional rates of proliferation and regional specification during cardiogenesis. Development. 2005; 132: 2475–2487.[Abstract/Free Full Text]

31. Radice GL, Rayburn H, Matsunami H, Knudsen KA, Takeichi M, Hynes RO. Developmental defects in mouse embryos lacking N-cadherin. Dev Biol. 1997; 181: 64–78.[CrossRef][Medline] [Order article via Infotrieve]

32. Ruiz P, Brinkmann V, Ledermann B, Behrend M, Grund C, Thalhammer C, Vogel F, Birchmeier C, Gunthert U, Franke WW, Birchmeier W. Targeted mutation of plakoglobin in mice reveals essential functions of desmosomes in the embryonic heart. J Cell Biol. 1996; 135: 215–225.[Abstract/Free Full Text]

33. Excoffo KJ, Hruska-Hageman A, Klotz M, Traver GL, Zabner J. A role for the PDZ-binding domain of the coxsackie B virus and adenovirus receptor (CAR) in cell adhesion and growth. J Cell Science. 2004; 117: 4401–4409.[Abstract/Free Full Text]

34. Ishiwata T, Nakazawa M, Pu W, Tevosian S, Izumo S. Developmental changes in ventricular diastolic function correlate with changes in ventricular myoarchitecture in normal mouse embryos. Circ Res. 2003; 93: 857–865.[Abstract/Free Full Text]

35. White JC, Highland M, Clagett-Dame M. Abnormal development of the sinuatrial venous valve and posterior hindbrain may contribute to late fetal resorption of vitamin A-deficient rat embryos. Teratology. 2000; 62: 374–384.[CrossRef][Medline] [Order article via Infotrieve]

36. Olson EN, Schneider MD. Sizing up the heart: development redux in disease. Genes Dev. 2003; 17: 1937–1956.[Free Full Text]

37. Asher DR, Cerny AM, Weiler SR, Horner JW, Keeler ML, Neptune MA, Jones SN, Bronson RT, Depinho RA, Finberg RW. Coxsackievirus and adenovirus receptor is essential for cardiomyocyte development. Genesis. 2005; 42: 77–85.[CrossRef][Medline] [Order article via Infotrieve]

38. Perriard JC, Hirschy A, Ehler E. Dilated cardiomyopathy: a disease of the intercalated disc? Trends Cardiovasc Med. 2003; 13: 30–38.[CrossRef][Medline] [Order article via Infotrieve]

39. Sasse A, Wallich M, Ding Z, Goedecke A, Schrader J. Coxsackie-and-adenovirus receptor mRNA expression in human heart failure. J Gene Med. 2003; 5: 876–882.[CrossRef][Medline] [Order article via Infotrieve]

40. Fechner H, Noutsias M, Tschoepe C, Hinze K, Wang X, Escher F, Pauschinger M, Dekkers D, Vetter R, Paul M, Lamers J, Schultheiss HP, Poller W. Induction of coxsackievirus-adenovirus-receptor expression during myocardial tissue formation and remodeling: identification of a cell-to-cell contact-dependent regulatory mechanism. Circulation. 2003; 107: 876–882.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J Am Coll CardiolHome page
Y. Shi, C. Chen, U. Lisewski, U. Wrackmeyer, M. Radke, D. Westermann, M. Sauter, C. Tschope, W. Poller, K. Klingel, et al.
Cardiac deletion of the coxsackievirus-adenovirus receptor abolishes coxsackievirus b3 infection and prevents myocarditis in vivo.
J. Am. Coll. Cardiol., April 7, 2009; 53(14): 1219 - 1226.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
U. Lisewski, Y. Shi, U. Wrackmeyer, R. Fischer, C. Chen, A. Schirdewan, R. Juttner, F. Rathjen, W. Poller, M. H. Radke, et al.
The tight junction protein CAR regulates cardiac conduction and cell-cell communication
J. Exp. Med., September 29, 2008; 205(10): 2369 - 2379.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Mirza, C. Petersen, K. Nordqvist, and K. Sollerbrant
Coxsackievirus and Adenovirus Receptor Is Up-Regulated in Migratory Germ Cells during Passage of the Blood-Testis Barrier
Endocrinology, November 1, 2007; 148(11): 5459 - 5469.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. Shono, H. Tsukaguchi, E. Yaoita, M. Nameta, H. Kurihara, X.-S. Qin, T. Yamamoto, and T. Doi
Podocin Participates in the Assembly of Tight Junctions between Foot Processes in Nephrotic Podocytes
J. Am. Soc. Nephrol., September 1, 2007; 18(9): 2525 - 2533.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. Song, W. Yan, X. Chen, C.-x. Deng, Q. Wang, and K. Jiao
Myocardial Smad4 Is Essential for Cardiogenesis in Mouse Embryos
Circ. Res., August 3, 2007; 101(3): 277 - 285.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
98/7/923    most recent
01.RES.0000218041.41932.e3v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.-W.
Right arrow Articles by Bergelson, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.-W.
Right arrow Articles by Bergelson, J. M.
Related Collections
Right arrow Animal models of human disease
Right arrow Developmental biology
Right arrow Myocardial cardiomyopathy disease