Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2006;98:682-689
Published online before print February 2, 2006, doi: 10.1161/01.RES.0000207498.40005.e7
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
98/5/682    most recent
01.RES.0000207498.40005.e7v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kakkar, R.
Right arrow Articles by McNally, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kakkar, R.
Right arrow Articles by McNally, E. M.
Related Collections
Right arrow Arrythmias-basic studies
Right arrow Other Vascular biology
Right arrowRelated Article
(Circulation Research. 2006;98:682.)
© 2006 American Heart Association, Inc.


Cellular Biology

Spontaneous Coronary Vasospasm in KATP Mutant Mice Arises From a Smooth Muscle–Extrinsic Process

Rahul Kakkar, Bin Ye, Douglas A. Stoller, Matthew Smelley, Nian-Qing Shi, Kevin Galles, Michele Hadhazy, Jonathan C. Makielski, Elizabeth M. McNally

From the Department of Medicine (R.K., M.S., M.H., E.M.M.) and Committee on Cell Physiology (D.A.S.), The University of Chicago, Ill; and the Department of Medicine (B.Y., N.-Q.S., K.G., J.C.M.), University of Wisconsin, Madison.

Correspondence to Elizabeth M. McNally, MD, PhD, The University of Chicago, 5841 S Maryland, MC6088, Chicago, IL 60637. E-mail emcnally{at}medicine.bsd.uchicago.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
In the vasculature, ATP-sensitive potassium channels (KATP) channels regulate vascular tone. Mice with targeted gene disruptions of KATP subunits expressed in vascular smooth muscle develop spontaneous coronary vascular spasm and sudden death. From these models, it was hypothesized that the loss of KATP channel activity in arterial vascular smooth muscle was responsible for coronary artery spasm. We now tested this hypothesis using a transgenic strategy where the full-length sulfonylurea receptor containing exon 40 was expressed under the control of a smooth muscle–specific SM22{alpha} promoter. Two transgenic founder lines were generated and independently bred to sulfonylurea receptor 2 (SUR2) null mice to generate mice that restored expression of KATP channels in vascular smooth muscle. Transgenic expression of the sulfonylurea receptor in vascular smooth muscle cells was confirmed by detecting mRNA and protein from the transgene. Functional restoration was determined by recording pinacidil-based KATP current by whole cell voltage clamping of isolated aortic vascular smooth muscle cells isolated from the transgenic restored mice. Despite successful restoration of KATP channels in vascular smooth muscle, transgene-restored SUR2 null mice continued to display frequent episodes of spontaneous ST segment elevation, identical to the phenotype seen in SUR2 null mice. As in SUR2 null mice, ST segment elevation was frequently followed by atrioventricular heart block. ST segment elevation and coronary perfusion pressure in the restored mice did not differ significantly between transgene-negative and transgene-positive SUR2 null mice. We conclude that spontaneous coronary vasospasm and sudden death in SUR2 null mice arises from a coronary artery vascular smooth muscle–extrinsic process.


Key Words: KATP channel • sulfonylurea receptor • vasospasm • smooth muscle


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
ATP-sensitive potassium (KATP) channels are heterooctamers found in multiple cell types.1 The channel is composed of a pore-forming unit, Kir6.x, and a regulatory subunit, the sulfonylurea receptor (SUR). KATP channels are sensitive to intracellular energetic changes and are inhibited by ATP and stimulated by MgADP.2 The electrophysiological and pharmacological properties of KATP channels vary from tissue to tissue depending on the expression pattern of the specific Kir6.x and SUR subunits that constitute the channel. Biophysical profiles of KATP channels in native cells and tissues have been compared with heterologously expressed Kir6.x and SUR subunits to understand the composition of KATP channels in different tissues. For example, heterologous expression of Kir6.2 and SUR1 generates channels with a signature that closely matches the characteristics of native pancreatic ß-cell and neuronal KATP channels.

In the cardiovascular system, Kir6.2 and SUR2 constitute the major KATP channels of the heart reflecting expression in cardiomyocytes.1 SUR2 undergoes alternative splicing,3,4 where either exon 39 or exon 40 encodes the cytoplasmic carboxy terminus. SUR2 with exon 39 (SUR2A, also known as SUR2(39)) is found in cardiomyocytes and skeletal myofibers.5 In cardiomyocytes, KATP channels are quiescent at baseline and are activated by hypoxic or ischemic insults. The resultant potassium flux leads to a shortening of the action potential duration and cellular protection.6–8 In addition to this role, KATP channels have been implicated in ischemic preconditioning,9–12 the process where short bouts of ischemia before an index ischemic event activates intracellular signals and a transcriptional gene program that confers cellular protection. KATP channels are also involved in the normal cardiac response to adrenergic stress.13

In smooth muscle, including vascular smooth muscle, an alternatively spliced form of SUR2 that contains exon 40 (SUR2B, also known as SUR2(40)) is present. SUR2A and SUR2B differ in the carboxy-terminal 42 amino acids. Heterologous expression of SURB along with Kir6.1 results in a small-conductance, glibenclamide-sensitive potassium channel that is relatively insensitive to ATP, resembling the channel found in native vascular smooth muscle cells.14 These channels have been implicated in the regulation of resting coronary tone. Vascular KATP channels have also been implicated in the coronary vasodilatory response to exercise15 and hypoxia.16 KATP channels may also play a role in endotoxic vasodilation.17

Independent gene targeting studies in mice of either the gene encoding SUR2 (ABCC9) or Kir6.1 (KCNJ8) produced an identical phenotype of coronary artery spasm seen as transient ST segment elevation accompanied by atrioventricular heart block, bradycardia, and sudden death.18,19 As these genetically modified mice carried gene deletions that affected gene expression in all tissues, the origin of vascular spasm in Kir6.1 and SUR2 null mice was believed to result from of a loss of coronary artery vascular smooth muscle KATP channels, the common and overlapping cell type affected by both gene targeted mutants. To test the hypothesis that coronary artery smooth muscle KATP channels are responsible for the coronary artery spasm and sudden death seen in Kir6.1 and SUR2 null mice, we used the SM22{alpha} promoter to express SUR2B in SUR2–/– mice. Despite expression and reconstitution of vascular KATP channels, the phenotype of ST segment elevation and coronary artery vasospasm persisted, consistent with a vascular smooth muscle cell extrinsic mechanism of vascular spasm.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Transgenic Construct
The 2B isoform of SUR2 (SUR2B) was amplified from a mouse heart cDNA library and placed between the terminal 441 base pairs (bp) of the SM22{alpha} promoter20 and the bovine growth hormone termination and polyadenylation signal sequence. The plasmid (SM22-SUR2B) was verified by sequencing, digested, separated from the plasmid backbone, and purified before injection into fertilized oocytes.

Animals
SUR2–/– mice were described previously.19,21 The SUR2 mutant allele was bred heterozygously into the FVB background. The SM22-SUR2B transgene was injected into fertilized oocyte pronuclei generated from a cross between SUR2–/– females and FVB wild-type males (The Jackson Laboratory, Bar Harbor, Me). Transgene copy number was assessed by quantitative PCR using genomic DNA conducted in triplicate using transgene-specific primers with fold changes normalized to the apolipoprotein B reverse-transcribed transcript. Two transgene-positive SUR2+/– founders were selected and independently mated to SUR2–/– and SUR2+/+ mice. Animals were housed, treated, and handled in accordance with the guidelines set forth by the University of Chicago’s Institutional Animal Care and Use Committee, the Animal Welfare Act regulations, and the NIH Guide for the Care and Use of Laboratory Animals. All comparisons were made to littermates. All studies were performed on male mice between 8 and 12 weeks of age unless otherwise noted.

Reverse-Transcription PCR
Total RNA was extracted from homogenized descending aortae using TRIzol reagent according to the protocol of the manufacturer (Invitrogen, Carlsbad, Calif). RNA pellets were resuspended in diethylpyrocarbonate-treated water and DNase treated (Turbo DNAfree, Ambion, Austin, Tex). Complementary DNA was synthesized using Superscript III reverse transcriptase (Invitrogen). Transgene-specific primers were used to detect products from the SM22-SUR2B transgene (SM22{alpha} promoter forward: 5' AGACACCGAAGCTACTCTCC 3', SUR2 exon 4 reverse: 5' GCGGAAGGCATCGTTTCAGA 3'; SUR2 exon 38 forward: 5' AGTCATGACAGCCTTTGCGG 3', BGH terminator reverse: 5' GCCTTCTAGTTGCCAGCCAT 3').

Cell Isolation and Electrophysiology
Aortic smooth muscle cells were isolated as previously described.22 Purity of the isolation for smooth muscle was ascertained on a subset of cells by immunofluorescence staining with an anti–smooth muscle {alpha}-actin antibody (Sigma-Aldrich, St Louis, Mo), and cell viability was ascertained by Trypan blue dye exclusion (Sigma-Aldrich). Only cells displaying the typical spindle-shape of smooth muscle by phase-contrast microscopy were used in patch-clamp experiments.

Conventional patch-clamp whole cell recording was performed at 20°C to 22°C.23 Axopath 200B amplifier and pClamp version 9.0 software (Axon Instruments Incorporated, Union City, Calif) were used. Patch pipettes were drawn from borosilicate glass (World Precision Instruments Incorporated, Sarasota, Fl) with a resistance of 2 to 3 M{Omega} when filled with recording solutions. The bath solution contained 4 mmol/L KCl, 140 mmol/L NaCl, 10 mmol/L HEPES, 1 mmol/L CaCl2, 10 mmol/L glucose, 1.2 mmol/L MgCl2, and 50 µmol/L nifedipine, pH 7.4, with KOH. Nifedipine was added to the bath solution to block the L-type Ca2+ current. The pipette solution was composed of 140 mmol/L KCl, 20 mmol/L HEPES, 5 mmol/L EGTA, 2 mmol/L MgCl2, 1 mmol/L UDP, pH 7.25, with KOH. To ensure the opening of 2 types of KATP channels reported in smooth muscle cell,3,14 ATP was omitted and Mg2+ and UDP included in the pipette. The whole cell current was generated by clamp pulses from a holding potential of –70 mV to voltages ranging from –120 to 20 mV in 20-mV steps for 260 ms. The currents were filtered at 1 kHz and sampled at 5 kHz. Data were digitally stored for off-line analysis using the pClamp software. Whole cell currents usually reached maximal levels 2 minutes after membrane rupture. Extracellular application of pinacidil 200 µmol/L (Parke Davis, Ann Arbor, Mich) could not further increase the current amplitude. The whole cell current could be partially blocked by 20 µmol/L glibenclamide (Sigma-Aldrich). The glibenclamide-sensitive current was interpreted as KATP current19 and was normalized by cell capacitance to obtain the whole cell current density.

Antibodies
An anti-SUR2 antibody, BNJ-2, was raised in rabbits. The peptide sequence QSKPINRKQPGRYH was conjugated to KLH before use as an antigen. This sequence falls within nucleotide binding fold 1. BNJ-2 was affinity purified using the antigenic peptide. The specificity of this antibody was determined by heterologous expression (data not shown). The monoclonal anti–smooth muscle {alpha}-actin antibody was from Sigma-Aldrich (catalog number A5228). Secondary antibodies included goat anti-mouse Alexa488 and goat anti-rabbit Alexa596 (Invitrogen). Primary antibodies were diluted to 1:8000 and 1:300 for BNJ-2 and the anti–smooth muscle {alpha}-actin, respectively. Secondary antibodies were diluted to 1:2000 and 1:6000 for Alexa488 and Alexa596, respectively.

Immunofluorescence Microscopy
Hearts were frozen in liquid nitrogen–cooled isopentane, sectioned at a thickness of 8 µm and fixed in –20°C methanol for 10 minutes. Hearts were sectioned from base to apex and a minimum of every tenth section was examined for the presence of arteries using the anti–smooth muscle {alpha}-actin antibody to confirm the presence of arteries. Fluorescent images were viewed and captured using the Axioskop, AxioCam, and AxioVision microscope, camera, and software systems (Carl Zeiss Inc, Oberkochen, Germany).

Ambulatory Electrocardiographic Recordings
Continuous ambulatory electrocardiographic (ECG) recordings were obtained as described previously.19 Recording was begun after a 24-hour recovery period for 48 hours. ECG tracings were manually analyzed for spontaneous ST segment changes. ST segment frequency and duration during the first 2 hours of recording were quantified by an investigator blinded to mouse genotype. Heart rate variability was calculated as the SD of the mean R-R intervals over the recording period.

Microvascular Filling
Coronary artery microvascular filling was performed as described previously.19 Hearts were examined blinded to age, genotype, and animal number. Vessels found to be filled with Microfil were scored for presence or absence of focal narrowings, representing areas of focal vasospasm.

Coronary Perfusion Pressure
Mice were heparinized (0.5 U/g body weight) and anesthetized (inhaled 3% isoflurane). The hearts were then rapidly excised and transfused via a 24-gauge cannula (Fine Science Tools, Foster City, Calif) placed immediately distal of the intact aortic valve. Hearts were perfused at constant flow (&4.5 mL/min) with Krebs–Henseleit solution (in mmol/L: 120 NaCl, 4.7 KCl, 1.2 MgSO4, 1.2 KH2PO4, 15 glucose, 25 NaHCO3, 1.75 CaCl2, 0.05 EDTA) equilibrated with 95% O2 and 5% CO2 at 37°C using a standard Langendorff setup (Radnoti Glass Technology, Monrovia, Calif). Coronary perfusion pressure was continuously recorded using a pressure-sensing catheter (Millar Instruments, Houston, Tex) connected to the perfusion cannula. Hearts were equilibrated for at least 20 minutes before exposure to methylergonovine (10 µmol/L, Sigma-Aldrich, catalog no. M2776) for 20 minutes. Hearts were maintained at 37°C via a water-jacketed tissue-organ bath for the duration of the experiment (N=3 in each group).

Statistical Analysis
All quantified results are reported as mean±SD unless otherwise noted. A Student’s t test was used to compare means where appropriate. A cutoff probability value of 0.05 was used unless otherwise noted. For coronary perfusion pressure measurements, a 1-way ANOVA followed by Newman–Keuls multiple comparison tests was used.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Smooth Muscle Restricted Expression of SUR2B
We generated mice carrying a transgene to drive expression of SUR2B, the dominant isoform found in vascular smooth muscle, in coronary arteries using the SM22{alpha} promoter and following a strategy we had used previously (Figure 1A).24 The terminal 3' end of the SM22{alpha} promoter has been shown to be necessary and sufficient to drive expression specifically in arterial smooth muscle cells20,25 from mid-embryogenesis through adulthood.26 Mice harboring the SM22-SUR2B transgene were subsequently bred to mice with the null allele of SUR2 to produce mice with restoration of coronary artery vascular smooth muscle KATP channels.


Figure 1
View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. Strategy for transgene restoration. A, Schematic map of the SM22-SUR2B (SUR2 containing exon 40) transgenic construct. SM22{alpha} (SM22a) is the 441 bp proximal to the SM22{alpha} gene. BHGt represents the bovine growth hormone termination signals. B, RT-PCR performed on total mRNA from aortae isolated from SUR2 null mice with and without the SM22-SUR2B transgene (Tg+ and Tg, respectively). Reactions without reverse transcriptase were also performed (- RT) as a control. C indicates a positive control of transgene positive genomic DNA. PCR was conducted using primers specific to the SM22-SUR2B transgene spanning from SUR2 exon 38 into the termination sequence to yield the expected product of 211 bp.

Two independent SM22-SUR2B transgenic lines were generated and examined. Line 8 had a copy number of 3, and line 14 had a copy number of 12. Founder mice and their progeny were viable and fertile. The presence of mRNA produced from the SM22-SUR2B transgene was determined by RT-PCR of total RNA prepared from aortae (Figure 1B). Protein expression from the SM22-SUR2B transgene was documented by immunostaining using a rabbit polyclonal antibody raised against a region of the first nucleotide binding fold of SUR2 (Figure 2). Specificity of this BNJ-2 antibody was shown by its reactivity to normal coronary arteries and cardiomyocytes and its lack of reactivity to coronary arteries and cardiomyocytes in SUR2 null hearts (Figure 2). SUR2 immunoreactivity was seen consistently in both large and small vessels throughout the heart. Costaining with an anti–smooth muscle {alpha}-actin antibody was used to document the identity of coronary arteries and consistently appeared with SUR2 immunoreactivity as shown in Figure 2.


Figure 2
View larger version (43K):
[in this window]
[in a new window]
 
Figure 2. Restoration of coronary artery vascular smooth muscle SUR2 protein expression by transgenesis. Immunofluorescence microscopy was performed on heart sections containing coronary arteries. Sections from control (SUR2+/+), SUR2–/–, and SUR2 null hearts in the presence of the transgene in 2 different transgene lines, line 8 (row 3) and line 14 (row 4). The antibodies used are indicated at the top of the columns. Column 1 shows staining with an anti-SUR2 antibody demonstrating loss of SUR2 immunoreactivity in SUR2 null mice and restoration of SUR2 expression in the 2 different transgenic lines (column 1, red). Column 2 shows anti–smooth muscle actin reactivity to mark vascular smooth muscle (column 2, green). The third column shows merged images with nuclear DAPI staining (blue). Scale bars, 100 µmol/L.

Restoration of Vascular Smooth Muscle KATP Channel Activity
Transgene-driven KATP channel activity was documented using whole cell patch clamp of isolated aortic vascular smooth muscle cells from SUR2 null mice with and without the SM22-SUR2B transgene. Cells isolated from both transgenic lines exhibited pinacidil-evocable, glibenclamide-sensitive currents, consistent with the known pharmacological characteristics of native KATP channels (Figure 3A). Whole cell current density in both lines was not statistically different from wild type (Figure 3B), consistent with the generation of the appropriate channel density within arterial smooth muscle.


Figure 3
View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. KATP channel activity in vascular smooth muscle of transgenic animals. A, Whole cell patch clamp was performed on aortic vascular smooth muscle cells isolated from control (SUR2+/+), SUR2–/–, and SUR2 null mice in the presence of the transgene in 2 different transgene lines. The first column shows channel activity 2 minutes after cell rupture in the absence of drug. The second column shows channel response to 200 µmol/L pinacidil (Pin). The third column shows channel activity in the presence of 20 µmol/L glibenclamide (Glib). In the case of SUR2–/–, pinacidil-sensitive current (control minus pinacidil) is shown. Glibenclamide-sensitive currents are absent in SUR2–/– cells but are present in null mice in the presence of the transgene in 2 independent transgenic lines, line 8 (upper) and line 14 (lower). B, Mean whole cell current density quantified from A. *P<0.05 vs SUR2+/+. ns indicates P>0.05 vs SUR2+/+; n, number of patches, number of animals.

Coronary Artery KATP Channel Activity Fails to Correct Coronary Artery Vascular Spasm
We examined SUR2 null mice with and without the SM22-SUR2B transgene for the presence of coronary artery vascular spasm using radiofrequency ambulatory monitoring. SUR2 null mice display frequent and repeated episodes of transient ST segment elevation that frequently associate with atrioventricular heart block and occasionally bradycardia, agonal rhythms, and death. Surprisingly, transgene-restored SM22-SUR2B/SUR2 null mice also displayed frequent, transient ST segment elevation indistinguishable from that seen in SUR2 null mice (Figure 4). After 48 hours of ambulatory ECG recording, SM22-SUR2B/SUR2–/– mice were compared with their SUR2–/– littermate controls. No statistically significant difference in mean heart rate (Figure 5A) or heart rate variability (Figure 5B) was seen between the groups. In mice surviving through the recording period, mean PR and QRS interval duration were not different between SM22-SUR2B/SUR2–/– mice and their SUR2–/– littermate controls (data not shown). Quantitation of these episodes revealed no statistically significant difference in the amount and duration of ST segment elevation between SM22-SUR2B/SUR2–/– mice and SUR2 null mice (Figure 5C). We also examined whether the presence of the transgene alone, in a wild-type background, was sufficient to produce ST segment elevation. We monitored the heart rates of animals from line 8 and found no evidence of ST segment elevation or other ECG abnormalities.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
Figure 4. Evidence of persistent coronary vasospasm in SM22-SUR2B/SUR2–/– mice. A, Electrocardiograms were screened for ST segment changes consistent with coronary spasm. A, Row 1 shows a representative ECG tracing from an SM22-SUR2B transgene positive mouse in the presence of a control (SUR2+/+) background. No ECG perturbations were seen in this genotype nor in the transgene negative SUR2+/+ mice throughout the 48-hour recording period (data not shown). Row 2 (SUR2–/–) shows a representative ECG tracing from a littermate SUR2–/– transgene-negative mouse. Frequent episodes of transient, spontaneous ST segment elevation, usually followed by ST segment depression and atrioventricular heart block were noted in SUR2–/– mice as previously reported.24 Row 3 shows a representative ECG tracing from an SM22-SUR2B/SUR2–/– transgene-positive mouse. Similar to SUR2–/– mice, episodes of ST segment elevation, depression and heart block were seen in transgene-positive SUR2–/– mice. B, Infrequently, the persistent bradycardia would progress to agonal rhythms and death. Representative tracings corresponding to the numbers shown along the graph in B are shown in to the right in C. C, Tracing corresponding to the graph in B. 1=normal sinus rhythm; 2=ST segment elevation followed by ST segment depression; 3=2:1 atrioventricular block; 4=continued AV block with wide QRS interval.


Figure 5
View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. Heart rate, heart rate variability, and ST segment duration and frequency in transgene restored mice. A, Mean heart rate was calculated from ECG recordings of SUR2 null and SUR2 null mice in the presence of the SM22-SUR2B transgene (Tg+). No significant difference in mean heart rate was seen. Similarly, no significant differences were seen between transgene-positive and transgene-negative control (SUR2+/+) mice (n=5 mice per group). B, Heart rate variability was calculated from the ECG recordings in A. Variability was calculated as the SD of the mean R-R interval (SDNN) measured over the 48-hour recording period. No significant differences in heart rate variability were seen between SUR2 null mice and SUR2 null mice in the presence of the SM22-SUR2B transgene (Tg+), (n=5 mice per group). Similarly, no significant differences were seen between transgene positive and transgene negative control (SUR2+/+) mice. C, Episodes of ST segment elevation were compared between SUR2 null mice and SUR2 null mice with the SM22-SUR2B transgene (Tg and Tg+, respectively). The total duration of ST segment elevation during the first 2 hours of ECG recording was measured and the average taken (n=5 mice per group). There was no significant difference in the frequency and duration of ST segment elevation between the 2 groups.

Evidence of Persistent Coronary Vasospasm in Transgenic Mice
A microvascular filling technique was used to demonstrate arterial narrowing consistent with vascular spasm in SUR2 null mice.24 Because ECG evidence of vasospasm was documented in both lines of SM22-SUR2B/SUR2 null mice, we used this microvascular filling technique to examine transgene-restored mice for the presence of coronary artery vascular spasm. Microvascular evidence for coronary spasm was documented in both transgene-restored lines as well (Figure 6A).


Figure 6
View larger version (71K):
[in this window]
[in a new window]
 
Figure 6. Abnormal coronary artery vascular reactivity despite transgene restoration. A, Microvascular filling of coronary arteries from SUR2 null and transgene restored mice. Hearts were perfused with Microfil latex compound, fixed, dehydrated, and cleared with methylsalicylate. Shown are images of the residual coronary vascular casts. Whereas control (SUR2+/+) hearts showed no evidence of vascular occlusion, SUR2–/– as well as transgene positive SUR2–/– mice from both independent SM22-SUR2B transgenic lines display evidence of coronary spasm. Scale bar=100 µmol/L. B, Coronary perfusion pressures were measured in isolated working hearts from control, SUR2 null, and transgene-restored mice. SUR2 null mice display elevated baseline coronary artery perfusion pressures. Infusion of methylergonovine resulted in a further increase in coronary perfusion pressure, whereas a similar infusion in control mice produced an increase that was not statistically significant. SM22-SUR2B hearts showed a similar increase in baseline coronary artery perfusion pressure that was statistically significant from control but not from SUR2 null mice. Similarly, infusion of methylergonovine produced an increase in coronary artery vascular pressure consistent with enhanced spasm that was not seen in wild-type control mice. *P<0.05, n=3 in each group. All other comparisons were not statistically significant.

We also examined coronary perfusion pressure in littermate control as well as SUR2 null mice with and without the SM22-SUR2B transgene. The mean baseline coronary perfusion pressure in control mice (n=3) was 69±5 mm Hg. SUR2 null mice with and without the SM22-SUR2B transgene exhibited elevated baseline coronary perfusion pressures of 111±3 and 115±7 mm Hg, respectively, significantly higher than control mice (Figure 6B). Methylergonovine treatment (10 µmol/L) of control mice induced a mild, insignificant increase in coronary perfusion pressure to 79±2 mm Hg. In contrast, methylergonovine produced statistically significant increases of coronary perfusion pressure in SUR2 null mice with and without the SM22-SUR2B transgene (137±5 and 147±13 mm Hg, respectively). These data directly demonstrate that coronary artery perfusion pressure at baseline and in response to methylergonovine remained functionally abnormal despite restoration of arterial vascular SUR2-KATP channels.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Here we show a persistent phenotype of coronary artery vascular spasm in mice engineered to lack SUR2 despite restoration of vascular smooth muscle KATP channels. Smooth muscle restoration of coronary artery KATP channels was ineffective in reducing spasm and the consequent atrioventricular heart block and sudden death that accompanies this spasm. These findings indicated that coronary artery vascular spasm associated with global loss of SUR2-Kir6.1 KATP channels arises from a vascular smooth muscle cell–extrinsic process. Although never directly tested, the etiology of vasospasm in mice with targeted gene deletions of Kir6.1 or SUR2 had been attributed to the loss of KATP channels in smooth muscle.18,19 The presumed role of the vascular smooth muscle etiology was surmised based on the overlapping patterns of expression of these genes; both Kir6.1 and SUR2 are found in vascular smooth muscle. Considerable evidence suggests that the smooth muscle KATP channel is composed of Kir6.1 and SUR2B.3,14 However, it should be noted that both subunits are coexpressed in other cell types such as endothelial27–29 and neuronal cell types.30–33 Although not the dominant KATP channel, low-level expression is also present in cardiomyocytes.18,28,34

Mice lacking SUR2 do not show the normal vascular reactivity to glibenclamide and pinacidil, supporting a role for SUR2-KATP channels in the regulation of vascular tone.19 Our current studies have focused on expression of SUR2 in coronary artery vascular smooth muscle and in aortic smooth muscle because the SM22 promoter drives expression in these tissues. However, despite functional expression in these tissues, evidence for coronary artery spasm and increased coronary artery perfusion pressure remained. There is evidence to support a role for endothelial KATP channels in vascular function and, potentially, in the regulation of vascular tone and vascular spasm. Adenosine35 and {alpha}2-adrenergic36 vasodilatation may be dependent on endothelial KATP channels. However, in the rat aorta, vasodilation induced by opening of KATP channels was not affected by endothelial denudation, indicating that other mechanisms may be sufficient to override endothelial control.

Neuronal KATP channels may also contribute to vasospasm and sudden death seen in SUR2 null mice. The ability of the autonomic nervous system to induce coronary spasm has been documented,37,38 and a role for autonomic hyperactivity in human variant angina has been postulated.39 Blockade of KATP channels was shown to augment the normal increase in coronary vascular resistance seen with sympathetic nerve stimulation.40 This effect may be mediated by an unopposed neuropeptide Y effect.41 More recently, it has been proposed that the attenuation of cardiac norepinephrine overflow seen during low-flow ischemia may be mediated in part by the opening of presynaptic KATP channels.42 In skeletal muscle, the normal contraction-induced attenuation of sympathetic vasoconstriction is partially abolished by inhibition of KATP channels.43 These studies point to a possible role of the pre-synaptic KATP channel of sympathetic neurons in the etiology of coronary spasm.

Our studies demonstrate that spontaneous coronary artery vasospasm seen in mice lacking SUR2 arises from a vascular smooth muscle–extrinsic process. This surprising finding suggests that the loss of KATP channels in an organ system in close interaction with the coronary vasculature is vital for normal coronary function as studies in isolated hearts showed evidence of abnormal vascular reactivity, eliminating more distant regulators of vascular tone. A precedent for the involvement of KATP channels in tissue and organ system crosstalk has recently been noted in the central nervous system. Hypothalamic KATP channel function affects systemic glucose homeostasis indirectly by altering pancreatic {alpha}-cell glucagon secretion44 and hepatic gluconeogenesis.33 It is possible that the normal, KATP-mediated regulation of cardiovascular function may also be controlled though multiorgan system or, more likely, a proximal paracrine effect mediated by the neuronal or endothelial crosstalk to vascular smooth muscle.


*    Acknowledgments
 
This work was supported by the Burroughs Wellcome Fund (to E.M.M.), NIH grant HL078926 (to E.M.M.), and NIH grant HL057414 (to J.C.M.). R.K. was supported by NIH grant 5T32HL007381. B.Y. was supported by American Heart Association national scientist development grant 0435030N.


*    Footnotes
 
Original received August 26, 2005; revision received December 28, 2005; accepted January 19, 2006.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Seino S, Miki T. Physiological and pathophysiological roles of ATP-sensitive K+ channels. Prog Biophys Mol Biol. 2003; 81: 133–176.[CrossRef][Medline] [Order article via Infotrieve]

2. Noma A. ATP-regulated K+ channels in cardiac muscle. Nature. 1983; 305: 147–148.[CrossRef][Medline] [Order article via Infotrieve]

3. Isomoto S, Kondo C, Yamada M, Matsumoto S, Higashiguchi O, Horio Y, Matsuzawa Y, Kurachi Y. A novel sulfonylurea receptor forms with BIR (Kir6.2) a smooth muscle type ATP-sensitive K+ channel. J Biol Chem. 1996; 271: 24321–24324.[Abstract/Free Full Text]

4. Chutkow WA, Simon MC, Le Beau MM, Burant CF. Cloning, tissue expression, and chromosomal localization of SUR2, the putative drug-binding subunit of cardiac, skeletal muscle, and vascular KATP channels. Diabetes. 1996; 45: 1439–1445.[Abstract]

5. Inagaki N, Gonoi T, Clement JP, Wang CZ, Aguilar-Bryan L, Bryan J, Seino S. A family of sulfonylurea receptors determines the pharmacological properties of ATP-sensitive K+ channels. Neuron. 1996; 16: 1011–1017.[CrossRef][Medline] [Order article via Infotrieve]

6. Faivre JF, Findlay I. Action potential duration and activation of ATP-sensitive potassium current in isolated guinea-pig ventricular myocytes. Biochim Biophys Acta. 1990; 1029: 167–172.[Medline] [Order article via Infotrieve]

7. Nichols CG, Ripoll C, Lederer WJ. ATP-sensitive potassium channel modulation of the guinea pig ventricular action potential and contraction. Circ Res. 1991; 68: 280–287.[Abstract/Free Full Text]

8. Findlay I. The ATP sensitive potassium channel of cardiac muscle and action potential shortening during metabolic stress. Cardiovasc Res. 1994; 28: 760–761.[Free Full Text]

9. Cohen MV, Baines CP, Downey JM. Ischemic preconditioning: from adenosine receptor of KATP channel. Annu Rev Physiol. 2000; 62: 79–109.[CrossRef][Medline] [Order article via Infotrieve]

10. Gross GJ, Peart JN. KATP channels and myocardial preconditioning: an update. Am J Physiol Heart Circ Physiol. 2003; 285: H921–H930.[Abstract/Free Full Text]

11. Suzuki M, Sasaki N, Miki T, Sakamoto N, Ohmoto-Sekine Y, Tamagawa M, Seino S, Marban E, Nakaya H. Role of sarcolemmal K(ATP) channels in cardioprotection against ischemia/reperfusion injury in mice. J Clin Invest. 2002; 109: 509–516.[CrossRef][Medline] [Order article via Infotrieve]

12. Gumina RJ, Pucar D, Bast P, Hodgson DM, Kurtz CE, Dzeja PP, Miki T, Seino S, Terzic A. Knockout of Kir6.2 negates ischemic preconditioning-induced protection of myocardial energetics. Am J Physiol Heart Circ Physiol. 2003; 284: H2106–H2113.[Abstract/Free Full Text]

13. Zingman LV, Hodgson DM, Bast PH, Kane GC, Perez-Terzic C, Gumina RJ, Pucar D, Bienengraeber M, Dzeja PP, Miki T, Seino S, Alekseev AE, Terzic A. Kir6.2 is required for adaptation to stress. Proc Natl Acad Sci U S A. 2002; 99: 13278–13283.[Abstract/Free Full Text]

14. Yamada M, Isomoto S, Matsumoto S, Kondo C, Shindo T, Horio Y, Kurachi Y. Sulphonylurea receptor 2B and Kir6.1 form a sulphonylurea-sensitive but ATP-insensitive K+ channel. J Physiol. 1997; 499 (pt 3): 715–720.[Abstract/Free Full Text]

15. Ishibashi Y, Duncker DJ, Zhang J, Bache RJ. ATP-sensitive K+ channels, adenosine, and nitric oxide-mediated mechanisms account for coronary vasodilation during exercise. Circ Res. 1998; 82: 346–359.[Abstract/Free Full Text]

16. Kingsbury MP, Robinson H, Flores NA, Sheridan DJ. Investigation of mechanisms that mediate reactive hyperaemia in guinea-pig hearts: role of K(ATP) channels, adenosine, nitric oxide and prostaglandins. Br J Pharmacol. 2001; 132: 1209–1216.[CrossRef][Medline] [Order article via Infotrieve]

17. Landry DW, Oliver JA. The ATP-sensitive K+ channel mediates hypotension in endotoxemia and hypoxic lactic acidosis in dog. J Clin Invest. 1992; 89: 2071–2074.[Medline] [Order article via Infotrieve]

18. Miki T, Suzuki M, Shibasaki T, Uemura H, Sato T, Yamaguchi K, Koseki H, Iwanaga T, Nakaya H, Seino S. Mouse model of Prinzmetal angina by disruption of the inward rectifier Kir6.1. Nat Med. 2002; 8: 466–472.[CrossRef][Medline] [Order article via Infotrieve]

19. Chutkow WA, Pu J, Wheeler MT, Wada T, Makielski JC, Burant CF, McNally EM. Episodic coronary artery vasospasm and hypertension develop in the absence of Sur2 K(ATP) channels. J Clin Invest. 2002; 110: 203–208.[CrossRef][Medline] [Order article via Infotrieve]

20. Solway J, Seltzer J, Samaha FF, Kim S, Alger LE, Niu Q, Morrisey EE, Ip HS, Parmacek MS. Structure and expression of a smooth muscle cell-specific gene, SM22 alpha. J Biol Chem. 1995; 270: 13460–13469.[Abstract/Free Full Text]

21. Chutkow WA, Samuel V, Hansen PA, Pu J, Valdivia CR, Makielski JC, Burant CF. Disruption of Sur2-containing K(ATP) channels enhances insulin-stimulated glucose uptake in skeletal muscle. Proc Natl Acad Sci U S A. 2001; 98: 11760–11764.[Abstract/Free Full Text]

22. Ray JL, Leach R, Herbert JM, Benson M. Isolation of vascular smooth muscle cells from a single murine aorta. Methods Cell Sci. 2001; 23: 185–188.[CrossRef][Medline] [Order article via Infotrieve]

23. Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch. 1981; 391: 85–100.[CrossRef][Medline] [Order article via Infotrieve]

24. Wheeler MT, Allikian MJ, Heydemann A, Hadhazy M, Zarnegar S, McNally EM. Smooth muscle cell-extrinsic vascular spasm arises from cardiomyocyte degeneration in sarcoglycan-deficient cardiomyopathy. J Clin Invest. 2004; 113: 668–675.[CrossRef][Medline] [Order article via Infotrieve]

25. Li L, Miano JM, Mercer B, Olson EN. Expression of the SM22alpha promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visceral smooth muscle cells. J Cell Biol. 1996; 132: 849–859.[Abstract/Free Full Text]

26. Moessler H, Mericskay M, Li Z, Nagl S, Paulin D, Small JV. The SM 22 promoter directs tissue-specific expression in arterial but not in venous or visceral smooth muscle cells in transgenic mice. Development. 1996; 122: 2415–2425.[Abstract]

27. Yoshida H, Feig JE, Morrissey A, Ghiu IA, Artman M, Coetzee WA. K ATP channels of primary human coronary artery endothelial cells consist of a heteromultimeric complex of Kir6.1, Kir6.2, and SUR2B subunits. J Mol Cell Cardiol. 2004; 37: 857–869.[CrossRef][Medline] [Order article via Infotrieve]

28. Morrissey A, Rosner E, Lanning J, Parachuru L, Dhar Chowdhury P, Han S, Lopez G, Tong X, Yoshida H, Nakamura TY, Artman M, Giblin JP, Tinker A, Coetzee WA. Immunolocalization of KATP channel subunits in mouse and rat cardiac myocytes and the coronary vasculature. BMC Physiol. 2005; 5: 1.[CrossRef][Medline] [Order article via Infotrieve]

29. Schnitzler MM, Derst C, Daut J, Preisig-Muller R. ATP-sensitive potassium channels in capillaries isolated from guinea-pig heart. J Physiol. 2000; 525 (pt 2): 307–317.[Abstract/Free Full Text]

30. Sakura H, Ammala C, Smith PA, Gribble FM, Ashcroft FM. Cloning and functional expression of the cDNA encoding a novel ATP-sensitive potassium channel subunit expressed in pancreatic beta-cells, brain, heart and skeletal muscle. FEBS Lett. 1995; 377: 338–344.[CrossRef][Medline] [Order article via Infotrieve]

31. Zhou M, Tanaka O, Sekiguchi M, Sakabe K, Anzai M, Izumida I, Inoue T, Kawahara K, Abe H. Localization of the ATP-sensitive potassium channel subunit (Kir6. 1/uK(ATP)-1) in rat brain. Brain Res Mol Brain Res. 1999; 74: 15–25.[Medline] [Order article via Infotrieve]

32. Thomzig A, Pruss H, Veh RW. The Kir6.1-protein, a pore-forming subunit of ATP-sensitive potassium channels, is prominently expressed by giant cholinergic interneurons in the striatum of the rat brain. Brain Res. 2003; 986: 132–138.[CrossRef][Medline] [Order article via Infotrieve]

33. Pocai A, Lam TK, Gutierrez-Juarez R, Obici S, Schwartz GJ, Bryan J, Aguilar-Bryan L, Rossetti L. Hypothalamic K(ATP) channels control hepatic glucose production. Nature. 2005; 434: 1026–1031.[CrossRef][Medline] [Order article via Infotrieve]

34. Pountney DJ, Sun ZQ, Porter LM, Nitabach MN, Nakamura TY, Holmes D, Rosner E, Kaneko M, Manaris T, Holmes TC, Coetzee WA. Is the molecular composition of K(ATP) channels more complex than originally thought? J Mol Cell Cardiol. 2001; 33: 1541–1546.[CrossRef][Medline] [Order article via Infotrieve]

35. Kuo L, Chancellor JD. Adenosine potentiates flow-induced dilation of coronary arterioles by activating KATP channels in endothelium. Am J Physiol. 1995; 269: H541–H549.[Medline] [Order article via Infotrieve]

36. Gendron ME, Thorin E, Perrault LP. Loss of endothelial KATP channel-dependent, NO-mediated dilation of endocardial resistance coronary arteries in pigs with left ventricular hypertrophy. Br J Pharmacol. 2004; 143: 285–291.[CrossRef][Medline] [Order article via Infotrieve]

37. Cohen RA. Platelet-induced neurogenic coronary contractions due to accumulation of the false neurotransmitter, 5-hydroxytryptamine. J Clin Invest. 1985; 75: 286–292.[CrossRef][Medline] [Order article via Infotrieve]

38. Cohen RA. Role of autonomic nerves and endothelium in coronary vasospasm. Prog Clin Biol Res. 1986; 219: 353–362.[Medline] [Order article via Infotrieve]

39. Yasue H, Touyama M, Shimamoto M, Kato H, Tanaka S. Role of autonomic nervous system in the pathogenesis of Prinzmetal’s variant form of angina. Circulation. 1974; 50: 534–539.[Abstract/Free Full Text]

40. Mori H, Chujo M, Tanaka E, Yamakawa A, Shinozaki Y, Mohamed MU, Nakazawa H. Modulation of adrenergic coronary vasoconstriction via ATP-sensitive potassium channel. Am J Physiol. 1995; 268: H1077–H1085.[Medline] [Order article via Infotrieve]

41. Tanaka E, Mori H, Chujo M, Yamakawa A, Mohammed MU, Shinozaki Y, Tobita K, Sekka T, Ito K, Nakazawa H. Coronary vasoconstrictive effects of neuropeptide Y and their modulation by the ATP-sensitive potassium channel in anesthetized dogs. J Am Coll Cardiol. 1997; 29: 1380–1389.[Abstract]

42. Burgdorf C, Dendorfer A, Kurz T, Schomig E, Stolting I, Schutte F, Richardt G. Role of neuronal KATP channels and extraneuronal monoamine transporter on norepinephrine overflow in a model of myocardial low flow ischemia. J Pharmacol Exp Ther. 2004; 309: 42–48.[Abstract/Free Full Text]

43. Thomas GD, Hansen J, Victor RG. ATP-sensitive potassium channels mediate contraction-induced attenuation of sympathetic vasoconstriction in rat skeletal muscle. J Clin Invest. 1997; 99: 2602–2609.[Medline] [Order article via Infotrieve]

44. Miki T, Liss B, Minami K, Shiuchi T, Saraya A, Kashima Y, Horiuchi M, Ashcroft F, Minokoshi Y, Roeper J, Seino S. ATP-sensitive K+ channels in the hypothalamus are essential for the maintenance of glucose homeostasis. Nat Neurosci. 2001; 4: 507–512.[Medline] [Order article via Infotrieve]


Related Article:

A New Insight Into the Pathogenesis of Coronary Vasospasm
Hiroshi Hibino and Yoshihisa Kurachi
Circ. Res. 2006 98: 579-581. [Extract] [Full Text] [PDF]



This article has been cited by other articles:


Home page
J Am Coll CardiolHome page
L. J. Shaw, R. Bugiardini, and C. N. B. Merz
Women and ischemic heart disease: evolving knowledge.
J. Am. Coll. Cardiol., October 20, 2009; 54(17): 1561 - 1575.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. Stoller, P. Pytel, S. Katz, J. U. Earley, K. Collins, J. Metcalfe, R. M. Lang, and E. M. McNally
Impaired exercise tolerance and skeletal muscle myopathy in sulfonylurea receptor-2 mutant mice
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2009; 297(4): R1144 - R1153.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. Adebiyi, E. M. McNally, and J. H. Jaggar
Sulfonylurea Receptor-Dependent and -Independent Pathways Mediate Vasodilation Induced by ATP-Sensitive K+ Channel Openers
Mol. Pharmacol., September 1, 2008; 74(3): 736 - 743.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Farzaneh and A. Tinker
Differences in the mechanism of metabolic regulation of ATP-sensitive K+ channels containing Kir6.1 and Kir6.2 subunits
Cardiovasc Res, September 1, 2008; 79(4): 621 - 631.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
C. J. Pepine
Provoked Coronary Spasm and Acute Coronary Syndromes
J. Am. Coll. Cardiol., August 12, 2008; 52(7): 528 - 530.
[Full Text] [PDF]


Home page
Circ. Res.Home page
M. A. Burke, R. K. Mutharasan, and H. Ardehali
The Sulfonylurea Receptor, an Atypical ATP-Binding Cassette Protein, and Its Regulation of the KATP Channel
Circ. Res., February 1, 2008; 102(2): 164 - 176.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. P. Dzeja, P. Bast, D. Pucar, B. Wieringa, and A. Terzic
Defective Metabolic Signaling in Adenylate Kinase AK1 Gene Knock-out Hearts Compromises Post-ischemic Coronary Reflow
J. Biol. Chem., October 26, 2007; 282(43): 31366 - 31372.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
B. Malester, X. Tong, I. Ghiu, A. Kontogeorgis, D. E. Gutstein, J. Xu, K. D. Hendricks-Munoz, and W. A. Coetzee
Transgenic expression of a dominant negative KATP channel subunit in the mouse endothelium: effects on coronary flow and endothelin-1 secretion
FASEB J, July 1, 2007; 21(9): 2162 - 2172.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
W. Shi, N. Cui, Y. Shi, X. Zhang, Y. Yang, and C. Jiang
Arginine vasopressin inhibits Kir6.1/SUR2B channel and constricts the mesenteric artery via V1a receptor and protein kinase C
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2007; 293(1): R191 - R199.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Jawaid, T. ur Rehman, and D. K. Rohra
Regulation of Human Coronary Vascular Tone: Further Evidence Must Be Sought Before Ruling Out the Direct Role of ATP-Sensitive Potassium Channels in Regulation of Coronary Vasculature
Circ. Res., May 26, 2006; 98(10): e73 - e73.
[Full Text] [PDF]


Home page
Circ. Res.Home page
H. Hibino and Y. Kurachi
A New Insight Into the Pathogenesis of Coronary Vasospasm
Circ. Res., March 17, 2006; 98(5): 579 - 581.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
98/5/682    most recent
01.RES.0000207498.40005.e7v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kakkar, R.
Right arrow Articles by McNally, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kakkar, R.
Right arrow Articles by McNally, E. M.
Related Collections
Right arrow Arrythmias-basic studies
Right arrow Other Vascular biology
Right arrowRelated Article