Molecular Medicine |
From the Department of Medical Biochemistry and Microbiology (A.L., K.R.), University of Uppsala, Sweden; and the Department of Biomedicine (A.B., T.N., R.K.R.), Division of Physiology, University of Bergen, Norway.
Correspondence to Prof Kristofer Rubin, Department of Medical Biochemistry and Microbiology, University of Uppsala, BMC Box 582, SE-751 23 Uppsala, Sweden. E-mail Kristofer.Rubin{at}imbim.uu.se
| Abstract |
|---|
|
|
|---|
Vß3 integrin blocked the ability of PDGF-BB to normalize the lowered PIF resulting from mast cell degranulation. PDGF-BB was unable to normalize PIF lowered as a result of mast cell degranulation in ß3-negative mice. Monoclonal antiß3 integrin IgG had no effect on PIF in normal mouse dermis. In contrast, administration of antiß1 integrin IgM lowered PIF in normal dermis but had no effect on PDGF-BBinduced normalization of PIF after anaphylaxis. Furthermore, collagen gel contraction mediated by wild-type mouse embryonal fibroblasts were only marginally affected by function-blocking antiß1 integrin antibodies, especially in the presence of PDGF-BB. In contrast, contraction mediated by
V-negative mouse embryonic fibroblasts was completely blocked by antiß1 integrin antibodies, even after stimulation with PDGF-BB. These results show a previously unrecognized in vivo function for the
Vß3 integrin, as a participant in the control of PIF during inflammatory reactions. Furthermore, our data demonstrate that PDGF-BB induces connective tissue cells to generate tensile forces via
Vß3 during such reactions.
Key Words: anaphylaxis
V integrins collagen gel contraction edema fluid homeostasis
| Introduction |
|---|
|
|
|---|
Injection of antiß1 integrin IgG in rat dermis lowers PIF and leads to rapid edema formation.3 Monoclonal IgG specific for the collagen/laminin-binding integrin
2ß1, but not monoclonal anti-
1ß1 IgG, induces a reduction in PIF in rat dermis, suggesting that
2ß1 is of particular importance among the ß1 integrins. Several proinflammatory mediators such as interleukin (IL)-1ß, tumor necrosis factor-
, IL-6, and the prostaglandins (PGs) E1 and I2, as well as the phosphatidyl inositol 3-kinase (PI3K) inhibitor Wortmannin, all act to reduce dermal PIF.2,46 A reduced PIF, resulting from blockade of ß1 integrin function or inflammatory reactions can be normalized by a prostaglandin F analog and by platelet-derived growth factor (PDGF)-BB, but not PDGF-AA or fibroblast growth factor.5,7 By using mice with a knockout lesion for PDGFß receptorinduced activation of PI3K, we demonstrated that the normalization of PIF that normally can be induced by PDGF-BB was completely abolished. Consequently, PI3K is necessary to induce the PIF-normalizing effects of PDGF-BB.8 We have proposed a model for how connective tissue cells participate in the control of PIF. According to this model, connective tissue cells, ie, fibrocytes and/or pericytes, exert a tension on the collagen/microfibrillar network via integrins, eg,
2ß1.2,9,10 This collagen/microfibrillar network in turn restrains the intrinsic swelling properties of the hyaluronan/proteoglycan ground substance of the extracellular matrix (ECM).11 If the ground substance is allowed to swell, PIF will be reduced and if fluid is supplied by an intact blood circulation edema will form. Conversely, an increased cellular tension will increase PIF and filter fluid back across the capillaries or into the lymphatics.
Fibroblast-mediated collagen gel contraction12 depends on ß1 integrins and is stimulated by PDGF.1315 PDGF-BBstimulated collagen gel contraction is mediated by
Vß3 integrins in experimental conditions when ß1 integrins are absent or functionally perturbed.16,17 Furthermore, forced expression of the
V subunit in human osteosarcoma cells that lack endogenous expression of the collagen-binding integrin
2ß1 promotes collagen gel contraction by these cells.18 These findings are consistent with an earlier report suggesting that the
Vß3 integrin, under certain conditions, may function as a collagen receptor that mediates collagen gel contraction.19 Consistent similarities in the control of cell-mediated collagen-gel contraction in vitro and PIF and edema formation in vivo have been observed.35,7,8 Against this background, it seemed reasonable to hypothesize that
Vß3 integrins are involved in PDGF-BBdirected control of PIF in vivo. The present study was performed to test this hypothesis.
| Materials and Methods |
|---|
|
|
|---|
PCR Analysis
Three-primer PCR was performed to genotype mouse tail DNA samples for screening the ß3 integrin genotype. Common forward primer 1 (5' CTTAGACACCTGCTACGGGC 3') lay 5' of the pgk-neo cassette; reverse primer 2 (5' CACGAGACTAGTGAGACGTG 3') was neo specific and reverse primer 3 (5' CCTGCCTGAGGCTGAGTG 3') was wild-type specific. The PCR conditions (95°C, 10 minutes; followed by 30 cycles of 95°C, 1 minute; 66°C, 2 minutes; 72°C, 2 minutes; and finally 72°C, 10 minutes) yielded products of 538 bp (mutant) and 446 bp (wild-type).
Collagen Gel Contraction
Mouse embryonic fibroblasts were established by standard protocols22 from embryonic day (E) 9 to E10 integrin
V-negative and wild-type littermate embryos.23 Cells were grown in DMEM supplemented with 10% FBS and antibiotics in culture dishes and flasks precoated overnight at &8°C with 50 µg/mL native collagen (Vitrogen 100, Cohesion, Palo Alto, Calif) in PBS. Collagen gel contraction was quantified as described elsewhere.14 Briefly, 96-well plates were blocked in BSA overnight at 37°C and then washed in PBS. A collagen solution was made up from 5 parts double-concentrated DMEM, 1 part 0.2 mol/L HEPES (pH 8.0), and 4 parts collagen type I (Vitrogen 100, 3 mg/mL). Cells were washed 2 times in DMEM and diluted to a final concentration of 106 cells/mL in the same medium. One part cell suspension was mixed with 9 parts collagen solution. Cell-collagen suspension (100 µL) was added to each well, and gels were allowed to form for 1.5 hour at 37°C. Gels were detached by the ejection of 100 µL of DMEM, with or without 50 ng/mL PDGF-BB and with or without 800 µg/mL polyclonal anti-rat integrin ß1 IgG24 into the wells. The relaxed, floating gels were further incubated at 37°C and gel diameters were measured microscopically at the indicated time points. The degree of contraction is presented as the gel area as a percentage of the original area. Each experiment was performed with a minimum of 3 samples per condition.
PIF Measurements
PIF was measured using sharpened glass capillaries (tip diameter, 3 to 5 µm) filled with 0.5 mol/L NaCl colored with Evans Blue and connected to a servocontrolled counterpressure system.25,26 The punctures were performed through intact skin using a stereomicroscope (Wild M5, Heerbrugg, Switzerland) with the pipette tip located 0.3 to 0.5 mm below the skin. Care was taken not to cause any compression or retraction of the skin while puncturing. The animal was placed in a supine position and the left hind paw was carefully fixed to the table with surgical tape. Control PIF was measured with the circulation still intact. C48/80 (200 µg, Sigma, St Louis, Mo) in 0.1 mL of 0.9% NaCl was injected IV and allowed to circulate for 2 minutes before circulatory arrest was induced. C48/80 causes a reduction of the PIF through degranulation of mast cells. Circulatory arrest was induced to prevent a potential underestimation of the lowered PIF caused by an increase in interstitial fluid volume as a result of increased transcapillary fluid flux. The lowering of the PIF was monitored for 30 minutes and test substances were then injected subdermally in a volume of 1 µL of buffer (0.14 mol/L NaCl, 4.7 mmol/L KCl, 0.65 mmol/L MgSO4, 1.2 mmol/L CaCl2, 10 mmol/L HEPES, pH 7.4) using a 10-µL chromatography syringe (Hamilton, Bonaduz, Switzerland) with a 33- or 34-gauge needle. Measurements were then continued for another 60 minutes. Test substances used were PDGF-BB, anti-rat integrin ß1 (Ha2/5) monoclonal IgM (BD Pharmingen, San Diego, Calif), anti-mouse integrin ß3 (HMß3) monoclonal IgG (BD Pharmingen), and cyclo (Arg-Gly-Asp-D-Phe-Val) (Bachem, Bubendorf, Switzerland). The test substances were administered either separately or in combination. The pressure measurements were averaged in the following periods: 0 to 10, 11 to 20, 21 to 30, 31 to 40, 41 to 50, 51 to 60, 61 to 75, and 76 to 90 minutes after C48/80 injection. For a measurement to be accepted, the following criteria had to be fulfilled: (1) feedback gain could be changed without changing the pressure; (2) applying suction to the pipette by the pump increased the resistance in the pipette (this ensured contact between the pipette and the interstitial fluid, ie, the pipette was open); and (3) zero pressure did not change during the measurement.
PDGF-BB in Serum and Tissue
Eight wild-type BALB/c mice were anesthetized with an SC injection of 0.2 mL Ketalar/Dormicum and supplied with a catheter in the right jugular vein. The mice received an IV injection of 0.1 mL of NaCl (control, n=4) or 0.1 mL 200 µg C48/80 (experiment, n=4). Blood samples were obtained via the intravenous catheter or heart puncture 2 minutes later. Circulatory arrest was then induced by an IV injection of saturated KCl and the skin on one hind paw was removed. Blood (&200 µL) was immediately added to 200 µL of 3.8% citrate buffer containing 0.1 mol/L benzamidine, 103 U/mL Trasylol, and protease inhibitors (Complete, Roche Diagnostics, Mannheim, Germany). The mixture was centrifuged at 3000g for 20 minutes in a centrifuge without a brake. The skin samples (&100 mg) were minced with a scalpel and placed into tubes containing 200 µL of extraction buffer (50 mmol/L Tris-HCl pH 7.4, 5 mmol/L EDTA, 1% NP-40, 1% Na-deoxycholate, 50 mmol/L NaF, 50 mmol/L ß-glycerophosphate and protease inhibitors [Complete, Roche Diagnostics]) for 24 hours. Tissue samples were freeze thawed twice during this period. PDGF-BB was determined in the supernatants of serum and tissue extracts using a Mouse/Rat PDGF-BB Immunoassay (R&D Systems, Minneapolis, Minn). The procedure described in the kit was followed and Calibrator diluent RD63 was used to dilute the samples. The detection limit for the assay given by the manufacturer was 7.7 pg/mL (range 4.0 to 19.3 pg/mL).
Statistical Analysis
All values are mean±SD. Data were recorded for each 10-minute period within each experimental group up to 60 minutes and thereafter in 15 minutes periods. Each experimental group was compared for control and 21 to 30 minutes and 51 to 60 minutes using 1-way ANOVA followed by post hoc Bonferroni and StudentNewmanKeul tests. A value of P<0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
|
The reduction of PIF in mouse dermis resulting from systemic administration of C48/80 is reversed by a local instilment of PDGF-BB (Figure 1 and the Table) as previously reported.8 The PIF-normalizing effect of 0.2 ng PDGF-BB was not affected in C57BL/6 mouse dermis by simultaneous instilment of 0.9 µg of monoclonal antiß1 integrin IgM (Figure 1 and the Table). Instilment of 0.25 µg of antiß3 integrin IgG, together with the PDGF-BB, however, abolished the capability of the latter to normalize PIF (Figure 1 and the Table). Furthermore, the PIF normalizing effect of PDGF-BB was abolished when it was instilled together with 500 µmol/L of the cyclic
Vß3 inhibitor cyclo (Arg-Gly-Asp-D-Phe-Val) in a volume of 1 µL (Figure 1 and the Table). The IC50 of this peptide for inhibition of 125I-vitronectin binding to immobilized recombinant
Vß3 integrin is 24 nmol/L and 2000 nmol/L for
Vß5,27 and in the range of 0.6 to 4.4 µmol/L for
Vß3 and >100 µmol/L for
5ß1-mediated cell adhesion.28 The test substance was injected at some distance from the site where the micropuncture needle was inserted, leading to at least a 20-fold dilution of the test substance during its diffusion to the tissue segment in which the PIF was recorded. Thus, the effective concentration of the inhibitor can be calculated to be <25 µmol/L in the present experiments, suggesting that the effect of the inhibitor on PIF is caused by blockage of
Vß3 and not
5ß1.
|
To further investigate the possibility that the PIF-normalizing effect of PDGF-BB in mouse dermis was dependent on ß3 integrins, we took advantage of ß3-deficient mice.20 These mice carry a null mutation of the ß3 integrin gene but are fertile and develop normally, except for disturbances of platelet and osteoclast functions leading to thrombastenia20 and osteosclerosis.21 Systemic administration of C48/80 in wild-type and ß3 null BALB/c mice reduced dermal PIF (Figure 2 and the Table). Local instilment of PDGF-BB normalized the reduced PIF in wild-type, but not in the dermis of ß3 integrin null, mice (Figure 2 and the Table). Together, our results strongly suggest that PDGF-BB acts on ß3, but not on ß1, integrins during the restoration of a normal dermal PIF that had been reduced by mast cell degranulation.
|
To validate the in vivo data suggesting a role of the
Vß3 integrin in contractile processes, we took advantage of mouse embryonic fibroblasts (MEF) isolated from
V-negative mice23 and compared the ability of these cells to contract collagen gels in vitro with wild-type MEF. Wild-type and
V-negative MEF both contracted collagen gels (Figure 3A and 3B). Collagen-gel contraction mediated by the
V-negative cells was completely inhibited by antiß1 integrin IgG, whereas the same IgG was unable to completely inhibit the contraction mediated by wild-type MEF (Figure 3A). PDGF-BB only marginally stimulated contraction by the wild-type MEF, but restored the ability of these cells to contract collagen gels in the presence of antiß1 integrin IgG (Figure 3B). The latter effect of PDGF-BB, ie, to partly override the blockade by antiß1 integrin IgG was not observed in
V-negative MEF (Figure 3B). These findings demonstrate that PDGF-BB stimulates contractile process in vitro by a process that depends on
V integrins.
|
| Discussion |
|---|
|
|
|---|
The present study was performed to further elucidate the events in the connective tissue cells associated with the lowering of PIF. In particular, we have investigated the phenomenon that the lowering of PIF can be reversed, ie, the capillary net filtration pressure normalized by PDGF-BB.7,8 The present study demonstrates that ß3 integrins are necessary for this effect of PDGF-BB. The ß3 integrin subunit associates with the
IIb and
V integrin subunits to form 2 RGD-directed integrins.29 Because the expression of
IIbß3 is restricted to megakaryocytes and platelets, it may be inferred that the ß3 integrindependent effect on PIF is mediated by the integrin
Vß3. Although a subdermal injection of PDGF-BB into naive dermis does not change PIF, PDGF-BB is able to normalize PIF that has been lowered after mast cell degranulation or blockade of ß1 integrins.7,8 Similarly, PIF is not affected by perturbation of
Vß3 integrin function in naive dermis and PIF is normal in undisturbed dermis of ß3-null mice (present findings). In order for PDGF-BB to normalize PIF after anaphylaxis, ß3 must be unperturbed (present findings). Our data thus provide evidence that PDGF-BBdirected usage of
Vß3 for control of PIF occurs only after induction of anaphylaxis or perturbation of ß1 integrin function. A role for
Vß3 in concert with PDGF in counteracting edema formation during inflammation is consistent with the reported upregulation of activated PDGFß receptors3033 and
Vß334 in various inflammatory conditions. Based on the present findings, it is proposed that these receptors at least partly protect the inflamed tissue from the adverse effects of the inflammatory response on tissue integrity.
The tissue concentration of PDGF-BB is not known and we could not detect PDGF-BB in plasma or dermal extracts neither from normal mice nor during the acute phase of anaphylaxis (data not shown). The detection limit for the assay used was 7.7 pg/mL. In a previous immunohistochemical study, we reported that, in normal human skin, PDGF-AB/BB is confined to peripheral nerve fibers and to solitary cells of the epidermis and of the superficial dermis.31 PDGF-BB is believed to act in a paracrine fashion where the producer cell delivers the growth factor in intercellular contacts.35 The local concentration in these contacts is likely to be high. In the present experimental system, we injected 0.2 ng of PDGF-BB that diffused to the site where PIF was measured. Although the PDGF-BB became diluted during the diffusion, the cells at this site were exposed to a PDGF-BB concentration higher than what is likely to be present overall in normal dermis. In spite of this, we consider our experimental system physiologically relevant because the endogenous PDGF-BB is likely to have its effects locally and then in relatively high concentrations, as discussed above. It can be anticipated that during an acute systemic anaphylaxis that is a lethal condition the
Vß3-directed control of PIF stimulated by endogenous PDGF BB is insufficient to counteract edema formation. Rather, the presently described edema-counteracting system involving PDGF-BB and
Vß3 is likely to be relevant during later phases of anaphylaxis and acute inflammation. In line with this is previously reported data showing that during wound healing, as well as in carcinoma and inflammatory lesions, PDGF-AB/BB is upregulated and also detected in infiltrating macrophages and vascular cells.31,32,35
The injection into a tissue, with or without adding a substance or protein normally present or not, will inflict a trauma to the tissue. In the present study, as well as previous studies on the control of PIF, we have made several attempts to control for the injection trauma as such, including vascular reactions with mobilization of leukocytes, as well as to validate the effect of the specificity of the injected protein. Although there is an effect of the injection trauma, it has never been observed that injection of saline or unspecific proteins including nonspecific IgG elicits a lowering of PIF.2 In contrast, IgG, cytokines, and other agents that modulate collagen gel contraction in vitro also has an in vivo action on PIF.35,7,8 Because we have demonstrated parallel effects of a number of substances in in vivo experiments and in fibroblast-mediated collagen gel contraction in vitro, we have used the latter system as a model for PIF control in vivo. We show here that mouse embryonic fibroblasts lacking
V integrins, exclusively depended on ß1 integrins to contract collagen gels even when the cells were stimulated by PDGF-BB. Wild-type fibroblasts, in contrast, contracted collagen gels when ß1 integrins were blocked, and this contraction was stimulated by PDGF-BB. These findings show that
Vß3 is necessary for collagen-gel contraction when ß1 integrins are blocked and that this process is stimulated by PDGF-BB. Several reports have shown that under certain conditions the
Vß3 integrin is able to mediate collagen gel contraction in vitro.1619 Many inflammatory agents, including PGE15 and IL-1ß,6 induce a reduction in PIF in normal dermis and inhibit cell-mediated collagen gel contraction. The inhibitory effects on collagen gel contraction by both these agents can at least partly be overcome by stimulation with PDGF-BB.5,15 Further studies will be needed to investigate the hypothesis that these proinflammatory agents block ß1 integrins but allow PDGF-BB stimulated
Vß3-mediated collagen-gel contraction in vitro and control of PIF in vivo.
The ligand for
Vß3 that is involved in PIF control in vivo is not defined and candidates include the collagen type I fibers and microfibrils.36 Available data suggest that native triple helical interstitial collagens are not recognized by the RGD-directed integrin
Vß3.37 The nature of the PDGF-BBstimulated cellcollagen interaction mediated by
Vß3 that is needed for collagen gel contraction in vitro and potentially in vivo is therefore not apparent. Further studies are needed to characterize the in vivo ECM ligand that is recognized by
Vß3 and functions to restrain dermal tissue swelling. Regardless of the ECM ligand that is recognized by
Vß3 in connective tissues and/or in collagen gels in vitro, the fact that stimulation with PDGF-BB was needed for
Vß3-mediated contraction in vitro and in vivo suggests a requirement for activation of the integrin through inside-out signaling.29 Such activation involves affinity modulation by conformational changes of the integrin.38,39 PDGF-BBregulated activation of
Vß3 may thus be a suitable target for the development of pharmaceutical agents for the treatment of uncontrolled edema, eg, in septic shock.
In conclusion, the results from this study support the hypothesis that PDGF-BB counteracts a tendency to form edema by stimulating the activity of
Vß3-integrins. Furthermore, our data suggest that under normal conditions, tension between connective tissue cells and the dermal fibers is maintained by ß1-integrinmediated contraction. Proinflammatory mediators are likely to block the ß1 integrins, causing a reduction in PIF and edema formation, a process that is opposed by PDGF-BBdirected
Vß3-mediated contraction.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Wiig H, Rubin K, Reed RK. New and active role of the interstitium in control of interstitial fluid pressure: potential therapeutic consequences. Acta Anaesthesiol Scand. 2003; 47: 111121.[CrossRef][Medline] [Order article via Infotrieve]
3. Reed RK, Rubin K, Wiig H, Rodt SÅ. Blockade of ß1-integrins in skin causes edema through lowering of interstitial fluid pressure. Circ Res. 1992; 71: 978983.
4. Åhlen K, Berg A, Stiger F, Tengholm A, Siegbahn A, Gylfe E, Reed RK, Rubin K. Cell interactions with collagen matrices in vivo and in vitro depend on phosphatidylinositol 3-kinase and free cytoplasmic calcium. Cell Adhes Commun. 1998; 5: 461473.[Medline] [Order article via Infotrieve]
5. Berg A, Ekwall AK, Rubin K, Stjernschantz J, Reed RK. Effect of PGE1, PGI2, and PGF2
analogs on collagen gel compaction in vitro and interstitial pressure in vivo. Am J Physiol. 1998; 274: H663H671.[Medline]
[Order article via Infotrieve]
6. Nedrebø T, Berg A, Reed RK. Effect of tumor necrosis factor-
, IL-1ß, and IL-6 on interstitial fluid pressure in rat skin. Am J Physiol. 1999; 277: H1857H1862.[Medline]
[Order article via Infotrieve]
7. Rodt SÅ, Åhlen K, Berg A, Rubin K, Reed RK. A novel physiological function for platelet-derived growth factor-BB in rat dermis. J Physiol (Lond). 1996; 495: 193200.
8. Heuchel R, Berg A, Tallquist M, Åhlen K, Reed RK, Rubin K, Claesson-Welsh L, Heldin C-H, Soriano P. Platelet-derived growth factor ß receptor regulates interstitial fluid homeostasis through phosphatidylinositol-3' kinase signaling. Proc Natl Acad Sci U S A. 1999; 96: 1141011415.
9. Rubin K, Gullberg D, Tomasini-Johansson B, Reed RK, Rydén C, Borg TK. Molecular recognition of the extracellular matrix by cell surface receptors. In: Comper WD, ed. Extracellular Matrix, Volume 2: Molecular Components and Interactions. Reading, UK: Harwood Academic Publishers; 1996: 262309.
10. Reed RK, Berg A, Gjerde EA, Rubin K. Control of interstitial fluid pressure: role of ß1-integrins. Semin Nephrol. 2001; 21: 222230.[CrossRef][Medline] [Order article via Infotrieve]
11. Meyer FA, Laver-Rudich Z, Tanenbaum R. Evidence for a mechanical coupling of glycoprotein microfibrils with collagen fibrils in Whartons jelly. Biochim Biophys Acta. 1983; 755: 376387.[Medline] [Order article via Infotrieve]
12. Grinnell F. Fibroblast biology in three-dimensional collagen matrices. Trends Cell Biol. 2003; 13: 264269.[CrossRef][Medline] [Order article via Infotrieve]
13. Clark RA, Folkvord JM, Hart CE, Murray MJ, McPherson JM. Platelet isoforms of platelet-derived growth factor stimulate fibroblasts to contract collagen matrices. J Clin Invest. 1989; 84: 10361040.[Medline] [Order article via Infotrieve]
14. Gullberg D, Tingström A, Thuresson AC, Olsson L, Terracio L, Borg TK, Rubin K. ß1 integrin-mediated collagen gel contraction is stimulated by PDGF. Exp Cell Res. 1990; 186: 264272.[CrossRef][Medline] [Order article via Infotrieve]
15. Tingström A, Heldin C-H, Rubin K. Regulation of fibroblast-mediated collagen gel contraction by platelet-derived growth factor, interleukin-1
and transforming growth factor-ß1. J Cell Sci. 1992; 102: 315322.
16. Cooke ME, Sakai T, Mosher DF. Contraction of collagen matrices mediated by
2ß1A and
Vß3 integrins. J Cell Sci. 2000; 113: 23752383.[Abstract]
17. Grundström G, Mosher DF, Sakai T, Rubin K. Integrin
Vß3 mediates platelet-derived growth factor-BB-stimulated collagen gel contraction in cells expressing signaling deficient integrin
2ß1. Exp Cell Res. 2003; 291: 463473.[CrossRef][Medline]
[Order article via Infotrieve]
18. Levinson H, Hopper JE, Ehrlich HP. Overexpression of integrin
V promotes human osteosarcoma cell populated collagen lattice contraction and cell migration. J Cell Physiol. 2002; 193: 219224.[CrossRef][Medline]
[Order article via Infotrieve]
19. Agrez MV, Bates RC, Boyd AW, Burns GF. Arg-Gly-Asp-containing peptides expose novel collagen receptors on fibroblasts: implications for wound healing. Cell Regul. 1991; 2: 10351044.[Medline] [Order article via Infotrieve]
20. Hodivala-Dilke KM, McHugh KP, Tsakiris DA, Rayburn H, Crowley D, Ullman-Cullere M, Ross FP, Coller BS, Teitelbaum S, Hynes RO. ß3-integrin-deficient mice are a model for Glanzmann thrombasthenia showing placental defects and reduced survival. J Clin Invest. 1999; 103: 229238.[Medline] [Order article via Infotrieve]
21. McHugh KP, Hodivala-Dilke K, Zheng MH, Namba N, Lam J, Novack D, Feng X, Ross FP, Hynes RO, Teitelbaum SL. Mice lacking ß3 integrins are osteosclerotic because of dysfunctional osteoclasts. J Clin Invest. 2000; 105: 433440.[Medline] [Order article via Infotrieve]
22. Todaro GJ, Green H. Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. J Cell Biol. 1963; 17: 299313.
23. Bader BL, Rayburn H, Crowley D, Hynes RO. Extensive vasculogenesis, angiogenesis, and organogenesis precede lethality in mice lacking all
V integrins. Cell. 1998; 95: 507519.[CrossRef][Medline]
[Order article via Infotrieve]
24. Gullberg D, Terracio L, Borg TK, Rubin K. Identification of integrin-like matrix receptors with affinity for interstitial collagens. J Biol Chem. 1989; 264: 1268612694.
25. Wiederhielm CA, Woodbury JW, Kirk S, Rushmer RF. Pulsatile pressures in the microcirculation of frogs mesentery. Am J Physiol. 1964; 207: 173176.
26. Wiig H, Reed RK, Aukland K. Micropuncture measurement of interstitial fluid pressure in rat subcutis and skeletal muscle: comparison to wick-in-needle technique. Microvasc Res. 1981; 21: 308319.[CrossRef][Medline] [Order article via Infotrieve]
27. Nisato RE, Tille JC, Jonczyk A, Goodman SL, Pepper MS.
Vß3 and
Vß5 integrin antagonists inhibit angiogenesis in vitro. Angiogenesis. 2003; 6: 105119.[CrossRef][Medline]
[Order article via Infotrieve]
28. Srivatsa SS, Fitzpatrick LA, Tsao PW, Reilly TM, Holmes DR Jr, Schwartz RS, Mousa SA. Selective
Vß3 integrin blockade potently limits neointimal hyperplasia and lumen stenosis following deep coronary arterial stent injury: evidence for the functional importance of integrin
Vß3 and osteopontin expression during neointima formation. Cardiovasc Res. 1997; 36: 408428.
29. Hynes RO. Integrins: bidirectional, allosteric signaling machines. Cell. 2002; 110: 673687.[CrossRef][Medline] [Order article via Infotrieve]
30. Rubin K, Tingström A, Hansson GK, Larsson E, Rönnstrand L, Klareskog L, Claesson-Welsh L, Heldin C-H, Fellström B, Terracio L. Induction of B-type receptors for platelet-derived growth factor in vascular inflammation: possible implications for development of vascular proliferative lesions. Lancet. 1988; 1: 13531356.[CrossRef][Medline] [Order article via Infotrieve]
31. Reuterdahl C, Sundberg C, Rubin K, Funa K, Gerdin B. Tissue localization of ß-receptors for platelet-derived growth factor and platelet-derived growth factor B chain during wound repair in humans. J Clin Invest. 1993; 91: 20652075.[Medline] [Order article via Infotrieve]
32. Sundberg C, Ljungström M, Lindmark G, Gerdin B, Rubin K. Microvascular pericytes express platelet-derived growth factor-ß receptors in human healing wounds and colorectal adenocarcinoma. Am J Pathol. 1993; 143: 13771388.[Abstract]
33. Rajkumar VS, Sundberg C, Abraham DJ, Rubin K, Black CM. Activation of microvascular pericytes in autoimmune Raynauds phenomenon and systemic sclerosis. Arthritis Rheum. 1999; 42: 930941.[CrossRef][Medline] [Order article via Infotrieve]
34. Wilder RL. Integrin
Vß3 as a target for treatment of rheumatoid arthritis and related rheumatic diseases. Ann Rheum Dis. 2002; 61 (suppl 2): ii96ii99.
35. Heldin CH, Westermark B. Mechanism of action and in vivo role of platelet-derived growth factor. Physiol Rev. 1999; 79: 12831316.
36. Kielty CM, Shuttleworth CA. Microfibrillar elements of the dermal matrix. Microsc Res Tech. 1997; 38: 413427.[CrossRef][Medline] [Order article via Infotrieve]
37. Davis GE. Affinity of integrins for damaged extracellular matrix:
Vß3 binds to denatured collagen type I through RGD sites. Biochem Biophys Res Commun. 1992; 182: 10251031.[CrossRef][Medline]
[Order article via Infotrieve]
38. Takagi J, Petre BM, Walz T, Springer TA. Global conformational rearrangements in integrin extracellular domains in outside-in and inside-out signaling. Cell. 2002; 110: 599511.[CrossRef][Medline] [Order article via Infotrieve]
39. Springer TA, Wang JH. The three-dimensional structure of integrins and their ligands, and conformational regulation of cell adhesion. Adv Protein Chem. 2004; 68: 2963.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
O.S. Svendsen, M.M. Barczyk, S.N. Popova, A Liden, D. Gullberg, and H. Wiig The {alpha}11{beta}1 Integrin Has a Mechanistic Role in Control of Interstitial Fluid Pressure and Edema Formation in Inflammation Arterioscler Thromb Vasc Biol, November 1, 2009; 29(11): 1864 - 1870. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. S. Svendsen, A. Liden, T. Nedrebo, K. Rubin, and R. K. Reed Integrin {alpha}v{beta}3 acts downstream of insulin in normalization of interstitial fluid pressure in sepsis and in cell-mediated collagen gel contraction Am J Physiol Heart Circ Physiol, August 1, 2008; 295(2): H555 - H560. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Liden, T. van Wieringen, J. Lannergard, A. Kassner, D. Heinegard, R. K. Reed, B. Guss, and K. Rubin A Secreted Collagen- and Fibronectin-binding Streptococcal Protein Modulates Cell-mediated Collagen Gel Contraction and Interstitial Fluid Pressure J. Biol. Chem., January 18, 2008; 283(3): 1234 - 1242. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Popova, M. Barczyk, C.-F. Tiger, W. Beertsen, P. Zigrino, A. Aszodi, N. Miosge, E. Forsberg, and D. Gullberg {alpha}11{beta}1 Integrin-Dependent Regulation of Periodontal Ligament Function in the Erupting Mouse Incisor Mol. Cell. Biol., June 15, 2007; 27(12): 4306 - 4316. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |