Integrative Physiology |
From the Department of Developmental Biology (F.B., S.Z., M.B.), CNRS URA 2578, Pasteur Institute, Paris, France; Developmental Biology Institute of Marseille-Luminy (R.G.K.), CNRS UMR6216, Marseille, France; INSERM U.36 (J.H.), College de France, Paris; Service de Cardiologie Pédiatrique (D.B.), Hôpital Necker-Enfants-Malades AP-HP, Paris, France; and Division of Basic Medical Sciences (N.A.B.), St. Georges, University of London, United Kingdom.
Correspondence to Margaret Buckingham, Department of Developmental Biology, Pasteur Institute, 25 rue du Dr. Roux, 75015 Paris, France. E-mail margab{at}pasteur.fr
| Abstract |
|---|
|
|
|---|
c mutant embryos, where cardiac neural crest cells are present in the heart, PTA and DORV are again associated with a rotation defect. This is also seen in Pitx2
c mutants, which have transposition of the great arteries. Because Pitx2c is involved in leftright signaling, these results suggest that embryonic laterality affects rotation of the myocardial wall during OFT maturation. We propose that failure of normal rotation of OFT myocardium may underlie major forms of congenital heart disease.
Key Words: heart outflow tract Splotch Pitx2 transposition of the great arteries
| Introduction |
|---|
|
|
|---|
As development proceeds, the single OFT undergoes remodeling into separate pulmonary and aortic arteries. This process involves interactions between diverse cell types, including myocardium, endocardium, and neural crest cells.10 Endocardial cells respond to signals from the overlying myocardium and undergo an epithelial-to-mesenchymal transformation to form the conotruncal cushions.11 Neural crest cells, which play an essential role in the normal septation of the heart,12 invade the extracellular matrix of the cushions and participate in aortico-pulmonary septation. In the chick, cardiac neural crest ablation leads to OFT defects including TOF, PTA, DORV, and interrupted aortic arch.13 In the mouse, Splotch mutations, known to result from disruption or deletion of the Pax3 gene, give rise to a similar spectrum of conotruncal defects, secondary to a neural crest cell migration defect.1416 Recently, cardiac neural crest ablation has been shown to affect formation of OFT myocardium from pharyngeal mesoderm.17 Pitx2c mutant mice also have conotruncal defects.18 Pitx2c confers embryonic leftright signaling to asymmetrically developing organs.19 Pitx2c is expressed asymmetrically in pharyngeal mesoderm and has been implicated in patterning of OFT myocardium.20,21
Classic morphological studies of the developing chick heart have shown torsion of the OFT, which, when physically interrupted, leads to malposition of the great arteries.22 Radioactive tattoos of the outflow region further establish that rotation occurs during OFT morphogenesis in the chick embryo.23 Previous studies on human embryos suggested that the OFT undergoes rotation during its remodeling.24 Computerization of distances and angles between major anatomical landmarks, in particular the axis of the semilunar valves, showed that the junction of the OFT and the great arteries undergoes a rapid rotation in a counterclockwise direction, facing downstream, between Carnegie stages 15 and 19.24 In addition, the angle of the aortic to pulmonary valve axis, relative to the inferior surface of congenitally malformed hearts, suggested that TOF, DORV, and TGA may result from an arrested rotation of the outflow region at the base of the great arteries.25,26
We now report a counterclockwise rotation of OFT myocardium in the mouse embryo and examine this phenomenon in mice with OFT defects. A transgenic line, y96-Myf5-nlacZ-16,27 in which ß-galactosidase activity marks a part of OFT myocardium, permits visualization of OFT rotation before, and during, the septation of this region. Di-I tracing experiments in cultured mouse embryos confirm this rotation. Comparison of transgene expression in Splotch and Pitx2
c mutant embryos, which have conotruncal defects, suggests that the abnormal position of the great arteries results from a premature arrest or failure to initiate OFT rotation. These results support the hypothesis that a spectrum of cardiac anomalies with abnormally positioned great arteries may arise from a perturbation of myocardial rotation, in addition to abnormal OFT septation caused by neural crest cell defects. These observations have implications for the understanding of conotruncal abnormalities in human congenital heart defects.
| Materials and Methods |
|---|
|
|
|---|
c (C57BL/6xCBA, F1) mice. The Pitx2
c neo allele has a deletion of the majority of exon 4 including all coding sequences within this exon.20 Pitx2
c mutant embryos were identified by PCR using primers for exon 3 and the neo sequence: 118/exon 3, CTAATATCAGCTACCTGTCCCTGTCACTC; 119/exon 3, CTGGAAGTATCGGAGATTGTATGCACCTC; and 126/neo, CGACGACCTGCAGC CAAGCTAGCT.
Analysis of Transgene Expression
Embryos were staged taking embryonic day (E) 0.5 as the morning of the vaginal plug. Dissection, X-gal staining, and in situ hybridization using an nlacZ antisense probe were performed as described previously.6 Embryos were examined using a Leica ZM20 stereomicroscope or Zeiss Axiophot microscope and photographed with a digital camera (Axiocam-Zeiss).
Embryo Sections and Immunohistochemistry
For immunohistochemistry or counterstaining, sections were incubated as described previously.6 The myosin heavy chain antibody, MF20, was a monoclonal antibody from Developmental Studies Hybridoma Bank, used at 1/200 dilution. The ß-galactosidase antibody was a rabbit polyclonal provided by J. F. Nicolas (Pasteur Institute, Paris, France) used at 1/500 dilution. The smooth muscle actin (SMA) was a monoclonal antibody from Sigma, used at 1/400. Secondary antibodies were goat anti-mouse Alexa 488 or 546 and goat anti-rabbit Alexa 594 used at 1/200 dilution or 1/1000, respectively (Molecular Probes). Sections were photographed using a Zeiss Axiovert microscope with an Axiocam camera (AxioVision 4.4, Zeiss).
Di-I Injection and Mouse Embryo Culture
Di-I labeling at E9.5 was initially performed levolaterally, through the yolk sac, amnion, and pericardial wall, with injection into the myocardium of the OFT, on the left, midway between the aortic sac and the dextral bend in the heart tube, as previously described.6 Two embryos were euthanized immediately to verify the injection site, and the rest cultured for 24 hours. Of 25 live embryos, 8 showed counterclockwise spread of the dye. In a second series of experiments, the technique was refined to permit more precise localization of smaller amounts of dye, by dissecting a "window" through the yolk sac, opening the amnion and pericardium. This method can lead to growth impairment. However, in 10 live embryos with labeled cells, 3 showed counterclockwise relocation of the labeled cells. In this series, 4 embryos were euthanized immediately to verify the injection site.
Corrosion Cast and Scanning Electron Microscopy
Corrosion casts: E17.5 embryos were isolated and the heart exposed by a thoracic incision. Batsons number 17 acrylic (Polysciences) was injected into right and left ventricles until the great arteries were filled. After hardening overnight in distilled water at 4°C, tissues were removed with Maceration Solution at 50°C for 24 hours without a shaking. All samples were mounted on stubs and then sputter-coated with gold. Samples were observed on a Zeiss SM940 scanning electron microscope.
| Results |
|---|
|
|
|---|
|
Rotation of OFT Myocardium
The expression profile of the 96-16 transgene between E9.5 and E12.5 in OFT myocardium shows a counterclockwise rotation during formation of the great arteries. ß-Galactosidase activity, is initially stronger in the right-hand side of the dorsal OFT wall, as seen in whole mount (Figure 2a) and sections (Figure 2e). Subsequently, ß-galactosidasepositive cells are located dorsally (Figure 2b and 2f) and then in the left-hand and ventral part of the tubular OFT (Figure 2c and 2g), before becoming largely confined to the base of the pulmonary trunk (Figure 2d and 2h), as this separates from the aorta during individualization of the great arteries from the OFT. The expression pattern of the transgene is presented schematically in Figure 2a through 2d. These observations suggest that the myocardial wall of the OFT rotates during great artery development and that the 96-16 transgene marks the myocardial component which will contribute to the base of the pulmonary trunk throughout this process. To show that this result does not reflect de novo transgene expression, we analyzed nlacZ transcripts by in situ hybridization between E9.5 and E12.5 (Figure 2i through 2l). nlacZ transcripts are observed at E9.5 and E10.5 (Figure 2i and 2j) but are not detectable subsequently (Figure 2k and 2l), whereas ß-galactosidase activity is still present (Figure 2c, 2d, 2g, and 2h), reflecting the stability of the ß-galactosidase protein compared with that of its mRNA. The changing position of X-gallabeled cells during great artery formation therefore provides a "chase," marking the cells that previously transcribed the transgene. A direct demonstration of OFT rotation comes from Di-I labeling experiments where dye was injected into myocardial cells on the left-hand side of the OFT at E9.5 either through the yolk sac (Figure 3a) or after exteriorization (Figure 3c) (see Materials and Methods). After 24 hours of embryo culture, labeled cells are observed more ventrally, showing that these cells have now changed position (Figure 3b and 3d). This result was observed on 11 of 35 live labeled embryos. Protein and transcript expression from the transgene, together with Di-I labeling experiments, are all consistent with a counterclockwise rotation of the OFT.
|
|
Defects in OFT Rotation in Splotch Embryos
To gain insight into the role of myocardial rotation in OFT remodeling, we examined the expression of the 96-16 transgene in mouse mutants in which this process is defective. Splotch embryos develop defects in the OFT, including PTA and DORV (Table and Figure 4). These conotruncal defects result from failure of the cardiac neural crest to colonize the developing heart in the absence of Pax3.14,16 In Splotch mutant hearts with PTA at E14.5, the transgene is expressed in the left-hand part of the myocardium at the base of the single outflow vessel (Figure 4b and 4b), whereas normally at this stage ß-galactosidase activity is concentrated in a ventral location at the base of the pulmonary trunk (Figure 4a and a). In Splotch mutant hearts with DORV at E15.5, a rotation defect is again observed with ß-galactosidasepositive cells present in the left-hand side of the outflow region, instead of ventrally (Figure 4d compared with 4c). At E11.5, during OFT septation, the transgene is normally expressed on the left side of the OFT (Figure 4e), whereas in the Splotch mutant, ß-galactosidase activity is observed dorsally (Figure 4f, arrowhead), as in wild-type hearts at E10.5 (see Figure 2f). These observations suggest that rotation of the myocardial wall of the OFT is affected at early stages in hearts, giving rise to DORV or PTA and is therefore associated with abnormal positioning of the great arteries and failure of OFT septation.
|
|
Defects of OFT Rotation in Pitx2
c Embryos
All Pitx2
c mutants have OFT anomalies with a majority characterized by abnormal positioning of the great arteries (93%), such as TGA or DORV, whereas 7% present PTA (Table). At E12.5, the aorta is normally positioned dorsally to the pulmonary trunk (Figure 5a), whereas in Pitx2
c mutants with DORV, the aorta is positioned ventrally (Figure 5b). As in the case of Splotch mutants with PTA, we observed 96-16 expression in the left-hand side of the OFT in Pitx2
c mutant hearts with the same defect (Figure 5c and 5d), reinforcing the notion that PTA is associated with a rotation defect.
|
Among the types of malposition of the great arteries observed in Pitx2
c mutants, 70% of embryos have TGA (Table and Figure 6b). Lateral views show that in these cases, the pulmonary trunk is positioned dorsally to the aorta instead of spiraling around it (Figure 6a and 6b). The pulmonary trunk normally emerges from the right ventricle (Figure 6c), whereas in Pitx2
c mutant embryos with TGA, the pulmonary trunk is connected to the left ventricle (Figure 6d). This is referred to as ventriculo-arterial discordance. At E15.5, transgene expression is normally detected at the base of the pulmonary trunk, which lies ventral to the aorta (Figure 6e and 6e). In contrast, in TGA hearts, transgene expression is maintained in myocardium at the base of the pulmonary trunk, now positioned dorso-laterally (Figure 6f and 6f), also indicative of a rotation defect.
|
| Discussion |
|---|
|
|
|---|
c mutant hearts which have similar malformations. In addition, we show that Pitx2
c mutants displaying TGA have a failure of OFT rotation. Thus, the expression profile of the 96-16 transgene in Splotch and Pitx2
c mutants demonstrates that rotation of the myocardial wall of the OFT is disturbed in conotruncal defects such as PTA, DORV, and TGA, suggesting a crucial role for myocardial rotation in positioning of the great arteries. At early stages of OFT development, expression of the 96-16 transgene colocalizes with myocardial markers, and ß-galactosidase continues to be present at the base of the pulmonary trunk at late fetal stages, after nlacZ transcripts have ceased to be detectable. No ß-galactosidasepositive cells are detected in the smooth muscle of the pulmonary trunk. This, together with the sharp boundary of transgene expression at the base of this vessel, is consistent with a retraction of the myocardium23 as the smooth muscle tunic develops.8 Further support for rotation of OFT myocardium in the mouse comes from a clonal analysis,29 which showed oriented cell growth of myocardial cells in different compartments of the heart. A spiraling orientation of clones was observed in the OFT at E10.5, compatible with rotation of the myocardium.30 Labeling of cells in the right-hand side of the pharyngeal mesoderm, which will contribute to OFT myocardium, in the chick embryo resulted in labeled cells on the left side of the OFT, again consistent with rotation.8 Earlier studies on human embryos, based on measurement of distances and angles between major anatomical landmarks, had shown that the junction of the OFT and great arteries undergoes a rotational movement between Carnegie stages 15 and 19.24 Moreover, measurements on embryos with conotruncal defects suggested that this rotation is prematurely arrested at different developmental stages according to the type of malformation.25,26 Our study provides the first direct evidence for such counterclockwise rotation of the OFT in mammalian embryos. The rotation of OFT myocardium in the mouse embryo, as visualized with the 96-16 transgene, begins at E9.5, equivalent to Carnegie stage 11, whereas rotation has been documented from Carnegie stage 15 in humans. This may reflect the sensitivity of transgene detection compared with physical measurements. Most of the myocardium has been added to the mouse OFT by E9.5, suggesting that the OFT first elongates and then rotates.
Rotation of the myocardial wall of the OFT is integrated into the remodeling process of the outflow region, which is intimately linked to the influx of neural crest. Splotch mutant mice develop OFT defects, including PTA and DORV,15,31 as a result of reduced colonization of the OFT by cardiac neural crest cells.14,16 Our study demonstrates that rotation of the OFT myocardial wall is prematurely arrested in Splotch embryos. This precedes OFT septation, a process dependent on neural crest cells that guide the organization of the endocardial cushions.11 Because we have never detected Pax3 expression in OFT myocardium, including in Pax3nlacZ/+ mice in which the heart is ß-galactosidase negative,32 the reduction of cardiac neural crest in Splotch mutant embryos may indirectly influence the process of OFT rotation. Moreover, rotation is observed from E9.5, when neural crest cells first invade this region.14,33 The rotation defect supports the conclusion that OFT development requires extensive cross-talk between neural crest and myocardial cells.17,34 However, this is not the only factor that leads to defective OFT rotation associated with PTA, because it is also seen in the 7% of hearts with this malformation in Pitx2
c mutants where cardiac neural crest migration appears to occur normally.20 These findings show that abnormal septation, secondary to a neural crest cell defect,9 is not the only cause of PTA, which we show is associated with a rotation defect.
Ablation of cardiac neural crest in the chick embryo induces a large spectrum of malformations affecting the OFT region but not TGA.13 This malformation probably has multiple causes, as evidenced by the Perlecan mouse, which has an extracellular matrix defect,35 or by retinoic acid treatments, which induce endocardial cushion defects.36 As seen here for Pitx2
c, mutations in genes that affect leftright asymmetry, such as cryptic or type IIB activin receptor can also lead to TGA.19,37,38 Our observations on Pitx2
c mutant embryos suggest that this malformation can be induced by a laterality defect affecting rotation of the myocardial wall of the OFT. This may result from an earlier effect on OFT myocardial precursors in the anterior heart field,3 where cells express Pitx2c and are perturbed in its absence.20 Leftright signaling may also exert its effect via the myocardium itself, because misexpression of Pitx2 in the embryonic heart correlates with abnormal OFT development.39 Whatever the underlying cause, our results suggest that arrested rotation of OFT myocardium is related to TGA in the absence of Pitx2
c. The fact that this phenomenon is also associated with PTA and DORV probably reflects underlying complexity in the cell populations and stages affected in the Pitx2
c mutant, leading to a spectrum of abnormalities during OFT remodeling.
Rotation of the myocardium at the base of the OFT is probably essential to achieve normal positioning of the great arteries with respect to each other at the ventriculo-arterial junction. Indeed, the spiraling movement of the aortico-pulmonary septum, which generates specific ventriculo-arterial connections, may result from the rotation of the myocardial wall of the OFT (Figure 7). Understanding the molecular and genetic regulation of OFT rotation, as visualized here for the first time in the mouse, should provide important new insights into congenital heart defects affecting ventricular septation and great artery development.
|
| Acknowledgments |
|---|
| Footnotes |
|---|
Original received July 6, 2005; revision received December 15, 2005; accepted December 20, 2005.
| References |
|---|
|
|
|---|
2. Samanek M. Congenital heart malformations: prevalence, severity, survival, and quality of life. Cardiol Young. 2000; 10: 179185.[Medline] [Order article via Infotrieve]
3. Kelly RG, Brown NA, Buckingham ME. The arterial pole of the mouse heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev Cell. 2001; 1: 435440.[CrossRef][Medline] [Order article via Infotrieve]
4. Mjaatvedt CH, Nakaoka T, Moreno-Rodriguez R, Norris RA, Kern MJ, Eisenberg CA, Turner D, Markwald RR. The outflow tract of the heart is recruited from a novel heart-forming field. Dev Biol. 2001; 238: 97109.[CrossRef][Medline] [Order article via Infotrieve]
5. Waldo KL, Kumiski DH, Wallis KT, Stadt HA, Hutson MR, Platt DH, Kirby ML. Conotruncal myocardium arises from a secondary heart field. Development. 2001; 128: 31793188.
6. Zaffran S, Kelly RG, Meilhac SM, Buckingham ME, Brown NA. Right ventricular myocardium derives from the anterior heart field. Circ Res. 2004; 95: 261268.
7. Buckingham M, Meilhac SM, Zaffran S. Building the mammalian heart from two sources of myocardial cells. Nat Rev Genet. 2005; 6: 826835.[CrossRef][Medline] [Order article via Infotrieve]
8. Waldo KL, Hutson MR, Ward CC, Zdanowicz M, Stadt HA, Kumiski D, Abu-Issa R, Kirby ML. Secondary heart field contributes myocardium and smooth muscle to the arterial pole of the developing heart. Dev Biol. 2005; 281: 7890.[CrossRef][Medline] [Order article via Infotrieve]
9. Ward C, Stadt H, Hutson M, Kirby ML. Ablation of the secondary heart field leads to tetralogy of Fallot and pulmonary atresia. Dev Biol. 2005; 284: 7283.[CrossRef][Medline] [Order article via Infotrieve]
10. Thompson RP, Fitzharris TP. Division of cardiac outflow. In: Ferrans V, Rosenkuist G, Weinstein C, eds. Cardiac Morphogenesis. Amsterdam: Elsevier Science Publishing and Co Inc; 1985: 169180.
11. Markwald RR, Fitzharris TP, Manasek FJ. Structural development of endocardial cushions. Am J Anat. 1977; 148: 85119.[CrossRef][Medline] [Order article via Infotrieve]
12. Van Mierop LH, Alley RD, Kausel HW, Stranahan A. The anatomy and embryology of endocardial cushion defects. J Thorac Cardiovasc Surg. 1962; 43: 7183.[Medline] [Order article via Infotrieve]
13. Kirby ML, Gale TF, Stewart DE. Neural crest cells contribute to normal aorticopulmonary septation. Science. 1983; 220: 10591061.
14. Epstein JA, Li J, Lang D, Chen F, Brown CB, Jin F, Lu MM, Thomas M, Liu E, Wessels A, Lo CW. Migration of cardiac neural crest cells in Splotch embryos. Development. 2000; 127: 18691878.[Abstract]
15. Conway SJ, Henderson DJ, Kirby ML, Anderson RH, Copp AJ. Development of a lethal congenital heart defect in the splotch (Pax3) mutant mouse. Cardiovasc Res. 1997; 36: 163173.
16. Conway SJ, Henderson DJ, Copp AJ. Pax3 is required for cardiac neural crest migration in the mouse: evidence from the splotch (Sp2H) mutant. Development. 1997; 124: 505514.[Abstract]
17. Yelbuz TM, Waldo KL, Kumiski DH, Stadt HA, Wolfe RR, Leatherbury L, Kirby ML. Shortened outflow tract leads to altered cardiac looping after neural crest ablation. Circulation. 2002; 106: 504510.
18. Franco D, Campione M. The role of Pitx2 during cardiac development. Linking left-right signaling and congenital heart diseases. Trends Cardiovasc Med. 2003; 13: 157163.[CrossRef][Medline] [Order article via Infotrieve]
19. Liu C, Liu W, Lu MF, Brown NA, Martin JF. Regulation of left-right asymmetry by thresholds of Pitx2c activity. Development. 2001; 128: 20392048.
20. Liu C, Liu W, Palie J, Lu MF, Brown NA, Martin JF. Pitx2c patterns anterior myocardium and aortic arch vessels and is required for local cell movement into atrioventricular cushions. Development. 2002; 129: 50815091.
21. Kioussi C, Briata P, Baek SH, Wynshaw-Boris A, Rose DW, Rosenfeld MG. Pitx genes during cardiovascular development. Cold Spring Harb Symp Quant Biol. 2002; 67: 8187.[CrossRef][Medline] [Order article via Infotrieve]
22. Dor X, Corone P. Migration and torsions of the conotruncus in the chick embryo heart: observational evidence and conclusions drawn from experimental intervention. Heart Vessels. 1985; 1: 195211.[Medline] [Order article via Infotrieve]
23. Thompson RP, Abercrombie V, Wong M. Morphogenesis of the truncus arteriosus of the chick embryo heart: movements of autoradiographic tattoos during septation. Anat Rec. 1987; 218: 434440, 394395.[CrossRef]
24. Lomonico MP, Moore GW, Hutchins GM. Rotation of the junction of the outflow tract and great arteries in the embryonic human heart. Anat Rec. 1986; 216: 544549.[CrossRef][Medline] [Order article via Infotrieve]
25. Lomonico MP, Bostrom MP, Moore GW, Hutchins GM. Arrested rotation of the outflow tract may explain tetralogy of Fallot and transposition of the great arteries. Pediatr Pathol. 1988; 8: 267281.[Medline] [Order article via Infotrieve]
26. Bostrom MP, Hutchins GM. Arrested rotation of the outflow tract may explain double-outlet right ventricle. Circulation. 1988; 77: 12581265.
27. Hadchouel J, Tajbakhsh S, Primig M, Chang TH, Daubas P, Rocancourt D, Buckingham M. Modular long-range regulation of Myf5 reveals unexpected heterogeneity between skeletal muscles in the mouse embryo. Development. 2000; 127: 44554467.[Abstract]
28. Epstein DJ, Vogan KJ, Trasler DG, Gros P. A mutation within intron 3 of the Pax-3 gene produces aberrantly spliced mRNA transcripts in the splotch (Sp) mouse mutant. Proc Natl Acad Sci U S A. 1993; 90: 532536.
29. Meilhac SM, Kelly RG, Rocancourt D, Eloy-Trinquet S, Nicolas JF, Buckingham ME. A retrospective clonal analysis of the myocardium reveals two phases of clonal growth in the developing mouse heart. Development. 2003; 130: 38773889.
30. Meilhac SM, Esner M, Kerszberg M, Moss JE, Buckingham ME. Oriented clonal cell growth in the developing mouse myocardium underlies cardiac morphogenesis. J Cell Biol. 2004; 164: 97109.
31. Franz T. Persistant truncus arteriosus in the Splotch mutant mouse. Anat Embryol. 1989; 180: 457464.[CrossRef][Medline] [Order article via Infotrieve]
32. Relaix F, Rocancourt D, Mansouri A, Buckingham M. Divergent functions of murine Pax3 and Pax7 in limb muscle development. Genes Dev. 2004; 18: 10881105.
33. Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian cardiac neural crest. Development. 2000; 127: 16071616.[Abstract]
34. Waldo KL, Hutson MR, Stadt HA, Zdanowicz M, Zdanowicz J, Kirby ML. Cardiac neural crest is necessary for normal addition of the myocardium to the arterial pole from the secondary heart field. Dev Biol. 2005; 281: 6677.[CrossRef][Medline] [Order article via Infotrieve]
35. Costell M, Carmona R, Gustafsson E, Gonzalez-Iriarte M, Fassler R, Munoz-Chapuli R. Hyperplastic conotruncal endocardial cushions and transposition of great arteries in perlecan-null mice. Circ Res. 2002; 91: 158164.
36. Yasui H, Nakazawa M, Morishima M, Ando M, Takao A, Aikawa E. Cardiac outflow tract septation process in the mouse model of transposition of the great arteries. Teratology. 1997; 55: 353363.[CrossRef][Medline] [Order article via Infotrieve]
37. Gaio U, Schweickert A, Fischer A, Garratt AN, Muller T, Ozcelik C, Lankes W, Strehle M, Britsch S, Blum M, Birchmeier C. A role of the cryptic gene in the correct establishment of the left-right axis. Curr Biol. 1999; 9: 13391342.[CrossRef][Medline] [Order article via Infotrieve]
38. Oh SP, Li E. The signaling pathway mediated by the type IIB activin receptor controls axial patterning and lateral asymmetry in the mouse. Genes Dev. 1997; 11: 18121826.
39. Campione M, Ros MA, Icardo JM, Piedra E, Christoffels VM, Schweickert A, Blum M, Franco D, Moorman AF. Pitx2 expression defines a left cardiac lineage of cells: evidence for atrial and ventricular molecular isomerism in the iv/iv mice. Dev Biol. 2001; 231: 252264.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
A. D. Hoffmann, M. A. Peterson, J. M. Friedland-Little, S. A. Anderson, and I. P. Moskowitz sonic hedgehog is required in pulmonary endoderm for atrial septation Development, May 15, 2009; 136(10): 1761 - 1770. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A.M. Roest, D. G.M. Molin, C. G. Schalkwijk, L. van Iperen, P. Wentzel, U. J. Eriksson, and A. C. Gittenberger-de Groot Specific Local Cardiovascular Changes of N{varepsilon}-(Carboxymethyl)lysine, Vascular Endothelial Growth Factor, and Smad2 in the Developing Embryos Coincide With Maternal Diabetes-Induced Congenital Heart Defects Diabetes, May 1, 2009; 58(5): 1222 - 1228. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Kirby Pulmonary Atresia or Persistent Truncus Arteriosus: Is It Important to Make the Distinction and How Do We Do It? Circ. Res., August 15, 2008; 103(4): 337 - 339. [Full Text] [PDF] |
||||
![]() |
D Obler, A L Juraszek, L B Smoot, and M R Natowicz Double outlet right ventricle: aetiologies and associations J. Med. Genet., August 1, 2008; 45(8): 481 - 497. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Theveniau-Ruissy, M. Dandonneau, K. Mesbah, O. Ghez, M.-G. Mattei, L. Miquerol, and R. G. Kelly The del22q11.2 Candidate Gene Tbx1 Controls Regional Outflow Tract Identity and Coronary Artery Patterning Circ. Res., July 18, 2008; 103(2): 142 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Bakker, B. J. Boukens, M. T.M. Mommersteeg, J. F. Brons, V. Wakker, A. F.M. Moorman, and V. M. Christoffels Transcription Factor Tbx3 Is Required for the Specification of the Atrioventricular Conduction System Circ. Res., June 6, 2008; 102(11): 1340 - 1349. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ryckebusch, Z. Wang, N. Bertrand, S.-C. Lin, X. Chi, R. Schwartz, S. Zaffran, and K. Niederreither Retinoic acid deficiency alters second heart field formation PNAS, February 26, 2008; 105(8): 2913 - 2918. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Lin, R. Sullivan, Y. Lee, S. Moran, E. Glover, and C. A. Bradfield Deletion of the Aryl Hydrocarbon Receptor-associated Protein 9 Leads to Cardiac Malformation and Embryonic Lethality J. Biol. Chem., December 7, 2007; 282(49): 35924 - 35932. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T Butcher and R. R Markwald Valvulogenesis: the moving target Phil Trans R Soc B, August 29, 2007; 362(1484): 1489 - 1503. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Rana, N. C.A. Horsten, S. Tesink-Taekema, W. H. Lamers, A. F.M. Moorman, and M. J.B. van den Hoff Trabeculated Right Ventricular Free Wall in the Chicken Heart Forms by Ventricularization of the Myocardium Initially Forming the Outflow Tract Circ. Res., April 13, 2007; 100(7): 1000 - 1007. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M.S. van den Akker, D. G.M. Molin, P. P.W.M. Peters, S. Maas, L. J. Wisse, R. van Brempt, C. J. van Munsteren, M. M. Bartelings, R. E. Poelmann, P. Carmeliet, et al. Tetralogy of Fallot and Alterations in Vascular Endothelial Growth Factor-A Signaling and Notch Signaling in Mouse Embryos Solely Expressing the VEGF120 Isoform Circ. Res., March 30, 2007; 100(6): 842 - 849. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |