Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2005;97:937-945
Published online before print September 29, 2005, doi: 10.1161/01.RES.0000188211.83193.1a
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
97/9/937    most recent
01.RES.0000188211.83193.1av1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, L.
Right arrow Articles by Hales, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, L.
Right arrow Articles by Hales, C. A.
(Circulation Research. 2005;97:937.)
© 2005 American Heart Association, Inc.


Integrative Physiology

Cyclin-Dependent Kinase Inhibitor p27Kip1, But Not p21WAF1/Cip1, Is Required for Inhibition of Hypoxia-Induced Pulmonary Hypertension and Remodeling by Heparin in Mice

Lunyin Yu, Deborah A. Quinn, Hari G. Garg, Charles A. Hales

From the Department of Medicine, Pulmonary and Critical Care Unit, Massachusetts General Hospital, Harvard Medical School, Boston, Mass.

Correspondence to Charles A. Hales, Pulmonary and Critical Care Unit, Massachusetts General Hospital, Harvard Medical School, 55 Fruit St, Bulfinch-148, Boston, MA 02114-2696. E-mail chales{at}partners.org


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Heparin has growth inhibitory effects on pulmonary artery smooth muscle cell (PASMC) in vitro and in vivo. However, the mechanism has not been fully defined. In this study, we investigated the role of cyclin-dependent kinase inhibitors, p21WAF1/cip1 (p21) and p27Kip1 (p27), in the inhibitory effect of heparin on PASMC proliferation in vitro and on hypoxia-induced pulmonary hypertension in vivo using p21 and p27-null mice. In vitro, loss of the p27 gene negated the inhibitory effect of heparin on PASMC proliferation, but p21 was not critical for this inhibition. In vivo, heparin significantly inhibited the development of hypoxia-induced pulmonary hypertension and remodeling, as evidenced by decreased right ventricular systolic pressure, ratio of right ventricular weight to left ventricle plus septum weight, and percent wall thickness of pulmonary artery, in p21+/+, p21–/–, p27+/+, and p27+/–, but not in p27–/– mice. We also observed that hypoxia decreased p27 expression significantly in mouse lung, which was restored by heparin. Heparin inhibited Ki67 proliferative index in terminal bronchial vessel walls in p27+/+ and p27+/–, but not in p27–/– mice exposed to hypoxia. Therefore, we conclude that the cyclin-dependent kinase inhibitor p27, but not p21, is required for the inhibition of hypoxic pulmonary vascular remodeling by heparin.


Key Words: p27Kip1 • p21WAF1/cip1 • heparin • pulmonary hypertension • hypoxia • mouse


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Heparin, a glycosaminoglycan, has been used as an anticoagulant for more than 50 years.1 Besides anticoagulation, heparin has a variety of other biological activities, such as regulation of lipid metabolism, control of cell attachment to various proteins in the extracellular matrix, binding with acid and basic fibroblast growth factors, and inhibition of vascular smooth muscle cell (SMC) proliferation.2

An important pathological feature of pulmonary hypertension is increased medial thickening of the pulmonary artery attributable to hypertrophy and hyperplasia of pulmonary artery SMC (PASMC).3,4 Our previous studies have shown that antiproliferative heparins significantly inhibit pulmonary vascular remodeling induced by hypoxia in rodents5–7 and PASMC proliferation in culture.8–10 Other investigators also have reported that heparin inhibits PASMC proliferation in vitro and in vivo.8,11 To date, however, the mechanism by which heparin inhibits PASMC proliferation has not been elucidated.

The balance between cell proliferation and cell quiescence is regulated by a variety of cell cycle modulators. Cyclin-dependent kinase (CDK) is a major regulator of the transition between the phases of the cell cycle.12 Cyclin/CDK complexes are composed of a regulatory subunit, cyclin, and an active kinase subunit, CDK. The cyclin/CDK complexes are controlled by both positive and negative regulators.13 p21WAF1/cip1 (p21) and p27Kip1 (p27) are two primary negative regulators of CDK in SMC and play an important role in the inhibition of CDK activity.14 Both p21 and p27 inhibit the phosphorylation of cyclin A/CDK2, cyclin D/CDK4, and cyclin E/CDK2 complex, which results in inhibition of the activity of this complex and cell growth arrest in G1 phase.12

Fouty et al observed that overexpression of p27 decreased PASMC proliferation.15 Other investigators have found that overexpression of p27 was associated with attenuated systemic artery SMC proliferation.16,17 The first identified negative regulator of CDK, p21, has also been reported to have inhibitory effects on artery smooth muscle cell proliferation.14 Many studies have found that inhibition of SMC proliferation was accompanied by upregulation of p21 activity.17–18 Khoury and Langleben11 reported an increase in p21 with heparin inhibition of pericyte proliferation although the role of p21 was not defined.

Based on our previous findings and other investigators’ observations, we hypothesized that p21 and p27 play an important role in the inhibition of PASMC proliferation and of hypoxia-induced pulmonary hypertension by heparin. Therefore, the objective of this study was to investigate the role of the CDK inhibitors p21 and p27 in the inhibitory effect of heparin on PASMC proliferation in vitro and in the development of hypoxia-induced pulmonary hypertension and remodeling in vivo.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture and Treatment
Bovine PASMCs were isolated from bovine pulmonary arteries as previously described.19 p27–/– and wild-type control (p27+/+) mouse PASMCs from pulmonary arteries of p27-null and C57 BL/6 mice were provided kindly by Brian W. Fouty at University of Colorado Health Science Center, Denver, Colorado. The cells, grown in RPMI medium1640 with 10% FBS, streptomycin, penicillin, and amphotericin B, were used in passages 4 through 6. Cell growth assays were performed on PASMC in passage 4 (n=5), passage 5 (n=5), and passage 6 (n=5) to ensure reproducibility. The cells were seeded at 1.25x104 cells per well in 6-well tissue culture plates, were allowed to grow for 2 days, and were growth arrested for 48 hours. The media was then changed either to standard medium (with 10% FBS), to growth arrest medium (with 0.1% FBS), or to standard medium with heparin at different doses. Upjohn heparin (batch #1209b) from beef lung was a gift from Pharmacia & Upjohn Inc, Kalamazoo, Mich., and was used for cell cultures and animal experiments in this study. After treatment with heparin for 4 days, the cells were harvested for cell proliferation assays using a direct cell-counting proliferation assay9,10 and for Western blot and RT-PCR analysis. The percent growth was calculated as (net cell growth in treated medium/net cell growth in standard medium)x100, where the net cell growth=cell growth in standard or treated medium–cell growth in growth arrest medium.9,10

Western Blot
Total cell lysates were obtained from harvested cells. Antibodies included p21 rabbit polyclonal antibody (C-19; Santa Cruz Biotechnology, Santa Cruz, Calif), p27 mouse monoclonal antibody (clone 57; BD Biosciences Pharmingen, San Diego, Calif), and GAPDH mouse monoclonal antibody (clone 6C5; Research Diagnostics, Inc, Flanders, N.J.).

RT-PCR
Total RNA was extracted from cultured PASMCs. Total RNA (4 µg) was used to carry out RT-PCR to measure mRNA expression with Qiagen Onestep RT-PCR Kit (Qiagen Inc). The primer pairs for p27,20 for p21,21 and for the housekeeping gene GAPDH22 were purchased from Sigma Genosys, Woodlands, Tex.

siRNA In Vitro Gene Silencing
In vitro siRNA transfections were performed using a Qiagen RNAi starter Kit (Qiagen, Inc). After treatment with heparin for 4 days, the cells were harvested for cell growth assay. Western blot analysis was performed to confirm the gene silencing by small interfering RNA (siRNA). According to manufacturer’s directions, p27 siRNA was designed on the basis of the p27 gene sequence (GeneBank accession no. NM 004064-2) at Qiagen’s website, siRNA Design tool by Sequence. The DNA target sequence for this p27 gene was AAGGTGCATACTGAGCCAAG, and the siRNA duplex sequences were sense 5'-GGUUGCAUACUGAGCCAAG-3' and antisense 3'-TCCAACGUAUGACUCGGUUC-5'. p21 siRNA was designed according to previously published work by Zou et al.23 p27 siRNA and p21siRNA were synthesized by Qiagen-Xeragon, Inc.

Animals
Animal experiments were approved by the Subcommittee on Research Animal Care at Massachusetts General Hospital. A total of 116 mice were used. Homozygous p21-null male mice (p21–/–, p21-knockout[KO]) were the gifts of Dr Philip Leder (Department of Genetics, Harvard Medical School, Boston, Mass), and the strain-specific FVB wild-type (WT) control mice (p21+/+) were obtained from Taconic Farmer, Inc (Germantown, NY). Homozygous p27-null (p27–/–, p27-KO) and heterozygous (Het) p27 (p27+/–, p27-Het) male mice and the strain-specific129S4 control mice (p27+/+, WT) were bred from a breeding pair of Het p27 mice (+/–) (gifts from Dr Jim Roberts, Fred Hutchinson Cancer Research Center, Seattle, Wash), and the offspring genotype was confirmed by polymerase chain reaction of genomic DNA.24 The mice (8 to 10 weeks old) were placed in a hypoxic chamber or exposed to normoxia in the same chamber for 2 weeks. Oxygen concentration was maintained at 10% by controlling the flow rates of compressed air and N2. Cage concentration of O2 was checked daily. The heparin-treated mice were given 300 U/kg of heparin subcutaneously twice daily for 14 days, as in our previous study.5 In control groups, mice were given 0.1 mL of saline subcutaneously twice daily.

Measurements of Right Ventricular Pressure
After 14 days in the chamber, the animals were removed and anesthetized with intraperitoneal ketamine (80 mg/kg) and diazepam (5 mg/kg). Animals were placed on a warming blanket to maintain body temperature at 37°C. Right ventricular systolic pressure (RVSP) was measured with the use of a single lumen catheter (0.012x0.016 inches silicone tubing) passed through the right external jugular vein. The animals were then euthanized with 200 mg/kg of pentobarbital and used immediately for the determination of right ventricular hypertrophy, hematocrit, and lung pathology as well as gene expression.

Histological Evaluation
Right ventricular hypertrophy was measured as the ratio of right ventricular weight to left ventricular plus septal weight (RV/LV+S). Pulmonary vascular remodeling was assessed by measuring the percentage of wall thickness of the vessels (%WT), including terminal bronchial and intraacinous arterioles. The percentage of thick-walled as a fraction of total intraacinous vessels (% thick) was also determined.5,25 A computer imaging analysis was applied for the measurement of wall thickness. The images of individual pulmonary arteries were captured using a digital camera, mounted on a light microscope, and linked to a computer. Wall thickness was measured as described previously.5,25

Detection of the CDK Inhibitors
Total RNA and protein were isolated from the mouse lungs and the same methods were used for the detection of the expression of p27 and p21 mRNA and protein as described above.

Immunohistochemical Staining for Ki67 Expression
Anti-Ki67 antibody (rabbit polyclonal, dilution 1:25; Abcam, Inc, Cambridge, Mass) was used as a marker of vascular wall cell proliferation. Immunohistochemical staining of paraffin sections of lung tissue was performed by using a labeled-(strept)avidin-biotin (LAB-SA) detection kit (Histostain-plus kit; Zymed Laboratory, Inc) following the manufacturer’s protocol. Hematoxylin was used as counterstain. Control slides were treated identically but without the primary antibody. The identification of cellular positive status was determined by Ki67 nuclear staining by a blinded investigator. The percentage of Ki67 positive cells was estimated by calculating the ratio of Ki67-expressing cell nuclei to the total number of cell nuclei in the cell wall of cross-sections of 10 terminal bronchial arterioles per slide.

Hematocrit Measurement
Blood samples were collected and centrifuged in heparinized microcapillary tubes for 3 minutes. Hematocrit was read directly.

Statistical Analysis
All values were expressed as mean±SEM. Statistics were performed using the computer program Statview (SAS Institute, Inc) with factorial ANOVA. If ANOVA were significant, multiple comparisons were made among groups using the Fisher protected least significant difference test. Significance was set at P<0.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Heparin Induced PASMC Growth Arrest and Increased p21 and p27 mRNA and Protein Expression
Bovine PASMCs stimulated with 10% FBS were treated with heparin for 4 days, which significantly inhibited PASMC growth in a dose-dependent manner compared with nonheparinized controls (P<0.05 versus 10% FBS; Figure 1A), and which caused a dose-related increase in p21 mRNA and protein (P<0.05 versus control; Figure 1B and 1C) as well as in p27 mRNA and protein (P<0.05 versus control; Figure 1D and 1E).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 1. A, Cell growth assay. Bovine PASMC were incubated for 4 days with heparin in the medium, and then cell growth assay was performed. Cells grown in 10% FBS and 0.1% FBS were used for positive and negative controls. The results were representative of 3 separate experiments (total n=15), and error bars represent standard error. *P<0.05 as compared with 10% FBS. HP indicates heparin. B through E, Detection of p21 and p27 mRNA and protein expression. Total RNA and protein from bovine PASMC grown for 4 days in medium containing 10% FBS and the indicated amount of heparin were isolated and then subjected to RT-PCR and Western blot analysis. GAPDH was used for equal loading control. Controls represent bovine PASMC grown in 10% FBS without added heparin. Expression of p21 and p27 mRNA and protein, which were representative of 5 separate experiments in B and D, were quantified as arbitrary unit (AU) of densitometry of the band images (C and E) from RT-PCR for mRNA expression and from Western blot for protein expression by using National Institutes of Health 1.61 image software. *P<0.05 as compared with control.

Blockade of the p21 Gene Did Not Affect the Inhibitory Effect of Heparin on PASMC Proliferation
PASMC growth was inhibited significantly and in a dose-dependent manner by heparin despite 70% inhibition of p21 protein expression by p21 siRNA transfection (P<0.05 versus 10% FBS; Figure 2A and 2B). These data suggested that the p21 gene was not critical in heparin-induced inhibition of PASMC proliferation. To examine the role of heparin in the complete absence of p21, we observed that heparin significantly inhibited the 10% serum-induced proliferation of both HCT 116 p21+/+ and p21–/– colon cancer cells. The percent growth was 63% and 42% in p21+/+ cells and 75% and 51% in p21–/– cells, respectively, at doses of 100 µg/mL and 200 µg/mL of heparin, compared with 100% growth in serum without heparin. Thus, these cells showed strong inhibition by heparin even in the absence of p21.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. A through D, p21 and p27 siRNA silencing and PASMC proliferation. Bovine PASMC grown to 50% confluence were transfected with siRNA of both CDK inhibitors at dose of 1.5 µg per well in 24-well plates for 24 hours. After serum-starvation for 48 hours, the cells transfected with siRNA were incubated for 4 days with heparin. Cells grown in 10% FBS or 0.1% FBS were used for positive and negative control. A, % growth of the cells transfected with p21 siRNA; B, Western blot respectively showing inhibition of p21 protein by p21 siRNA. C, % growth of the cells transfected with p27 siRNA; D, Western blot respectively showing inhibition of p27 protein by p27 siRNA. E, p27 deficiency and inhibition of heparin on PASMC proliferation. p27+/+ and p27–/– mouse PASMC were incubated for 4 days with heparin. Cells grown in 10% FBS and 0.1% FBS were used for positive and negative controls. The results are representative of 3 separate experiments (total n=15), and error bars represent standard error. *P<0.05 as compared with 10% FBS. HP indicates heparin.

Loss of p27 Gene Negated the Inhibitory Effect of Heparin on PASMC Proliferation
To determine the role of p27 deficiency on PASMC proliferation, PASMCs transfected with p27 siRNA and PASMCs deficient in p27 were used. Gene silencing by introduction of p27 siRNA in PASMCs resulted in 70% inhibition of p27 protein expression and in the abrogation of heparin-dependent growth arrest of PASMCs, such that the growth of PASMCs was unabated (P<0.05 versus 10% FBS; Figure 2C and 2D). Similar to the results with p27 siRNA transfection, we did not observe an inhibitory effect of heparin on the growth of p27–/– PASMCs (P<0.05 versus 10% FBS; Figure 2E). These data demonstrate that the p27 gene was necessary for heparin-induced inhibition of PASMC proliferation. The scrambled p21 and p27 siRNA were used as controls for these siRNA experiments, but no gene silencing was observed (data not shown).

Deficiency of p21 Gene Does Not Attenuate the Inhibitory Effect of Heparin on Hypoxia-Induced Pulmonary Hypertension and Vascular Remodeling In Vivo
To determine the importance in the intact animal of the in vitro observations, we performed studies using p21-null mice. Heparin significantly inhibited the development of hypoxia-induced pulmonary hypertension in both p21+/+ and p21–/– mice, as shown by RVSP(Figure 3A) and RV/LV+S (Figure 3B). Pulmonary vascular remodeling as shown by the wall thickness of the terminal bronchiolar arterioles (% WT-TA) and intraacinous arterioles (% WT-IA) and by the % thick of the intracinous vessels was significantly less in both p21+/+ and p21–/– mice treated with heparin (Figure 4A through 4D). The value of the hematocrit was significantly higher in the hypoxic versus the normoxic groups, but no difference was observed between p21+/+ and p21–/– hypoxic mice (Figure 3C). These results demonstrated that deficiency of the p21 gene did not prevent the inhibitory effect of heparin on hypoxia-induced pulmonary hypertension in vivo.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. RVSP (A), RV/LV+S ratio (B), and hematocrit (C) in p21-deficient mice. WT control (p21+/+ mice without heparin), WT heparin (p21+/+ mice with heparin), p21-KO control (p21–/– mice without heparin), p21-KO heparin (p21–/– mice with heparin). n=6 for normoxia and n=8 for hypoxia. *P<0.05 as compared with littermate control mice.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. % WT-terminal bronchiolar arteriole (TA) (A), % WT-intracinar arteriole (IA) (B), % thick (C) in p21-deficient mice, and representative photomicrograph for terminal bronchial arterioles (D). WT control (p21+/+ mice without heparin), WT heparin (p21+/+ mice with heparin), p21-KO control (p21–/– mice without heparin), p21-KO heparin (p21–/– mice with heparin). n=6 for normoxia and n=8 for hypoxia. *P<0.05 as compared with littermate control mice.

Hypoxia-Induced Pulmonary Hypertension Remodeling Was Inhibited by Heparin in Both p27+/+ and p27+/– But Not in p27–/– Mice
Heparin reduced (P<0.05) RVSP and RV/LV+S in hypoxic wild-type (p27+/+) and Het (p27+/–) mice compared with hypoxic controls but not in p27 KO (p27–/–) mice (Figure 5A and 5B). Heparin likewise reduced pulmonary vascular remodeling (P<0.05) when measured as % WT in terminal bronchial arterioles and intraacinous vessels and as % thick of intraacinous vessels in wild-type (p27+/+) and Het (p27+/–) but not p27 KO mice (Figure 6A and 6D). There were no significant differences in RVSP and vascular remodeling among any of the mice in normoxia with and without heparin treatment. Hypoxia caused a significant rise in hematocrit as compared with normoxia, but there was no significant difference among hypoxic groups (Figure 5C). These results indicated that p27 was required for the inhibitory effect of heparin on hypoxia-induced pulmonary hypertension in intact mice.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. RVSP (A), RV/LV+S ratio (B), and hematocrit (C) in p27-deficient mice. WT control (p21+/+ mice without heparin), WT heparin (p27+/+ mice with heparin), p27-Het control (p27+/– mice without heparin), p27-Het heparin (p27+/– mice with heparin), p27-KO control (p27–/– mice without heparin), p27-KO heparin (p27–/– mice with heparin). n=5 for each groups. *P<0.05 as compared with littermate control mice. NS indicates not significant.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 6. %WT-TA (A), %WT-IA (B), % thick (C) in p27-deficient mice, and representative photomicrograph (D) for terminal bronchial arterioles. WT control (p27+/+ mice without heparin), WT heparin (p27+/+ mice with heparin), p27-Het control (p27+/– mice without heparin), p27-Het heparin (p27+/– mice with heparin), p27-KO control (p27–/– mice without heparin), p27-KO heparin (p27–/– mice with heparin). n=5 for each groups. *P<0.05 as compared with littermate control mice. NS indicates not significant.

Hypoxia Decreased p27 Expression and Heparin Reversed This Decrease In Vivo
We found that hypoxia significantly decreased p27 mRNA and protein level in the lung and that heparin inhibited the decrease (Figure 7A). However, p21 expression was not affected by either hypoxia or heparin in the whole lung (Figure 7B).



View larger version (80K):
[in this window]
[in a new window]
 
Figure 7. Expression of CDK inhibitors in mouse lungs. Total RNA and protein from the mouse lung tissue was isolated and then subjected to RT-PCR and Western blot analysis. GAPDH was used for equal loading control. WT control (wild-type mice without heparin), WT heparin (wild-type mice with heparin), p27-Het control (p27+/– mice without heparin), p27-Het heparin (p27+/– mice with heparin), p27- or p21-KO control (p27–/– or p21–/– mice without heparin), p27- or p21-KO heparin (p27–/– or p21–/– mice with heparin). The results are representative of 3 separate experiments. A, p21 expression in p21-null mice. B, p27 expression in p27-null mice. The results are representative of 3 separate experiments.

Heparin Decreased Vessel Wall Ki67 Proliferative Index Induced by Hypoxia in WT and p27-Het, But Not in p27-KO Mice
To examine whether increased vascular wall cell proliferative activity correlated with the lack of effect of heparin observed in hypoxic p27-null mice versus hypoxic wild-type and p27-Het mice, we compared the Ki67 proliferative index of vascular wall cells in the pulmonary vessels from normoxic and hypoxic animals. Fewer than 3.5% of the cells in the vessel wall of the terminal bronchiolar arteriole were Ki67-positive in normoxic mice with or without heparin, compared with &41% in hypoxic control mice. Specifically, there were 40.2±2.1 in WT, 41.0±1.6 in p27-Het and 42.1±1.2 in p27-KO mice, respectively. Heparin, however, decreased the % Ki67-positive cells to 26.5±1.7 in hypoxic WT and 27.3±1.3 in hypoxic p27-Het mice (P<0.05 versus littermate controls), but did not influence the Ki67 expression in hypoxic p27-KO mice, which was 41.3±2.0%.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The present study demonstrates that p27 is critical to the prevention of pulmonary vascular smooth muscle hyperplasia by heparin in vitro (Figures 1 and 2Up) and hypoxia induced pulmonary hypertension in vivo (Figures 5 and 6Up). p21 was not important to this process (Figures 3 and 4Up).

Heparin inhibition of SMC proliferation has been associated with several factors including the suppression of c-fos and c-myc, 26 inhibition of the EGF receptor,27 nitric oxide synthesis,28 protein kinase activity,29 modulation of cytosolic calcium,30 inhibition of the Na+/H+ exchanger,19,25 as well as an increase in p2111 and p27.30 These data suggest that heparin inhibition of SMC proliferation probably involves several different pathways. Our study revealed that the CDK inhibitor p27 plays a critical role in mediating the antiproliferative property of heparin on hypoxia-induced pulmonary hypertension and remodeling, but p21 does not.

p27 is a member of CIP/KIP family of CDK inhibitors and inhibits cyclin E/CDK2 activity. In vitro overexpression of p27 decreases SMC proliferation,15,31 and inhibition of p27 activity enhances baboon aortic SMC proliferation.32 Fouty et al in their study of the role of the p27 gene in modulating PASMC proliferation used p27–/– PASMCs and found a 2-fold increase in [3H]thymidine incorporation and cell proliferation in p27–/– PASMCs compared with p27+/+ PASMCs.15 Tanner et al17 also observed that overexpression of p27 caused a reduction of aortic SMC proliferation. In the present study, we found that inhibition of PASMC proliferation by heparin was accompanied by induction of both p27 mRNA and protein, and, furthermore, blockade of the p27 gene expression by p27 siRNA transfection of bovine PASMCs or by KO of the p27 gene in mouse PASMCs resulted in loss of the antiproliferative effect of heparin, thus demonstrating the importance of p27 in regulating PASMC proliferation.

p27 also plays a critical role in vivo in mediating cell growth, and disruption of p27 causes an alteration in cell proliferation.24,33,34 Fero et al,24 Kiyokawa et al,33 and Nakayama et al34 found that a lack of functional p27 resulted in increased animal size from continued cell proliferation. Sun et al35 showed that the lack of p27 reduced rapamycin-mediated inhibition of SMC migration. Cool et al36 reported that p27-negative cells occurred in pulmonary hypertension in the central core of plexiform lesions where the cells proliferate. p27-positive cells were present in the peripheral area adjacent to incipient blood vessel formation. These data show that p27 might be an essential element in regulation of pulmonary vascular cell proliferation. In our study, the p27+/+, p27+/–, and p27–/– mice developed similar pulmonary hypertension and vascular remodeling under hypoxia. However, p27–/– mice lost heparin-mediated inhibition of hypoxic pulmonary hypertension and vascular remodeling, suggesting p27 was an important cofactor for the inhibitory effect of heparin, though not sufficient by itself, to alter hypoxic pulmonary vascular remodeling. Interestingly, in our study the p27-Het mice (p27+/–) developed pulmonary hypertension and vascular remodeling indistinguishable from p27 wild-type (p27+/+) mice. This is in contradistinction to the results with tumorigenesis and atherosclerosis where possessing 1 allele of p27 is partially protective compared with wild-type (p27+/+).37,38

Yu et al39 and Hirst et al40 observed increased Ki67 expression in cultured PASMCs and human bronchial SMC with growth factor stimulation. Roque and colleagues41 reported that decreased Ki67 expression was correlated with an increase in p27 expression in a porcine coronary angioplasty model. We also investigated the cell proliferation marker Ki67 expressed in the medial wall of terminal bronchial arterioles to further determine whether heparin inhibition of PASMC proliferation in vivo is mediated by p27. Our results revealed that PASMC proliferation in p27-KO mice was not affected by heparin although heparin inhibited cell proliferation in WT and p27-Het animals. This finding has provided additional support to the notion that the protective effect of heparin against hypoxic pulmonary vascular remodeling is mediated, at least in part, by p27-dependent growth arrest.

The p21 gene, another member of the CIP/KIP family of CDK inhibitors, also is an important modulator in the regulation of cell cycle progression. Overexpression of the p21 gene has been associated with a reduction in systemic artery SMC proliferation.17 In addition, Khoury and Langleben11 observed that heparin inhibition of pulmonary vascular pericyte proliferation caused by hypoxia was accompanied by induction of p21. Our data showed, however, that although heparin inhibition of PASMC proliferation was associated with upregulation of p21 in vitro, this increase in p21 was not necessary for the inhibition of cell growth because blockade of p21 gene expression by the use of p21 siRNA did not affect the inhibitory effect of heparin on PASMC proliferation. Heparin also inhibited the proliferation of both p21+/+ and p21–/– hematocrit cells. With the use of p21-deficient mice, we further demonstrated that p21 was not critical for the inhibitory effect of heparin on hypoxia-induced pulmonary hypertension in mice.

We observed a different effect of heparin on induction of p21 mRNA and protein in vitro and in vivo. p21 was induced in the heparin treated PASMCs, but was not affected in the hypoxic heparin-treated mice. It may be that the p21 signal is not involved in regulation of hypoxia-induced pulmonary hypertension in vivo. This finding also indicates that not all in vivo findings can be predicated by in vitro studies.

The fundamental cellular mechanism of action of heparin on SMC growth and the precise structural determinants of the heparin mechanism required for its antiproliferative action remain unknown. Heparin does bind growth factors, and this may contribute to its mode of action by depriving cells of these growth stimuli.42 Heparin, however, also appears to bind to specific receptors on the SMC surface, and the antiproliferative effect is enhanced >10-fold when quiescent SMCs are incubated with heparin for 48 hours before growth stimulation.42 Internalization of receptor bound heparin appears to occur during this time, at least in part suggesting an intracellular site of action.42,43 We have also shown that heparin can inhibit PASMC proliferation induced by serotonin, a growth factor that is not bound to heparin.44 Though heparin binding to growth factors may be involved in the inhibition of PASMC proliferation, this is not the only mechanism.

In conclusion, our study reveals that the CDK inhibitor p27 plays a critical role in the inhibitory effect of heparin on hypoxia-induced pulmonary hypertension and remodeling. p21, another CDK inhibitor, was not necessary for the inhibition of hypoxia-induced pulmonary hypertension by heparin.


*    Acknowledgments
 
This work was supported by National Institutes of Health grants HL39150 (C.A.H.) and HL03920 (D.A.Q.).


*    Footnotes
 
Original received February 7, 2005; revision received June 7, 2005; resubmission received August 23, 2005; accepted September 15, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Marcum JA. The origin of the dispute over the discovery of heparin. J Hist Med Allied Sci. 2000; 55: 37–66.[Free Full Text]

2. Garg HG, Roughley PJ, Hales CA. Proteoglycans in Lung Disease. In: Garg HG, Hales CA, and Linhardt RJ, eds. Heparin as a Potential Therapeutic Agent to Reverse Vascular Remodeling. New York, NY: Marcel Dekker, Inc; 2002: 377–398.

3. Jeffery TK, Wanstall JC. Pulmonary vascular remodeling: a target for therapeutic intervention in pulmonary hypertension. Pharmacol Ther. 2001; 92: 1–20.[CrossRef][Medline] [Order article via Infotrieve]

4. Rabinovitch M. Pulmonary vascular remodeling in hypoxic pulmonary hypertension. In: Yuan J X-J., ed. Hypoxic Pulmonary Vasoconstriction: Cellular and Molecular Mechanisms. Norwell, Mass: Kluwer Academic Publishers; 2004: 403–418.

5. Hales CA, Kradin RL, Brandstetter RD, Zhu Y-J. Impairment of hypoxic pulmonary artery remodeling by heparin in mice. Am Rev Respir Dis. 1983; 126: 747–752.

6. Hassoun PM, Steigman TB, Hales CA. Effect of heparin and warfarin on chronic hypoxic pulmonary hypertension and vascular remodeling in the guinea pig. Am Rev Respir Dis. 1989; 139: 763–768.[Medline] [Order article via Infotrieve]

7. Garg HG, Thompson BT, Hales CA. Structural determinants of antiproliferative activity of heparin on pulmonary artery smooth muscle cells. Am J Physiol Lung Cell Mol Physiol. 2000; 279: L779–L789.[Abstract/Free Full Text]

8. Thompson BT, Spence CR, Janssens SP, Joseph PM, Hales CA. Inhibition of hypoxic pulmonary hypertension by heparin of differing in vitro antiproliferation potency. Am J Respir Crit Care Med. 1994; 149: 1512–1517.[Abstract]

9. Garg HG, Yu L, Hales CA, Toida T, Islam T, Linhardt RJ. Sulfation patterns in heparin and heparan sulfate: effects of the proliferation of bovine pulmonary artery smooth muscle cells. Biochem Biophys Arch. 2003; 1639: 225–231.

10. Cindhuchao N, Quinn DA, Garg HG, Hales CA. Heparin inhibits SMC growth in the presence of human and fetal bovine serum. Biochem Biophys Res Commun. 2003; 302: 84–88.[CrossRef][Medline] [Order article via Infotrieve]

11. Khoury J, Langleben D. Heparin-like molecules inhibit pulmonary vascular periocyte proliferation in vitro. Am J Physiol Lung Cell Mol Physiol. 2000; 279: L252–L261.[Abstract/Free Full Text]

12. Sandal T. Molecular aspects of the mammalian cell cycle and cancer. Oncologist. 2002; 7: 73–81.[Abstract/Free Full Text]

13. Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 1999; 13: 1501–1512.[Free Full Text]

14. Roninson IB. Oncogenic functions of tumor suppressor p21 (Waf1/Cip1/Sdi1): association with cell senescence and tumor-promoting activities of stromal fibroblasts. Cancer Lett. 2002; 179: 1–14.[CrossRef][Medline] [Order article via Infotrieve]

15. Fouty BW, Grimison B, Fagan KA, Le Cras TD, Harral JW, Hoedt-Miller M, Sclafani RA, Rodman DM. P27(KIP1) is important in modulating pulmonary artery smooth muscle cell proliferation. Am J Respir Cell Mol Biol. 2001; 25: 652–658.[Abstract/Free Full Text]

16. Castro C, Diez-Juan A, Cortes MJ, Andres V. Distinct regulation of mitogen-activated protein kinases and p27Kip1 in smooth muscle cells from different vascular beds. A potential role in establishing regional phenotypic variance. J Biol Chem. 2003; 278: 4482–4490.[Abstract/Free Full Text]

17. Tanner FC, Boehm M, Akyurek LM, San H, Yang ZY, Tashiro J, Nabel GJ, Nabel EG. Differential effects of the cyclin-dependent kinase inhibitors p27(Kip1), p21(Cip1), and p16(Ink4) on vascular smooth muscle cell proliferation. Circulation. 2000; 101: 2022–2025.[Abstract/Free Full Text]

18. O’Reilly MA, Staversky RJ, Watkins RH, Maniscalco WM. Accumulation of p21(Cip1/WAF1) during hyperoxic lung injury in mice. Am J Respir Cell Mol Biol. 1998; 19: 777–785.[Abstract/Free Full Text]

19. Quinn DA, Dahlberg CG, Bonventre JP, Scheid CR, Honeyman T, Joseph PM, Thompson BT, Hales CA. The role of Na+/H+ exchange and growth factors in pulmonary artery smooth muscle cell proliferation. Am J Respir Cell Mol Biol. 1996; 14: 139–145.[Abstract]

20. Tao L, Kramer PM, Wang W, Yang S, Lubet RA, Steele VE, Pereira MA. Altered expression of c-myc, p16 and p27 in rat colon tumors and its reversal by short-term treatment with chemopreventive agents. Carcinogenesis. 2002; 23: 1447–1454.[Abstract/Free Full Text]

21. Robson CN, Gnanapragasam V, Byrne RL, Collins AT, Neal DE. Transforming growth factor-beta1 up-regulates p15, p21 and p27 and blocks cell cycling in G1 in human prostate epithelium. J Endocrinol. 1999; 160: 257–266.[Abstract]

22. Yu L, Blackburn GL, Zhou JR. Genistein and daidzein downregulate prostate androgen-regulated transcript-1 (PART-1) gene expression induced by dihydrotestosterone in human prostate LNCaP cancer cells. J Nutr. 2003; 133: 389–392.[Abstract/Free Full Text]

23. Zou X, Ray D, Aziyu A, Christov K, Boiko AD, Gudkov AV, Kiyokawa H. Cdk4 disruption renders primary mouse cells resistant to oncogenic transformation, leading to Arf/p53-independent senescence. Genes Dev. 2002; 16: 2923–2934.[Abstract/Free Full Text]

24. Fero ML, Rivkin M, Tasch M, Porter P, Carow CE, Firpo E, Polyak K, Tsai LH, Broudy V, Perlmutter RM, Kaushansky K, Roberts JM. A syndrome of multiorgan hyperplasia with features of gigantism, tumorigenesis, and female sterility in p27(Kip1)-deficient mice. Cell. 1996; 85: 733–744.[CrossRef][Medline] [Order article via Infotrieve]

25. Quinn DA, Du HK, Thompson BT, Hales CA. Amiloride analogs inhibit chronic hypoxic pulmonary hypertension. Am J Respir Crit Care Med. 1998; 157: 1263–1268.[Abstract/Free Full Text]

26. Wright TC Jr, Pukac LA, Castellot JJ Jr, Karnovsky MJ, Levine RA, Kim-Park HY, Campisi J. Heparin suppresses the induction of c-fos and c-myc mRNA in murine fibroblasts by selective inhibition of a protein kinase C-dependent pathway. Proc Natl Acad Sci U S A. 1989; 86: 3199–3203.[Abstract/Free Full Text]

27. Kalmes A, Vesti BR, Daum G, Abraham JA, Clowes AW. Heparin blockade of thrombin-induced smooth muscle cell migration involves inhibition of epidermal growth factor (EGF) receptor transactivation by heparin-binding EGF-like growth factor. Circ Res. 2000; 87: 92–98.[Abstract/Free Full Text]

28. Horstman DJ, Fischer LG, Kouretas PC, Hannan RL, Rich GF. Role of nitric oxide in heparin-induced attenuation of hypoxic pulmonary vascular remodeling. J Appl Physiol. 2002; 92: 2012–2018.[Abstract/Free Full Text]

29. Patel RC, Handy I, Patel CV. Contribution of double-stranded RNA-activated protein kinase toward antiproliferative actions of heparin on vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 2002; 22: 1439–1444.[Abstract/Free Full Text]

30. Horiuchi A, Nikaido T, Ya-Li Z, Ito K, Orii A, Fujii S. Heparin inhibits proliferation of myometrial and leiomyomal smooth muscle cells through the induction of alpha-smooth muscle actin, calponin h1 and p27. Mol Hum Reprod. 1999; 5: 139–145.[Abstract/Free Full Text]

31. Reis ED, Roque M, Cordon-Cardo C, Drobnjk M, Fuster V, Badimon JJ. Apoptosis, proliferation, and p27 expression during vessel wall healing: time course study in a mouse model of transluminal femoral artery injury. J Vasc Surg. 2000; 3: 1022–1029.

32. Nathe TJ, Deou J, Walsh B, Bourns B, Clowes AW, Daum G. Interleukin-1 beta inhibits expression of p21(WAF1/CIP1) and p27(KIP1) and enhanced proliferation in response to platelet-derived growth factor-BB in smooth muscle cells. Arterioscler Throm Vasc Biol. 2002; 22: 1293–1298.[Abstract/Free Full Text]

33. Kiyokawa H, Kineman RD, Manova-Todorova KO, Soares VC, Hoffman ES, Ono M, Khanam D, Hayday AC, Frohman LA, Koff A. Enhanced growth of mice lacking the cyclin-dependent kinase inhibitor function of p27(Kip1). Cell. 1996; 85: 721–732.[CrossRef][Medline] [Order article via Infotrieve]

34. Nakayama K, Ishida N, Shirane M, Inomata A, Inoue T, Shishido N, Horii I, Loh DY, Nakayama K. Mice lacking p27(Kip1) display increased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors. Cell. 1996; 85: 707–720.[CrossRef][Medline] [Order article via Infotrieve]

35. Sun J, Marx SO, Chen HJ, Poon M, Marks AR, Rabbani LE. Role for p27(Kip1) in vascular smooth muscle cell migration. Circulation. 2001; 103: 2967–2972.[Abstract/Free Full Text]

36. Cool CD, Stewart JS, Werahera P, Miller GJ, Williams RL, Voelkel NF, Tuder RM. Three-dimensional reconstruction of pulmonary arteries in plexiform pulmonary hypertension using cell-specific markers. Evidence for a dynamic and heterogeneous process of pulmonary endothelial cell growth. Am J Pathol. 1999; 155: 411–419.[Abstract/Free Full Text]

37. Fero ML, Randel E, Gurley KE, Roberts JM, Kemp CJ. The murine gene p27Kip1 is haplo-insufficient for tumor suppression. Nature. 1998; 396: 177–180.[CrossRef][Medline] [Order article via Infotrieve]

38. Diez-Juan A, Andres V. The growth suppressor p27(Kip1) protects against diet-induced atherosclerosis. FASEB J. 2001; 15: 1989–1995.[Abstract/Free Full Text]

39. Yu Y, Fantozzi I, Remillard CV, Landsberg JW, Kunichika N, Platoshyn O, Tigno DD, Thistlethwaite PA, Rubin LJ, Yuan JX. Enhanced expression of transient receptor potential channels in idiopathic pulmonary arterial hypertension. Proc Natl Acad Sci U S A. 2004; 101: 13861–13866.[Abstract/Free Full Text]

40. Hirst SJ, Twort CH, Lee TH. Differential effects of extracellular matrix proteins on human airway smooth muscle cell proliferation and phenotype. Am J Respir Cell Mol Biol. 2000; 23: 335–344.[Abstract/Free Full Text]

41. Roque M, Cordon-Cardo C, Fuster V, Reis ED, Drobnjak M, Badimon JJ. Modulation of apoptosis, proliferation, and p27 expression in a porcine coronary angioplasty model. Atherosclerosis. 2000; 153: 315–322.[CrossRef][Medline] [Order article via Infotrieve]

42. Castellot JJ Jr, Wosng K, Herman B, Hoover RL, Albertini DF, Wright TC, Caleb BL, Karnovsky MJ. Binding and internalization of heparin by vascular smooth muscle cells. J Cell Physiol. 1985; 124: 13–20.[CrossRef][Medline] [Order article via Infotrieve]

43. Reilly CF, Fritze LMS, Rosenberg RD. Heparin inhibition of smooth muscle cell proliferation: a cellular site of action. J Cell Physiol. 1986; 129: 11–19.[CrossRef][Medline] [Order article via Infotrieve]

44. Lee SL, Wang WW, Joseph PM, Hales CA, Fanburg BL. Inhibitory effect of heparin on Serotonin-induced hyperplasia and hypertrophy of smooth muscle cells. Am J Respir Cell Mol Biol. 1997; 17: 78–83.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
IOVSHome page
Y.-B. Shui, J. M. Arbeit, R. S. Johnson, and D. C. Beebe
HIF-1: An Age-Dependent Regulator of Lens Cell Proliferation
Invest. Ophthalmol. Vis. Sci., November 1, 2008; 49(11): 4961 - 4970.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. D. Ochoa, H. Baker, S. Hasak, R. Matyal, A. Salam, C. A. Hales, W. Hancock, and D. A. Quinn
Cyclic Stretch Affects Pulmonary Endothelial Cell Control of Pulmonary Smooth Muscle Cell Growth
Am. J. Respir. Cell Mol. Biol., July 1, 2008; 39(1): 105 - 112.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
L. Yu, D. A. Quinn, H. G. Garg, and C. A. Hales
Deficiency of the NHE1 Gene Prevents Hypoxia-induced Pulmonary Hypertension and Vascular Remodeling
Am. J. Respir. Crit. Care Med., June 1, 2008; 177(11): 1276 - 1284.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
E. Al-Ansari, H.-k. Du, L. Yu, C. D. Ochoa, H. G. Garg, D. A. Quinn, and C. A. Hales
Low-Molecular-Weight Heparin Inhibits Hypoxic Pulmonary Hypertension and Vascular Remodeling in Guinea Pigs
Chest, December 1, 2007; 132(6): 1898 - 1905.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
97/9/937    most recent
01.RES.0000188211.83193.1av1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, L.
Right arrow Articles by Hales, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, L.
Right arrow Articles by Hales, C. A.