Molecular Medicine |
From the Divisions of Cellular and Gene Therapy Products (Y.S., R.N., S.M., T.Y.), Biosignaling (K.F., K.I.), and Pharmacology (S.I., Y.O.), National Institute of Health Sciences (T.N.), Tokyo, Japan; and the Department of Pharmacology and Toxicology (R.N., M.S.), Toho University, Faculty of Pharmaceutical Sciences, Chiba, Japan.
Correspondence to Yoji Sato, PhD, Division of Cellular and Gene Therapy Products, National Institute of Health Sciences, 1-18-1 Kami-yoga, Setagaya, Tokyo 158-8501, Japan. E-mail yoji{at}nihs.go.jp
| Abstract |
|---|
|
|
|---|
gene diminished the effect of T3 on MGP expression. Aortic smooth muscle tissues from methimazole-induced hypothyroid rats (400 mg/L drinking water; 4 weeks) also showed a 68% decrease in the MGP mRNA level, as well as a 33% increase in calcium content compared with that from the control euthyroid animals, whereas hyperthyroidism (0.2 mg T3/kg IP; 10 days) upregulated MGP mRNA by 4.5-fold and reduced calcium content by 11%. Our findings suggest that a physiological concentration of thyroid hormone directly facilitates MGP gene expression in smooth muscle cells via thyroid hormone nuclear receptors, leading to prevention of vascular calcification in vivo.
Key Words: calcium gene expression nuclear receptors vascular smooth muscle thyroid hormone
| Introduction |
|---|
|
|
|---|
25% of hypothyroid patients have diastolic hypertension,6 the mechanism for the altered systemic vascular resistance under an abnormal thyroid hormone status is not well understood. To date, a loss of nongenomic vasodilating action of thyroid hormone7 and atherosclerosis attributable to hypercholesterolemia8 have been associated with the increased systemic vascular resistance under hypothyroidism.9 Recently, mRNAs for TR isoforms were identified in aortic and coronary smooth muscle cells, suggesting that a direct genomic action of thyroid hormone may play a significant role in vascular smooth muscle.10 Although extremely high concentrations of thyroid hormone are known to regulate expression of several genes in vascular smooth muscle cells,10,11 the physiological and direct target genes of thyroid hormone in vascular smooth muscle cells are not known.9 Arterial calcification is a common pathological feature of vascular sclerosis, as well as a variety of metabolic disorders such as diabetes and renal disease. Decades ago, cretinism was found to be associated with arterial calcification, especially when patients did not receive sufficient thyroid hormone replacement therapy.12 However, the mechanism for the calcification in cretins has been to date unclear. A subset of vascular smooth muscle cells, named "calcifying vascular cells," was demonstrated recently to undergo osteogenic and chondrogenic differentiation in culture, indicating that some vascular smooth muscle cells still have the potential for multiple lineages.13 Because thyroid hormone plays a critical role in bone remodeling,14 we hypothesized that thyroid hormone is also associated with vascular calcification. To test this hypothesis, we investigated the effect of thyroid hormone on vascular smooth muscle calcification and expression profiles of calcification-associated genes in vitro and in vivo, and identified matrix Gla protein (MGP) gene as a target of thyroid hormone in vascular smooth muscle cells.
| Materials and Methods |
|---|
|
|
|---|
-Actinpositive rat aortic smooth muscle cells (RAOSMCs) were obtained from Cell Applications, Inc. and were cultured on 6-well cell culture plates at 37°C in a humidified atmosphere of 95% air/5% CO2 in growth medium (GM; Dulbeccos Minimal Essential Medium [DMEM] supplemented with 10% FCS, 100 U/mL penicillin, and 100 µg/mL streptomycin). Cells up to passage 5 were used for the experiments. The culture media were changed every 48 hours. Thyroid hormonedepleted serum was prepared as described previously.15 To evaluate effects of thyroid hormone on gene expression profiles of the synthetic phenotype of RAOSMCs, the cells at 50% of confluence were cultured in thyroid hormonedepleted medium (TDM; DMEM containing 10% thyroid hormone-depleted serum, 100 U/mL penicillin, and 100 µg/mL streptomycin) for 2 days and stimulated with 3',3,5-triiodo-L-thyronine (T3) for another 2 days. The contractile form of RAOSMCs was obtained by culturing confluent cells in serum-free differentiation medium (DM; DMEM supplemented with 1x ITS-X (Invitrogen), 5 mmol/L taurine, 100 U/mL penicillin, and 100 µg/mL streptomycin) for 10 days, followed by T3 treatment for 2 days. The transition of the cell phenotype in DM was confirmed by immunoblotting for nonmuscle myosin heavy chain (SMemb) and smooth muscle myosin heavy chain-2 (SM2). To examine effects of thyroid hormone on calcium accumulation, confluent RAOSMCs were cultured as described previously16 in TDM with or without 100 ng/mL recombinant human bone morphogenic protein-2 (rBMP2; R & D Systems) in a cell culture dish with or without collagen type IV (Col4) coating (BD Biosciences). Supplementation with ß-glycerophosphate, which facilitates smooth muscle cell calcification,17 was omitted because of a decrease in the signal-to-background ratio. Cells were subsequently stimulated with T3 for 5 days. The concentrations of free T3 (fT3) and free L-thyroxine (T4) in the serum-containing medium were determined using chemiluminescent enzyme immunoassay at a clinical diagnostic laboratory. The detection limits for fT3 and fT4 were 1.1 pmol/L and 1.7 pmol/L, respectively. Human coronary artery smooth muscle cells (HCASMCs; Cell Applications, Inc.) were maintained and transformed into the contractile phenotype before treatment with T3 by culturing for 7 days in serum-free HCASMC DM (311D-500; Cell Applications, Inc) according to manufacturer instructions.
Animals
Male Sprague-Dawley rats (Japan SLC; Shizuoka, Japan) were maintained on rodent chow (Certified diet MF; Oriental Yeast, Co) and given water ad libitum. For generation of hypothyroid animals, methimazole (MMI; 400 mg/L) was added to the drinking water for 4 weeks. Hyperthyroid rats were generated by daily injection of T3 (0.2 mg/kg body weight IP) for 10 days. Plasma concentrations of fT3 and fT4 were measured, as described above. After the treatment with MMI or T3, the thoracic aorta was isolated. Animals were 12 weeks old when killed. Aortic smooth muscle tissue for measurements of calcium accumulation and gene expression was cleared of fat, connective tissue, and an endothelium and stored at 80°C until use. For pathological examination, the aortic tissue was fixed in 10% formaldehyde. Transverse aortic sections were taken from the fixed tissue and stained with hematoxylin and eosin. All animals were treated in accordance with laboratory animal care guidelines of National Institute of Health Sciences at Tokyo.
Calcium Accumulation
Calcium content in RAOSMCs and rat aortic smooth muscle tissues were determined as described previously16 using o-cresolphthalein complexone method. Protein concentration was determined using Bio-Rad protein assay reagent and BSA as a standard.
Real-Time Quantitative RT-PCR
Total RNA was isolated from smooth muscle cells and tissues using Sepasol reagent (Nakalai Tesque) containing 0.1 mg/mL glycogen (Roche Diagnostics) and was treated with DNaseI (Promega) according to the manufacturer protocols. To quantitate specific mRNA levels, the real-time progress of target sequence-specific amplification was monitored during RT-PCR using TaqMan chemistry and PRISM7000 Sequence Detection System (Applied Biosystems). An 18S ribosomal RNA was used as an internal control for each RNA level. Sequences of the primers and the TaqMan probes are listed in supplemental Table I (available online at http://circres.ahajournals.org).
Western Blot Analysis
RAOSMCs and aortic smooth muscle tissues were homogenized in lysis buffer as described previously.18 After measuring protein concentrations, proteins were separated by SDS-PAGE and blotted onto polyvinylidene fluoride membranes, which were incubated with anti-SMemb or anti-SM2 monoclonal antibodies (Yamasa) or an anti-MGP polyclonal antibody (TransGenic) for 1 hour at room temperature. Subsequently, membranes were incubated with the secondary antibody conjugated with horseradish peroxidase for 1 hour. Signals were visualized and quantified using ECL Plus system (Amersham Biosciences) and LAS-3000 Imaging System (FUJIFILM), respectively.
Promoter Activity Assay
Fragments between 1752 and 1 of 5' flanking sequence of the MGP gene exon 1 and between 1895 and 1 of 5' flanking sequence of the stanniocalcin-1 (STC1) gene exon 1 were amplified using rat tail genomic DNA as a template. The primers for PCR amplifications were designed as based on the nucleotide sequences (MGP forward: CAAGGGTACCGGTTTGAGAGACCACGAGAC; MGP reverse: CTTGAAGCTTCCTGTGAGTCTGCCTCTGTG; STC1 forward: CAAGCTCGAGCCCCTGATATTTCAGCATGG; STC1 reverse: CTTGAAGCTTAGGTGAGGATTTGAGGAGG). The amplicons were subcloned into the firefly luciferase expression vector pGL3-Basic (Promega). RAOSMCs in the contractile state, grown on a 24-well plate, were transiently cotransfected with 225 ng/well of each promoter luciferase plasmid and 75 ng/well of phRL-TK control plasmid (Promega) using FuGene6 (Roche). Three hours after transfection, cells were incubated with or without T3. The luciferase activity was defined as a ratio of the firefly luciferase signal to the renilla luciferase signal, which was measured with Dual-Luciferase Reagent (Promega). The transfection efficiency of the plasmids was estimated to be 1% to 10% of the total RAOSMCs, as assessed by transfection experiments with an enhanced green fluorescent protein expression vector pEGFP-N1 (BD Biosciences Clontech; data not shown).
RNA Interference Against TR
RAOSMCs in the synthetic form were transiently transfected with StealthRNAi (Invitrogen) specific for TR
gene (sense: CCAGAAGAACCUCCAUCCCACCUAU; antisense: AUAGGUGGGAUGGAGGUUCUUCUGG) or StealthRNAi negative control medium GC (Invitrogen) using Lipofectamine 2000 (Invitrogen), according to manufacturer instructions and incubated in TDM for 2 days. Cells were then treated with or without T3 (15 pmol/L fT3) for another 2 days. Total RNA was isolated from cells before and after T3 treatment for mRNA determinations.
Statistics
Data were expressed as means±SEM unless otherwise indicated. Data were analyzed for statistical significance by Student t test or ANOVA with Student-NewmanKeuls test as a post hoc test. Significance was imparted at the P<0.05 level.
| Results |
|---|
|
|
|---|
10 to 100 pmol/L19 and because T4 has
10-fold lower affinity for TRs than that of T3. In vascular smooth muscle cells, T4 is known to be converted to T3 by type II iodothyronine deiodinase,10 although the conversion rate in vivo is not clear. Assuming that X% (X=0 to 100) of T4 is processed to T3 at the site of action in vivo and that the affinity of T4 for TRs is one tenth of that of T3, the total activity of thyroid hormones in euthyroid rat plasma should be equivalent to that of 6.9 to 31 pmol/L [4.2+27xX/100+27x(1X/100)/10] of fT3 alone. The supplementation of T3 to TDM at 1 nmol/L of total concentration resulted in an increase in fT3 to 15±1 pmol/L (mean±SD), with a slight increase in fT4, therefore, it was regarded within a euthyroid range.
|
T3-Induced Gene Expression and Calcification in Cultured RAOSMCs
Vascular smooth muscle cells show a high degree of plasticity and are able to interchange between a differentiated, contractile phenotype and a proliferating, synthetic phenotype. Therefore, we first examined the effects of T3 on expression profiles of calcification-associated genes in both phenotypes. RAOSMCs in GM predominantly expressed a marker of synthetic phenotype: SMemb. The replacement of the medium with DM reduced the protein level of SMemb to 28% and increased SM2 expression by 11.6-fold (online Figure I), indicating the transition of the phenotype. In the synthetic phenotype, T3 (1 nmol/L total T3=15 pmol/L fT3) led to upregulation of mRNAs for MGP and STC1x3.3-fold and 1.3-fold, respectively (Figure 1A), whereas osteopontin (OPN) was downregulated by 21%. The mRNA levels of BMP2, bone morphogenic protein-4 (BMP4), osteonectin (ON), and core binding factor
1 (Cbfa1; also known as Runx2 or Osf2) were not significantly altered by the T3 treatment. Specific signals for osteocalcin and bone sialoprotein mRNA were not detected by several independent primer sets in all experiments of the present study, presumably because of their low abundance in vascular smooth muscle cells. In the contractile phenotype in DM, T3 (15 pmol/L) induced upregulation of MGP and BMP4x3.2-fold and 1.6-fold, respectively (Figure 1B). A higher concentration of T3 (1 nmol/L) resulted in a further increase in the MGP mRNA level and a significant upregulation of STC1 mRNA, indicating the dose dependency of the effects. Messenger RNA levels of OPN, BMP2, ON, STC1, and Cbfa1 in the contractile phenotype were not significantly altered by the T3 treatment. Among the calcification-associated genes, MGP and STC1 genes were commonly upregulated by T3 in both phenotypes, suggesting that these two genes were relatively essential in RAOSMCs as targets of thyroid hormone.
|
Because the effect of MGP on calcification and osteogenic differentiation of vascular smooth muscle cells depends on availability of BMP2 and Col4,20,21 cell calcification was determined in the absence or presence of these factors. In the absence of rBMP2 and Col4 coating, treatment with T3 (1 nmol/L total T3=15 pmol/L fT3) for 5 days resulted in an increase in calcium content by 39% in RAOSMCs (Figure 2). The same treatment tended to have the similar effect on cells in a Col4-coated vessel in the absence of rBMP2. In contrast, T3 led to a significant decrease in cellular calcium by 10% in the presence of rBMP2 and Col4-coating.
|
Transcriptional Regulation of MGP and STC1 Genes by T3
To test a hypothesis that the promoters of MGP and STC1 genes were under regulation of thyroid hormone, RAOSMCs were transiently transfected with luciferase reporters under control of the MGP and STC1 promoters. The 5' flanking sequences of MGP and STC1 genes have been submitted to NCBI (accession numbers AY750958 and AY750959, respectively). Transcription Element Search System (TESS)22 revealed that consensus sequences of the thyroid hormone response element were located in 585 to 600 (TGTACCCCAATGAACC) and 1009 to 1024 (TGGAGACAGGAGGACA) bases upstream of the putative transcription initiation sites of MGP and STC1 genes, respectively. Treatments of the cells with T3 (15 pmol/L to 1 nmol/L) for 48 hours resulted in significant increases in transcriptional activity compared with vehicle treatment (Figure 3).
|
Regulation of MGP and STC1 Expression via TRs
Arterial smooth muscle cells express TR
1 and TR
2 nuclear receptor isoforms strongly and TRß1 and TRß2 relatively weakly.10 To evaluate the involvement of TRs in the T3-induced upregulation of MGP and STC1 mRNAs, RNA interference (RNAi) was performed using StealthRNAi specific for the TR
gene encoding TR
1 and TR
2. The RNAi in RAOSMCs for 2 days significantly attenuated mRNA expression of TR
1 and TR
2 by 66% and 57%, respectively, compared with the controls (Figure 4). The RNAi was also associated with upregulation of MGP mRNA by 32% compared with the controls, suggesting that unliganded TR
1 or TR
2, which has no affinity for thyroid hormones, had an inhibitory effect on the expression of MGP. The mRNA level of STC1 was not altered by the RNAi. Incubation with 15 pmol/L fT3 for the following 2 days facilitated the expression of MGP and STC1 in the control group, whereas no significant effect of T3 on MGP and STC1 gene expression was detected in the RNAi group. T3 had no effect on the expression of the TR
isoforms.
|
Calcium Accumulation in Hypothyroid Rat Aorta
As examined by hematoxylin-eosin staining, the cross-sections of aorta from rats treated with MMI for 4 weeks did not show obvious calcified foci (Figure 5A). However, o-cresolphthalein complexone experiments indicated that the 4-week treatment with MMI significantly increased the calcium content in the rat aortic smooth muscle tissues by 33% compared with that of euthyroid animals (Figure 5B). Quantitative RT-PCRs revealed that mRNA levels of MGP, BMP4, ON, and Cbfa1 were downregulated by 68%, 87%, 69%, and 72%, respectively, by the MMI treatment. OPN, BMP2, and STC1 mRNA levels were not significantly altered (Figure 5C). MMI also attenuated protein expression of MGP by 54% (Figure 5D). Calcified foci were not observed even in aortic cross-sections from rats treated with MMI for 12 weeks (online Figure II), suggesting that the calcification was not progressive.
|
Calcium Content in Hyperthyroid Rat Aorta
Hyperthyroidism elicits pronounced vascular relaxation.9 However, the effect of hyperthyroidism on vascular calcification has been unclear. Therefore, it is of interest to compare effects of hyperthyroidism on the expression profiles of calcification-associated genes with those of hypothyroidism. In contrast to the aortic smooth muscle from hypothyroid rats, daily injections of T3 for 10 days led to a decrease in the calcium content in the rat aortic smooth muscle tissues by 11% compared with that of euthyroid animals (Figure 6A). Quantitative RT-PCRs showed that mRNA levels of MGP, OPN, and BMP2 were upregulated by 4.5-fold, 4.9-fold, and 3.4-fold, respectively, by the T3 treatment, whereas hyperthyroidism resulted in a significant decrease in the level of STC1 mRNA (Figure 6B).
|
Upregulation of MGP mRNA in Cultured HCASMCs
To demonstrate that thyroid hormone regulates MGP gene expression in vascular smooth muscle cells of a different species, we determined MGP mRNA levels in HCASMCs in the presence and absence of T3. Treatment with a physiological concentration (15 pmol/L) of T3 for 2 days led to a significant increase in MGP mRNA by 40% (1.0±0.07 [hypothyroid 0 pmol/L T3] versus 1.40±0.13 [euthyroid 15 pmol/L T3] in an arbitrary unit; n=12).
| Discussion |
|---|
|
|
|---|
gene expression led to a loss of responsiveness of the MGP gene to T3, suggesting that the effect of T3 is based on a genomic action via TR
1. Furthermore, in vivo hormone levels were positively and negatively associated with the expression of MGP and calcification in vascular smooth muscle, respectively. Because aortic smooth muscle from hypothyroid rats showed no obvious neointimal formation, the vascular calcification under the hypothyroidism is likely to be similar to that of media sclerosis. In aortic smooth muscle from hypothyroid rats, expression levels of calcification activators BMP4, ON, and Cbfa1 were decreased, whereas hyperthyroidism upregulated another calcification activator BMP2. However, calcium content in aortic smooth muscle was increased in hypothyroidism, and the opposite was observed in hyperthyroidism, suggesting that the expression or function of calcification inhibitors, such as MGP and OPN, are more dominant for the phenotypic outcome in vivo, compared with those of the calcification activators.
MGP is a mineral-binding extracellular matrix protein synthesized by vascular smooth muscle cells and chondrocytes. Luo et al have shown that ablation of MGP gene in mice causes extensive and lethal calcification and cartilaginous metaplasia of the media of all elastic arteries, indicating that MGP has an inhibitory effect on media calcification in vivo.23 In contrast, in the same study, morphological analysis showed that heterozygous MGP knockout mice, which had a similar decrease in an arterial MGP level to that by the MMI treatment in the present study, had no obvious calcified foci in arterial smooth muscle. However, this does not necessarily imply that the heterozygous ablation of MGP gene does not affect calcium content in arteries because biochemical quantification for tissue calcium has not been performed. Thus, it is still possible that there is a dose-response relationship between MGP and media calcification, and that an
50% reduction of MGP results in some increase in calcium content, although it may not be morphologically evident.
The extracellular environment around smooth muscle cells is known to determine a functional role of MGP. Namely, calcification of vascular smooth muscle cells in the presence of a relatively high concentration of BMP2 was inhibited by MGP, whereas calcification of vascular smooth muscle cells under a low concentration of BMP2 was stimulated by MGP.20 Moreover, extracellular matrix proteins, especially Col4, have significant influence on MGP function and vascular calcification.21 In fact, the effect of T3 on calcification of RAOSMCs was determined by these environmental factors. Therefore, these results suggest that T3 regulates smooth muscle cell calcification, at least partly, by promoting MGP expression, although not only vascular cells but also migratory adventitial pericytic myofibroblasts and circulating skeletal progenitors may have some additional contributions to vascular calcification in vivo.24
STC1 is a mammalian homolog of stanniocalcin, the fish calcium/phosphate-regulating polypeptide that inhibits calcium flux into cells and stimulates phosphate reabsorption. In the present study, gene transcription of STC1 appeared to be regulated by T3 via TR
in a dose-dependent manner. However, the highest mRNA expression of STC1 tended to be achieved at a euthyroid status in vitro and in vivo, and hyperthyroidism significantly attenuated the STC1 mRNA expression in vivo. Recently, STC1 was shown to accelerate osteoblast development in an autocrine/paracrine manner in cultured fetal rat calvaria cells.25 Therefore, the downregulation of STC1 may also contribute to the low calcium content in aortic smooth muscle of hyperthyroid rats, although the mechanism that offsets the increase in the STC1 gene transcription remains to be elucidated.
OPN is known to inhibit or promote vascular smooth muscle calcification in vivo in a phosphorylation-dependent manner.26 Therefore, the changes in its expression in the synthetic form of RAOSMCs and in smooth muscle tissue of hyperthyroid rats may be also associated with the effect of thyroid hormone on calcium accumulation. However, as shown in the in vitro and MMI experiments, a physiological concentration of thyroid hormone is unlikely to target OPN gene directly, at least in the contractile form of aortic smooth muscle cells.
BMP2 was upregulated by hyperthyroidism in vivo, whereas BMP4 was downregulated by MMI-induced hypothyroidism. BMP2 is know to antagonize the effect of MGP,20 and BMP4 has been suggested to play a significant role as a cytokine, a growth factor or a media-calcification promoter in vascular lesions of calciphylaxis.27 The mRNA levels of ON and Cbfa1 were also decreased in hypothyroid rat aortic smooth muscle. With the exception of BMP4, these changes in vivo did not follow on from the in vitro experiments, suggesting that the alterations were not attributable to a direct effect of thyroid hormone on vascular smooth muscle cells. Because physiological concentrations of thyroid hormones upregulated BMP4 in the contractile form of RAOSMCs and in vivo (hypothyroid versus euthyroid), BMP4 may be another direct target of thyroid hormone in aortic smooth muscle cells. However, the expected influences of the changes in all the calcification activators above were apparently masked, aforementioned, indicating their minor roles in vascular calcification, compared with those of calcification inhibitors.
In summary, our findings, for the first time, demonstrate that a physiological concentration of thyroid hormone has significant genomic effects on vascular smooth muscle cells in vitro and in vivo, which are associated with vascular calcification. Most notably, a decrease in thyroid hormone and the concomitant increase in vascular calcification in vivo are marked by a decrease in the level of MGP expression, suggesting that a physiological concentration of thyroid hormone has a direct protective role against vascular smooth muscle calcification in vivo. Although vascular calcification has been thought to be benign, arterial calcification should alter vascular compliance. Thus, it is possible that the increased vascular stiffness underlies the high systemic vascular resistance observed in hypothyroidism. Vascular calcification can lead to some other serious problems, including vascular stenosis, calciphylaxis, and even sudden death. Recently, a polymorphism in the promoter region of MGP gene was found to have a significant association with myocardial infarction in low-risk individuals and femoral calcification in the presence of atherosclerotic plaques, suggesting involvement of this mutation in coronary artery disease.28 In addition, a recent meta-analysis of coronary artery calcium scores suggested that the calcium score is an independent risk factor to predict coronary heart disease events.29 Therefore, further studies on the protective role of thyroid hormone and MGP against vascular smooth muscle calcification should provide insights into novel therapeutic strategies for the high systemic vascular resistance and blood pressure of hypothyroid patients, as well as for diseases associated with cardiovascular calcification such as diabetes, chronic renal insufficiency, and hypercholesterolemia.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Abe A, Yamamoto T, Isome M, Ma M, Yaoita E, Kawasaki K, Kihara I, Aizawa Y. Thyroid hormone regulates expression of shaker-related potassium channel mRNA in rat heart. Biochem Biophys Res Commun. 1998; 245: 226230.[CrossRef][Medline] [Order article via Infotrieve]
3. Gloss B, Trost S, Bluhm W, Swanson E, Clark R, Winkfein R, Janzen K, Giles W, Chassande O, Samarut J, Dillmann W. Cardiac ion channel expression and contractile function in mice with deletion of thyroid hormone receptor alpha or beta. Endocrinology. 2001; 142: 544550.
4. Boerth SR, Artman M. Thyroid hormone regulates Na+-Ca2+ exchanger expression during postnatal maturation and in adult rabbit ventricular myocardium. Cardiovasc Res. 1996; 31: E145E152.
5. Orlowski J, Lingrel JB. Thyroid and glucocorticoid hormones regulate the expression of multiple Na,K-ATPase genes in cultured neonatal rat cardiac myocytes. J Biol Chem. 1990; 265: 34623470.
6. Klein I, Ojamaa K. Thyroid hormone and the cardiovascular system. N Engl J Med. 2001; 344: 501509.
7. Ojamaa K, Klemperer JD, Klein I. Acute effects of thyroid hormone on vascular smooth muscle. Thyroid. 1996; 6: 505512.[Medline] [Order article via Infotrieve]
8. Hak AE, Pols HAP, Visser TJ, Drexhage HA, Hofman A, Witteman JC. Subclinical hypothyroidism is an independent risk factor for atherosclerosis and myocardial infarction in elderly women: the Rotterdam Study. Ann Intern Med. 2000; 132: 270278.
9. Klein I, Ojamaa K. Thyroid hormone: targeting the vascular smooth muscle cell. Circ Res. 2001; 88: 260261.
10. Mizuma H, Murakami M, Mori M. Thyroid hormone activation in human vascular smooth muscle cells: expression of type II iodothyronine deiodinase. Circ Res. 2001; 88: 313318.
11. Fukuyama K, Ichiki T, Takeda K, Tokunou T, Iino N, Masuda S, Ishibashi M, Egashira K, Shimokawa H, Hirano K, Kanaide H, Takeshita A. Downregulation of vascular angiotensin II type 1 receptor by thyroid hormone. Hypertension. 2003; 41: 598603.
12. Komar NN, Gabrielsen TO. Arterial calcification in adult cretins. Am J Roentgenol Radium Ther Nucl Med. 1967; 101: 202203.[Medline] [Order article via Infotrieve]
13. Tintut Y, Alfonso Z, Saini T, Radcliff K, Watson K, Bostrom K, Demer LL. Multilineage potential of cells from the artery wall. Circulation. 2003; 108: 25052510.
14. Bassett JH, Williams GR. The molecular actions of thyroid hormone in bone. Trends Endocrinol Metab. 2003; 14: 356364.[CrossRef][Medline] [Order article via Infotrieve]
15. Samuels HH, Stanley F, Casanova J. Depletion of L-3,5,3'-triiodothyronine and L-thyroxine in euthyroid calf serum for use in cell culture studies of the action of thyroid hormone. Endocrinology. 1979; 105: 8085.
16. Jono S, Nishizawa Y, Shioi A, Morii H. Parathyroid hormone-related peptide as a local regulator of vascular calcification. Its inhibitory action on in vitro calcification by bovine vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 1997; 17: 11351142.
17. Shioi A, Nishizawa Y, Jono S, Koyama H, Hosoi M, Morii H. Beta-glycerophosphate accelerates calcification in cultured bovine vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 1995; 15: 20032009.
18. Sato Y, Ferguson DG, Sako H, Dorn GW II, Kadambi VJ, Yatani A, Hoit BD, Walsh RA, Kranias EG. Cardiac-specific overexpression of mouse cardiac calsequestrin is associated with depressed cardiovascular function and hypertrophy in transgenic mice. J Biol Chem. 1998; 273: 2847028477.
19. Lazar MA, Chin WW. Nuclear thyroid hormone receptors. J Clin Invest. 1990; 86: 17771782.[Medline] [Order article via Infotrieve]
20. Zebboudj AF, Shin V, Bostrom K. Matrix GLA protein and BMP-2 regulate osteoinduction in calcifying vascular cells. J Cell Biochem. 2003; 90: 756765.[CrossRef][Medline] [Order article via Infotrieve]
21. Shin V, Zebboudj AF, Bostrom K. Endothelial cells modulate osteogenesis in calcifying vascular cells. J Vasc Res. 2004; 41: 193201.[CrossRef][Medline] [Order article via Infotrieve]
22. Schug J, Overton GC. TESS: Transcription Element Search Software on the WWW. In: Technical Report CBIL-TR-19971001-v0.0, Computational Biology and Informatics Laboratory, School of Medicine, University of Pennsylvania, 1997: 110.
23. Luo G, Ducy P, McKee MD, Pinero GJ, Loyer E, Behringer RR, Karsenty G. Spontaneous calcification of arteries and cartilage in mice lacking matrix GLA protein. Nature. 1997; 386: 7881.[CrossRef][Medline] [Order article via Infotrieve]
24. Vattikuti R, Towler DA. Osteogenic regulation of vascular calcification: an early perspective. Am J Physiol Endocrinol Metab. 2004; 286: E686E696.
25. Yoshiko Y, Maeda N, Aubin JE. Stanniocalcin 1 stimulates osteoblast differentiation in rat calvaria cell cultures. Endocrinology. 2003; 144: 41344143.
26. Jono S, Peinado C, Giachelli CM. Phosphorylation of osteopontin is required for inhibition of vascular smooth muscle cell calcification. J Biol Chem. 2000; 275: 2019720203.
27. Griethe W, Schmitt R, Jurgensen JS, Bachmann S, Eckardt KU, Schindler R. Bone morphogenic protein-4 expression in vascular lesions of calciphylaxis. J Nephrol. 2003; 16: 728732.[Medline] [Order article via Infotrieve]
28. Herrmann SM, Whatling C, Brand E, Nicaud V, Gariepy J, Simon A, Evans A, Ruidavets JB, Arveiler D, Luc G, Tiret L, Henney A, Cambien F. Polymorphisms of the human matrix gla protein (MGP) gene, vascular calcification, and myocardial infarction. Arterioscler Thromb Vasc Biol. 2000; 20: 23862393.
29. Pletcher MJ, Tice JA, Pignone M, Browner WS. Using the coronary artery calcium score to predict coronary heart disease events. A systematic review and meta-analysis. Arch Intern Med. 2004; 164: 12851292.
This article has been cited by other articles:
![]() |
Y. Kanno, T. Into, C. J. Lowenstein, and K. Matsushita Nitric oxide regulates vascular calcification by interfering with TGF-{beta} signalling Cardiovasc Res, January 1, 2008; 77(1): 221 - 230. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |