Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2005;97:482-487
Published online before print August 4, 2005, doi: 10.1161/01.RES.0000179775.04114.45
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
97/5/482    most recent
01.RES.0000179775.04114.45v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Partovian, C.
Right arrow Articles by Simons, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Partovian, C.
Right arrow Articles by Simons, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITRIC OXIDE
Related Collections
Right arrow Endothelium/vascular type/nitric oxide
(Circulation Research. 2005;97:482.)
© 2005 American Heart Association, Inc.


Integrative Physiology

PKC{alpha} Activates eNOS and Increases Arterial Blood Flow In Vivo

Chohreh Partovian, Zhenwu Zhuang, Karen Moodie, Michelle Lin, Noriyuki Ouchi, William C. Sessa, Kenneth Walsh, Michael Simons

From the Angiogenesis Research Center and Section of Cardiology (C.P., Z.Z., K.M., M.S.), Dartmouth Medical School, Dartmouth-Hitchcock Medical Center, Lebanon, NH; the Molecular Cardiology/Whitaker Cardiovascular Institute (N.O., K.W.), Boston University School of Medicine, Mass; and the Department of Pharmacology and Molecular Cardiobiology Program (M.L., W.C.S.), Yale University School of Medicine, New Haven, Conn.

Correspondence to Dr Michael Simons, Section of Cardiology, Dartmouth-Hitchcock Medical Center, One Medical Center Dr, Lebanon, NH 03756. E-mail michael.simons{at}dartmouth.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Endothelial nitric oxide synthase (eNOS) plays an important role in control of vascular tone and angiogenesis among other functions. Its regulation is complex and has not been fully established. Several studies have emphasized the importance of phosphorylation in the regulation of eNOS activity. Although it is commonly accepted that protein kinase C (PKC) signaling inhibits eNOS activity by phosphorylating Thr497 and dephosphorylating Ser1179, the distinct role of different PKC isoforms has not been studied so far. The PKC family comprises roughly 12 different isozymes that activate distinct downstream pathways. The present study was designed to investigate the role of PKC{alpha} isoform in regulation of eNOS activity. Overexpression of PKC{alpha} in primary endothelial cells was associated with increased eNOS-Ser1179 phosphorylation and increased NO production. Inhibition of PKC{alpha} activity either by siRNA transfection or by overexpression of a dominant negative mutant resulted in a marked decrease in FGF2-induced Ser1179 phosphorylation and NO production. In vivo, PKC{alpha} transduction in rat femoral arteries resulted in a significant increase in the resting blood flow that was suppressed by treatment with L-NAME, an eNOS inhibitor. In conclusion, these data demonstrate for the first time that PKC{alpha} stimulates NO production in endothelial cells and plays a role in regulation of blood flow in vivo.


Key Words: protein kinase C • blood flow • nitric oxide synthase • endothelial cells


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Recently, several studies have emphasized the importance of phosphorylation in the regulation of endothelial nitric oxide synthase (eNOS) activity.1 Most is known about the functional consequences of phosphorylation of a serine residue in the reductase domain (Ser1177 in human sequence and Ser1179 in bovine sequence) and a threonine residue within the CaM-binding domain (Thr495 in human eNOS sequence and Thr497 in bovine sequence). In unstimulated cultured endothelial cells, although the Ser1179 residue is not phosphorylated, the Thr497 is constitutively phosphorylated. Following application of various stimuli such as vascular endothelial growth factor (VEGF),2,3 estrogen,4 insulin,5 bradykinin,6 or fluid shear stress7 the Ser1179 site is rapidly phosphorylated, which leads to increased enzyme activity and increased nitric oxide (NO) production. The kinases involved in this process vary with the stimuli applied. Although VEGF mainly phosphorylates Ser1179 via protein kinase B{alpha}/Akt-1,8 shear stress elicits eNOS phosphorylation on this residue by activating Akt-19 and protein kinase A.7 Other kinases such as AMP-activated protein kinase10 and CaM-dependent kinase II6 also have the ability to phosphorylate the Ser1179 site. The Thr497 residue is known as a negative regulatory site, its phosphorylation being associated with a decrease in the enzyme activity. It has been suggested that constitutively active kinase that phosphorylates eNOS at Thr497 is most probably protein kinase C (PKC).3,6,11 The PKC family comprises roughly 12 different isozymes, which are broadly classified by their activation characteristics. The conventional PKC isozymes ({alpha}, ßI, ßII, and {gamma}) are Ca2+- and lipid-activated, whereas the so-called novel isozymes ({epsilon}, {theta}, {eta}, and {delta}) and atypical isozymes ({zeta}, {iota}, v, and µ) are Ca2+-independent but activated by distinct lipids.12 Although it is commonly accepted that PKC signaling inhibits eNOS activity in endothelial cells, the distinct role of different PKC isoforms has not been studied so far. The aim of the present study was to analyze the role of PKC{alpha}, one of the major PKC isoforms expressed in endothelial cells, in regulation of eNOS activity in vitro and in vivo.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
Bovine aortic endothelial cells (BAEC) were purchased from Clonetics (BioWhittaker, Inc, Walkersville, Md) and propagated in DMEM medium (Invitrogen, Carlsbad, Calif) supplemented with 10% fetal bovine serum (FBS), penicillin and streptomycin. Human umbilical vein endothelial cells (HUVEC) also purchased from Clonetics were propagated in EGM-2 medium (Clonetics) according to manufacturer’s instructions. Primary mice cardiac endothelial cells were isolated as previously described.13 Briefly the hearts of both wild-type and knockout (Akt-1–/–) mice were harvested, minced finely with scissors and then digested in 25 mL collagenase 0.2% (wt/vol) at 37°C for 45 minutes. The crude cell preparation was pelleted and resuspended in Dulbecco’s phosphate-buffered saline (DPBS). The cell suspension was incubated with PECAM-1 coated beads (IgG Dynal beads from Dynal Corp., Great Neck, NY) at room temperature for 10 minutes with end-over-end rotation. Using a magnetic separator, the bead-bound cells were recovered, washed with DMEM-20% FBS, suspended in 10 mL complete culture medium [DMEM containing 20% FBS, supplemented with 100 µg/mL heparin, 100 µg/mL EC growth supplement (ECGS; Biomedical Technologies, Stoughton, Mass) nonessential amino acids, sodium pyruvate, L-glutamine, and antibiotics at standard concentrations] and then plated in a fibronectin-coated tissue-culture dish.

Adenoviral Constructs and Cell Transduction
The wild-type PKC{alpha} adenoviral construct was a gift from Dr Motoi Ohba (Showa University, Tokyo, Japan) and has been previously described.14 The virus particle titer was 3.55x109 plaque forming units (pfu) per ml. The dominant negative PKC{alpha} construct which was generated by replacing the conserved lysine in the ATP binding domain with arginine (a gift from Dr Dan Rosson, Lankenau Medical Research Center, Wynnewood, Pa) was subcloned in an adenoviral vector (first generation, E1 and E3 deleted) driven by hCMV promoter and also containing green fluorescent protein (GFP). The virus particle titer was 3.7x1010 pfu /mL.

BAEC or mice cardiac endothelial cells were transduced with different adenoviral constructs in half a volume of 0.5% FBS-DMEM. After 4 hours, the cells were completed with half a volume of full-serum medium for overnight incubation. The day after, cells were washed with PBS and incubated in full-serum medium. In these conditions, the transduction efficiency was typically >80% as determined by GFP expression. The experimentations were performed between 48 and 72 hours after transduction.

Specific Silencing of Gene Expression by siRNA in HUVEC
The DNA target sequences were as follows: AAGCACAAGUUCAAAAUCCAC for PKC{alpha} and AAGCCCCUAAAGACAAUGAAG for PKC{epsilon}. Twenty-one-base RNA was synthesized by Xeragon Inc. For annealing, 40 µmol/L of each strand was incubated in annealing buffer containing 100 mmol/L potassium acetate, 30 mmol/L HEPES-KOH, 2 mmol/L magnesium acetate (pH 7.4) for 1 minute at 90°C followed by 1 hour at 37°C. Cells were at 80% to 90% confluence at the time of the transfection (transfection kit from Targeting Systems) with 75 pmols of PKC{alpha} or control (Cy3-labeled luciferase) dsRNA. The media was replaced with fresh complete media 24 hours after transfection. Analyses for testing the silencing of PKC{alpha} gene were performed between 48 and 72 hours after transfection, including Western blotting for total PKC{alpha} and PKC{alpha} kinase activity.

PKC{alpha} Kinase Activity Assay
PKC{alpha} was immunoprecipitated from the cell lysates with 2 µg of anti-PKC{alpha} antibody (Santa Cruz Biotech. Inc) and 30 µL of protein G plus/protein A agarose suspension (Calbiochem) and used in an in vitro kinase assay as previously described.15 The reaction mixture (30 µL) contained 50 µmol/L ATP and 5 µCi of [{gamma}-32P]ATP (PerkinElmer Life Sciences), 1 mmol/L dithiothreitol, 5 mmol/L MgCl2, 25 mmol/L Tris-HCl (pH 7.5), 20 µmol/L phosphatidylserine, 10 µmol/L diolein, and 0.2 mmol/L CaCl2 and PKCß1 optimal peptide as substrate (100 µmol/L) (Calbiochem). Reactions were started by addition of reaction mixture to the immunoprecipitates and incubated at 30°C for 10 minutes. The reaction was stopped by spotting onto P81 phosphocellulose paper. The filters were washed 3x in 0.75% phosphoric acid and once in acetone and the radioactivity was determined in a scintillation mixture.

Western Blotting
Cells were lysed in RIPA buffer (PBS 1X, Nonidet P-40 1%, Sodium Deoxycholate 0.5% and SDS 0.1%) containing protease inhibitor cocktail (Complete, Roche). Thirty to 50 µg of proteins were resolved by 10% or 7.5% SDS PAGE and transferred to Immobilon membranes (Millipore). The membranes were probed with various primary antibodies followed by incubation with HRP-conjugated secondary antibodies (Vector Laboratories, Inc) as appropriate. Proteins were visualized by enhanced chemiluminescence, according to the instructions of the manufacturer (Pierce). The following primary antibodies have been used: anti-Akt antibodies, antiphospho-eNOS-Ser1179 and antiphospho-p44/42 MAPK (phospho-ERK) from Cell Signaling Technology; antiphospho-eNOS-Thr495 from Upstate Cell Signaling; anti-eNOS from Santa Cruz Biotechnology; anti-PKC{alpha} from BD Transduction Laboratories.

Measurement of NO Release From Cells Transduced With Different Adenoviral Constructs
BAEC were plated in 6-well plates and then transduced with WT- or DN-PKC{alpha} or GFP as control. Two days later, the medium was aspirated and replaced with 2 mL of starvation medium. The cells were incubated for 12 hours and an aliquot of medium was taken for basal NO measurements, assayed as nitrite, the stable breakdown product of NO in aqueous medium. Nitrite levels were measured using a Sievers NO analyzer. Cells were collected and lysed for protein assay. For the stimulated NO release, transduced cells were starved in serum-free medium overnight. The day after the medium was aspirated and replaced by 2 mL of fresh serum-free medium. After 1 hour, an aliquot was taken for background nitrite measurements and the cells were stimulated with PBS or 50 ng/mL of FGF2 and incubated for an additional 30 minutes. An aliquot of medium was again taken for nitrite measurement and the cells collected and lysed for protein assay.

In Vivo Gene Transfer
All animal experiments were approved by the Institutional Animal Care and Use Committee. Twenty-four ({approx}8 animals in each group) male Sprague Dawley rats (The Jackson Laboratory, Bar Harbor, Me), aged between 6 and 7 weeks and weighing {approx}350 g were used in this study. The animals were anesthetized with intraperitoneal injection of Ketamine (80 mg/kg) and Xylasine (8 mg/kg). Femoral artery and superficial epigastric artery were isolated. After temporary clamping of the proximal and distal femoral artery, 20 µL of adeno-GFP or adeno-WT-PKC{alpha} was infused into the femoral artery via superficial epigastric artery and incubated for 15 minutes. Viral titer was brought to 3x109 pfu/ml for each construct. After incubation, the superficial epigastric artery was permanently ligated and clamps on the femoral artery were removed to restore femoral blood flow. Three days after surgery, femoral-artery blood flow was measured using a doppler probe (Transonic Systems Inc). Blood pressure and heart rate were measured using a Millar transducer inserted into the carotid artery. L-NAME was infused as a single bolus injection of 20 µg/kg via the jugular vein. After flow measurements, femoral arteries were harvested, immediately frozen in liquid nitrogen, and kept at –80°C until analyzed. Samples were homogenized in a lysis buffer containing PBS 1X, Nonidet P-40 1%, Sodium Deoxycholate 0.5%, SDS 0.1% and protease inhibitor cocktail (Complete, Roche). Eighty µg of protein was subjected to SDS-PAGE and Western blotting as previously described.

Statistical Analysis
Results are shown as mean±SEM. Differences between 2 groups were determined by Student t test and a 1-way ANOVA with Bonferroni’s post hoc test was used for multiple comparisons. Probability values <0.05 were considered significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
To evaluate a potential role of PKC{alpha} in regulation of eNOS activity, wild-type PKC{alpha} (WT-PKC{alpha}) was overexpressed in bovine aortic endothelial cells (BAEC) using an adenoviral construct and phosphorylation of eNOS was assessed at baseline and in response to FGF2. PKC{alpha} overexpression was associated with an 8-fold increase in PKC{alpha} kinase activity measured by an in vitro kinase assay in the presence of [{gamma}-32P]ATP (Figure 1A). In cells transduced with WT-PKC{alpha}, eNOS phosphorylation level was increased on the Ser1179 site both at baseline and in response to FGF2 (Figure 1B), whereas phosphorylation of the Thr497 site remained unchanged (Figure 1B). Overexpression of PKC{alpha} in BAEC was also associated with a significant increase in the basal level of NO accumulation measured after 12 hours by chemiluminescence, confirming the functional consequence of increased Ser1179 phosphorylation (Figure 1C).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Overexpression of wild-type or dominant negative PKC{alpha} in BAEC using adenoviral constructs. A, PKC{alpha} activity measured in an in vitro kinase assay is significantly increased in cells transduced with WT-PKC{alpha}. B, Western blot shows an increase in phospho-eNOS-Ser1179 and in phospho-Akt-Ser473 both at baseline and in response to FGF2, no change in phospho-eNOS-Thr,497 no change in total eNOS and total Akt in WT-PKC{alpha}–transduced cells. C, Basal level of NO accumulation after 12 hours measured by chemiluminescence is significantly increased in cells transduced with WT-PKC{alpha} but not significantly different in those transduced with DN-PKC{alpha} vs Ad-GFP. Values are expressed as mean±SEM. *Significantly different P<0.05. **P<0.01. D, Overexpression of DN-PKC{alpha} in BAEC inhibits FGF2-induced eNOS-Ser1179 and Akt-Ser473 phosphorylation. Western blot shows no change in FGF-2–induced phospho-ERK, no change in eNOS-Thr497 and total eNOS. E, Stimulated NO release measured as nitrate accumulation 30 minutes after stimulation with FGF2; is abolished in cells transduced with DN-PKC{alpha} construct. Data represent mean±SEM. *Significantly different P<0.05 from values obtained for PBS stimulation in adeno-GFP–transduced cells.

To further investigate the role of PKC{alpha} in eNOS activation, a catalytically inactive form of PKC{alpha} was overexpressed in BAEC using an adenoviral construct. Seventy-two hours after transduction, eNOS phosphorylation was assessed at both Ser1179 and Thr497 sites in response to stimulation with FGF2 (50 ng/mL). Whereas, Thr497 phosphorylation level was unchanged, FGF2-induced Ser1179 phosphorylation was completely inhibited in cells transduced with DN-PKC{alpha} (Figure 1D). Stimulated NO release measured as nitrate accumulation 30 minutes after stimulation with FGF2 was also abolished in cells transduced with DN-PKC{alpha} construct (Figure 1E).

Protein kinase B{alpha}/Akt-1 is the kinase primarily involved in phosphorylation of the Ser1179 in response to growth factor stimulation.2,8 Therefore we evaluated the effect of PKC{alpha} alteration on Akt activity assessed by the phosphorylation level of Ser473. Overexpression of wild-type PKC{alpha} in BAEC was associated with increased Ser473 phosphorylation both at baseline and after stimulation with FGF2 (Figure 1B). Overexpression of the dominant negative mutant of PKC{alpha} in BAEC inhibited FGF2-induced Akt-Ser473 phosphorylation (Figure 1D).

To rule out the possibility that the results generated in cells overexpressing PKC{alpha} construct either dominant negative or wild-type may not be physiologically relevant, we used RNA interference to silence endogenous PKC{alpha} gene expression. HUVEC were transfected with siRNA directed against PKC{alpha} or a control siRNA, directed against the luciferase gene. Seventy-two hours after siRNA transfection, there was a significant reduction in the PKC{alpha} protein level in HUVEC treated with PKC{alpha} siRNA, although expression of other PKC isoforms was unaffected (Figure 2A). The PKC{alpha} kinase activity, measured by an in vitro kinase assay in the presence of [{gamma}-32P]ATP, was decreased by 3.5 fold in PKC{alpha} siRNA- versus control siRNA-treated-HUVEC (Figure 2B). Seventy-two hours after siRNA-transfection, cells were serum-starved and then stimulated with FGF2 or a vehicle. Although, the level of total eNOS was unchanged, FGF2-induced eNOS-Ser1179 phosphorylation was markedly attenuated in PKC{alpha} siRNA-treated HUVEC (Figure 2C). Transfection with PKC{alpha} siRNA was also associated with inhibition of FGF-2-induced Akt–Ser473 phosphorylation (Figure 2C).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Transfection of HUVEC with siRNA directed against PKC{alpha} or luciferase. A, Western blot showing that PKC{alpha} expression level is markedly reduced 72 hours after transfection with anti–PKC{alpha}-siRNA. No change is observed in the expression level of other PKC isoforms in anti–PKC{alpha}-siRNA transfected cells and no change in expression level of PKCs in cells transfected with anti–luciferase-siRNA. B, PKC{alpha} activity measured in an in vitro kinase assay is significantly decreased in HUVEC transfected with anti–PKC{alpha}-siRNA vs those transfected with control siRNA. C, There is a marked decrease in FGF2-induced eNOS-Ser1177 and Akt-Ser473 phosphorylation, in anti–PKC{alpha}-siRNA-transfected HUVEC, with no change of total eNOS level. D, There is no significant change in FGF2-induced eNOS-Ser1177 and Akt-Ser473 phosphorylation, in cells transfected with siRNA against PKC{epsilon}

To further check the specificity of these results for PKC{alpha}, cells were treated with PKC{epsilon} siRNA, and then 72 hours later were serum-starved and stimulated with FGF2 or a vehicle. The knockdown of PKC{epsilon} had no effect on eNOS phosphorylation at Ser1179 or Akt phosphorylation at Ser473 (Figure 2D).

These in vitro results lead us to hypothesize that modulation of PKC{alpha} activity in the endothelium may influence blood flow in vivo. To test this hypothesis, the viral constructs containing PKC{alpha} or the GFP were infused in the femoral artery temporarily clamped at both extremities, via an arterial branch and incubated for 15 minutes. Previous studies using adeno-ß-gal in a similar femoral artery model of gene transfer have shown a gene transfer efficiency of >50% and a transgene expression exclusively localized in the endothelium.16,17 Three days after transduction, the femoral artery blood flow was measured using a Doppler probe. The blood flow at baseline was significantly increased in femoral arteries transduced with the WT-PKC{alpha} construct in comparison with controls transduced with Ad-GFP (Figure 3A). This increase in blood flow was diminished to a level comparable to the baseline level by infusion of L-NAME, an L-arginine analog that inhibits eNOS, suggesting that PKC{alpha} effect is mediated through activation of eNOS (Figure 3A). Whereas the level of total eNOS was unchanged, the extent of Akt phosphorylation at the Ser473 site was significantly increased in lysates obtained from femoral arteries transduced with WT-PKC{alpha} (Figure 3B).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. Analysis of femoral artery in vivo, 3 days after transduction with adeno-WT-PKC{alpha} or GFP alone. A, Basal level of blood flow is significantly increased in femoral arteries transduced with wild-type PKC{alpha}. This increase is reversed by infusion of L-NAME. Data represent mean±SEM. *Significantly different P<0.05 **Significantly different P<0.001. B, A representative Western blot showing an increase in PKC{alpha} and phospho-Akt-Ser473, with no change in total eNOS level in arteries transduced with WT-PKC{alpha}

To further evaluate the hypothesis that PKC{alpha} effect on eNOS may be mediated by Akt-1, we isolated primary endothelial cells from the heart of Akt-1 knockout mice. FGF2-induced Ser1179 phosphorylation was markedly inhibited in endothelial cells isolated from Akt-1 knockout mice but not in cells from wild-type mice (Figure 4). Overexpression of PKC{alpha} in Akt-1–/– cells led to an increase in eNOS-Ser1179 phosphorylation at baseline that was further increased after stimulation with FGF2 (Figure 4). Whereas Akt-2 expression level was increased in Akt-1–/– cells, PKC{alpha} overexpression was not associated with further increase in Akt phosphorylation at Ser473 (Figure 4). These data show that PKC{alpha} is able to phosphorylate eNOS at Ser1179 in the absence of Akt-1.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 4. Overexpression of wild-type PKC{alpha} in primary cardiac mouse endothelial cells isolated from Akt-1–/– mice. Western Blot shows that FGF2-induced eNOS-Ser1179 phosphorylation is markedly inhibited in Akt-1–/– cells vs cells from wild-type littermate. Overexpression of PKC{alpha} in Akt-1–/– cells increases the basal level of eNOS-Ser1179 phosphorylation and restores the response to FGF2. Overexpression of PKC{alpha} did not change Thr497 phosphorylation level that is markedly decreased in Akt-1–/– cells.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The central finding of this study is that PKC{alpha} stimulates NO production by activating eNOS in vitro and in vivo. The data demonstrate that PKC{alpha} stimulates NO production in endothelial cells by increasing phosphorylation of Ser1179 while having no effect on Thr497 phosphorylation. This is a novel and important finding that differs from previous reports of PKC inhibition of eNOS activity by phosphorylating Thr497 and dephosphorylating Ser1179 3. The likely reason for that is the use of nonspecific pharmacological inhibitors and stimulator of PKC such as PMA that is a potent activator of a number of PKC isoforms.3,6,11 In addition to conventional PKC, PKC{delta}, {epsilon}, and {zeta} have also been shown to be activated and translocated to the membrane following PMA treatment.18 These different isoforms activate distinct downstream pathways that may have quite different effects on eNOS phosphorylation and activity. Different pharmacological inhibitors may also produce different results. Data from our laboratory showed that pretreatment of BAEC with Gö6976, an inhibitor of calcium-dependent PKC inhibits FGF-2 induced eNOS-Ser1179 phosphorylation (data not shown). These data are opposite from the ones using Ro-310645, underlying the nonspecificity of these pharmacological inhibitors. In contrast, in the current study we used tools that specifically and selectively affect the expression and activity of the PKC{alpha} isoform in endothelial cells. Overexpression of wild-type PKC{alpha} was associated with an increase in NO production and overexpression of the dominant negative mutant with inhibition of FGF2-induced NO release. Interestingly, we did not see further increase in NO levels following FGF2 stimulation in cells transduced with WT- PKC{alpha}. One possible explanation is that increased levels of PKC{alpha} provide maximum eNOS activation that cannot be further stimulated by FGF2. The other alternative is that nonspecific effects may occur with the levels of PKC{alpha} expression achieved here. Indeed, there are limitations to overexpression approaches, such as altered stoichiometry between the overexpressed enzyme and the endogenous substrate, or the absence of normal regulation or subcellular localization of the overexpressed kinase that might lead to nonspecific interactions. However, we did not observe any significant alteration of Akt-Ser473 phosphorylation in a rat fat pad endothelial cell line with stable overexpression of WT or DN PKC{alpha} (data not shown). Furthermore, the use of small interference RNA to knockdown the endogenous PKC{alpha} allowed us to overcome the limitations of the overexpression approach.

The in vivo results show that enhancement of PKC{alpha} activity in the endothelium leads to a significant increase in blood flow in an L-NAME dependent manner, which is consistent with the in vitro data showing that PKC{alpha} overexpression in endothelial cells increases NO production. DN-PKC{alpha} by itself did not decrease the baseline level of femoral artery blood flow, in the same way that it did not induce a statistically significant decrease in basal NO production from endothelial cells in vitro, suggesting that PKC{alpha}-eNOS pathway may not play a significant role in the regulation of resting blood flow. However stimulation of PKC{alpha} will induce an increase in blood flow. The in vivo data in our study are comparable to those obtained with acute modulation of Akt-1 activity in the endothelium,16 that also demonstrated increased resting blood flow after Akt-1 transduction whereas Akt-1-DN had little effect on baseline flow. Furthermore, Akt phosphorylation level at the Ser473 site was increased in arteries transduced with Ad-PKC{alpha} (Figure 3B).

Although our data clearly demonstrate the ability of PKC{alpha} to stimulate eNOS activity, the mechanism of interaction between these 2 molecules is less obvious. Data from our laboratory and others3 have shown that in vitro, PKC{alpha} is able to phosphorylate eNOS at Ser1179, suggesting the possibility of a direct interaction between PKC{alpha} and eNOS. However, in vivo there is the alternative possibility that PKC{alpha} acts upstream of one of the kinases known to directly phosphorylate eNOS, such as Akt, AMP-dependent protein kinase, or protein kinase A. Nevertheless, it is likely that PKC{alpha} acts upstream of Akt because we have shown that alteration of PKC{alpha} activity is associated with changes in Akt phosphorylation. These data are consistent with our previous study showing that PKC{alpha} is able to stimulate Akt activity in endothelial cells via direct phosphorylation of Ser473.19

On the other hand, our data also clearly show that PKC{alpha} is able to phosphorylate eNOS in Akt-1–/– cells. Furthermore, in these cells, whereas Akt-2 expression level is increased, the level of P-Akt Ser473 is not further increased following transduction with PKC{alpha}. These results suggest that PKC{alpha} can act both in an Akt-1-dependent and independent manner.

It is also interesting to note that in Akt-1–/– CMEC, eNOS-Thr497 was strongly dephosphorylated and PKC{alpha} overexpression in these cells did not increase its phosphorylation level suggesting that PKC{alpha} isoform is not the PKC responsible for constitutive phosphorylation of eNOS at Thr497 (Figure 4).

In conclusion, the data herein are the first demonstration that PKC{alpha} stimulates NO production in the endothelial cells and affects arterial blood flow in vivo; therefore, suggesting that pharmacological modulation of PKC{alpha} activity in the endothelium may have utility for the treatment of vascular disorders associated with vascular dysfunction and impaired blood flow.


*    Acknowledgments
 
This work was supported by the National Institutes of Health grants HL62289 and 53793 (M.S.). The authors thank members of the Angiogenesis Research Center for helpful discussions and critical reading of the manuscript and Drs Yih-Wen Chen and William F. Wade for providing the siRNA sequence for PKC{epsilon}.


*    Footnotes
 
Original received March 17, 2005; revision received June 28, 2005; accepted July 21, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Bauer PM, Fulton D, Boo YC, Sorescu GP, Kemp BE, Jo H, Sessa WC. Compensatory phosphorylation and protein-protein interactions revealed by loss of function and gain of function mutants of multiple serine phosphorylation sites in endothelial nitric-oxide synthase. J Biol Chem. 2003; 278: 14841–14849.[Abstract/Free Full Text]

2. Dimmeler S, Dernbach E, Zeiher AM. Phosphorylation of the endothelial nitric oxide synthase at ser-1177 is required for VEGF-induced endothelial cell migration. FEBS Lett. 2000; 477: 258–262.[CrossRef][Medline] [Order article via Infotrieve]

3. Michell BJ, Chen Z, Tiganis T, Stapleton D, Katsis F, Power DA, Sim AT, Kemp BE. Coordinated control of endothelial nitric-oxide synthase phosphorylation by protein kinase C and the cAMP-dependent protein kinase. J Biol Chem. 2001; 276: 17625–17628.[Abstract/Free Full Text]

4. Chambliss KL, Shaul PW. Estrogen modulation of endothelial nitric oxide synthase. Endocr Rev. 2002; 23: 665–686.[Abstract/Free Full Text]

5. Kim F, Gallis B, Corson MA. TNF-alpha inhibits flow and insulin signaling leading to NO production in aortic endothelial cells. Am J Physiol Cell Physiol. 2001; 280: C1057–C1065.[Abstract/Free Full Text]

6. Fleming I, Fisslthaler B, Dimmeler S, Kemp BE, Busse R. Phosphorylation of Thr(495) regulates Ca(2+)/calmodulin-dependent endothelial nitric oxide synthase activity. Circ Res. 2001; 88: E68–E75.

7. Boo YC, Sorescu G, Boyd N, Shiojima I, Walsh K, Du J, Jo H. Shear stress stimulates phosphorylation of endothelial nitric-oxide synthase at Ser1179 by Akt-independent mechanisms: role of protein kinase A. J Biol Chem. 2002; 277: 3388–3396.[Abstract/Free Full Text]

8. Fulton D, Gratton JP, McCabe TJ, Fontana J, Fujio Y, Walsh K, Franke TF, Papapetropoulos A, Sessa WC. Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature. 1999; 399: 597–601.[CrossRef][Medline] [Order article via Infotrieve]

9. Fisslthaler B, Dimmeler S, Hermann C, Busse R, Fleming I. Phosphorylation and activation of the endothelial nitric oxide synthase by fluid shear stress. Acta Physiol Scand. 2000; 168: 81–88.[CrossRef][Medline] [Order article via Infotrieve]

10. Chen ZP, Mitchelhill KI, Michell BJ, Stapleton D, Rodriguez-Crespo I, Witters LA, Power DA, Ortiz de Montellano PR, Kemp BE. AMP-activated protein kinase phosphorylation of endothelial NO synthase. FEBS Lett. 1999; 443: 285–289.[CrossRef][Medline] [Order article via Infotrieve]

11. Matsubara M, Titani K, Taniguchi H. Interaction of calmodulin-binding domain peptides of nitric oxide synthase with membrane phospholipids: regulation by protein phosphorylation and Ca(2+)-calmodulin. Biochemistry. 1996; 35: 14651–14658.[CrossRef][Medline] [Order article via Infotrieve]

12. Dempsey EC, Newton AC, Mochly-Rosen D, Fields AP, Reyland ME, Insel PA, Messing RO. Protein kinase C isozymes and the regulation of diverse cell responses. Am J Physiol Lung Cell Mol Physiol. 2000; 279: L429–L438.[Abstract/Free Full Text]

13. Allport JR, Lim YC, Shipley JM, Senior RM, Shapiro SD, Matsuyoshi N, Vestweber D, Luscinskas FW. Neutrophils from MMP-9- or neutrophil elastase-deficient mice show no defect in transendothelial migration under flow in vitro. J Leukoc Biol. 2002; 71: 821–828.[Abstract/Free Full Text]

14. Ohba M, Ishino K, Kashiwagi M, Kawabe S, Chida K, Huh NH, Kuroki T. Induction of differentiation in normal human keratinocytes by adenovirus-mediated introduction of the eta and delta isoforms of protein kinase C. Mol Cell Biol. 1998; 18: 5199–5207.[Abstract/Free Full Text]

15. Horowitz A, Simons M. Phosphorylation of the cytoplasmic tail of syndecan-4 regulates activation of protein kinase Calpha. J Biol Chem. 1998; 273: 25548–25551.[Abstract/Free Full Text]

16. Luo Z, Fujio Y, Kureishi Y, Rudic RD, Daumerie G, Fulton D, Sessa WC, Walsh K. Acute modulation of endothelial Akt/PKB activity alters nitric oxide-dependent vasomotor activity in vivo. J Clin Invest. 2000; 106: 493–499.[Medline] [Order article via Infotrieve]

17. von der Thusen JH, Fekkes ML, Passier R, van Zonneveld AJ, Mainfroid V, van Berkel TJ, Biessen EA. Adenoviral transfer of endothelial nitric oxide synthase attenuates lesion formation in a novel murine model of postangioplasty restenosis. Arterioscler Thromb Vasc Biol. 2004; 24: 357–362.[Abstract/Free Full Text]

18. Zheng WH, Kar S, Quirion R. Stimulation of protein kinase C modulates insulin-like growth factor-1-induced akt activation in PC12 cells. J Biol Chem. 2000; 275: 13377–13385.[Abstract/Free Full Text]

19. Partovian C, Simons M. Regulation of protein kinase B/Akt activity and Ser473 phosphorylation by protein kinase Calpha in endothelial cells. Cell Signal. 2004; 16: 951–957.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Physiol. Rev.Home page
J.-L. Balligand, O. Feron, and C. Dessy
eNOS Activation by Physical Forces: From Short-Term Regulation of Contraction to Chronic Remodeling of Cardiovascular Tissues
Physiol Rev, April 1, 2009; 89(2): 481 - 534.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. G. da Silva, A. Specht, B. Wegiel, C. Ferran, and E. Kaczmarek
Mechanism of Purinergic Activation of Endothelial Nitric Oxide Synthase in Endothelial Cells
Circulation, February 17, 2009; 119(6): 871 - 879.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-A. Chen, L. J. Druhan, S. Varadharaj, Y.-R. Chen, and J. L. Zweier
Phosphorylation of Endothelial Nitric-oxide Synthase Regulates Superoxide Generation from the Enzyme
J. Biol. Chem., October 3, 2008; 283(40): 27038 - 27047.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Rask-Madsen and G. L. King
Differential Regulation of VEGF Signaling by PKC-{alpha} and PKC-{epsilon} in Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., May 1, 2008; 28(5): 919 - 924.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Murakami, A. Elfenbein, and M. Simons
Non-canonical fibroblast growth factor signalling in angiogenesis
Cardiovasc Res, May 1, 2008; 78(2): 223 - 231.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. Sud, S. Wedgwood, and S. M. Black
Protein kinase C{delta} regulates endothelial nitric oxide synthase expression via Akt activation and nitric oxide generation
Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L582 - L591.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. Madeddu, N. Kraenkel, L. S. Barcelos, M. Siragusa, P. Campagnolo, A. Oikawa, A. Caporali, A. Herman, O. Azzolino, L. Barberis, et al.
Phosphoinositide 3-Kinase {gamma} Gene Knockout Impairs Postischemic Neovascularization and Endothelial Progenitor Cell Functions
Arterioscler. Thromb. Vasc. Biol., January 1, 2008; 28(1): 68 - 76.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Zaccolo and M. A. Movsesian
cAMP and cGMP Signaling Cross-Talk: Role of Phosphodiesterases and Implications for Cardiac Pathophysiology
Circ. Res., June 8, 2007; 100(11): 1569 - 1578.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
D. Ramzy, V. Rao, L. C. Tumiati, N. Xu, R. Sheshgiri, J. Jackman, D. H. Delgado, and H. J. Ross
Endothelin-1 accentuates the proatherosclerotic effects associated with C-reactive protein
J. Thorac. Cardiovasc. Surg., May 1, 2007; 133(5): 1137 - 1146.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
E. D. Motley, K. Eguchi, M. M. Patterson, P. D. Palmer, H. Suzuki, and S. Eguchi
Mechanism of Endothelial Nitric Oxide Synthase Phosphorylation and Activation by Thrombin
Hypertension, March 1, 2007; 49(3): 577 - 583.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Takeda, A. R. Kazarov, C. E. Butterfield, B. D. Hopkins, L. E. Benjamin, A. Kaipainen, and M. E. Hemler
Deletion of tetraspanin Cd151 results in decreased pathologic angiogenesis in vivo and in vitro
Blood, February 15, 2007; 109(4): 1524 - 1532.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
M. M. Anton, M. Y. Cortez-Cooper, A. E. DeVan, D. B. Neidre, J. N. Cook, and H. Tanaka
Resistance training increases basal limb blood flow and vascular conductance in aging humans
J Appl Physiol, November 1, 2006; 101(5): 1351 - 1355.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J.-a Kim, M. Montagnani, K. K. Koh, and M. J. Quon
Reciprocal Relationships Between Insulin Resistance and Endothelial Dysfunction: Molecular and Pathophysiological Mechanisms
Circulation, April 18, 2006; 113(15): 1888 - 1904.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. M. Cale and I. M. Bird
Dissociation of endothelial nitric oxide synthase phosphorylation and activity in uterine artery endothelial cells
Am J Physiol Heart Circ Physiol, April 1, 2006; 290(4): H1433 - H1445.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Liu and A. Horowitz
A PDZ-binding Motif as a Critical Determinant of Rho Guanine Exchange Factor Function and Cell Phenotype
Mol. Biol. Cell, April 1, 2006; 17(4): 1880 - 1887.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. S. Pollock and P. K. Carmines
NOS3 Regulation: Renal Tubular Epithelial Cells Are Not Simply Large Endothelial Cells
Hypertension, January 1, 2006; 47(1): 19 - 21.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
97/5/482    most recent
01.RES.0000179775.04114.45v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Partovian, C.
Right arrow Articles by Simons, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Partovian, C.
Right arrow Articles by Simons, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITRIC OXIDE
Related Collections
Right arrow Endothelium/vascular type/nitric oxide