| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Integrative Physiology |
Activates eNOS and Increases Arterial Blood Flow In Vivo
From the Angiogenesis Research Center and Section of Cardiology (C.P., Z.Z., K.M., M.S.), Dartmouth Medical School, Dartmouth-Hitchcock Medical Center, Lebanon, NH; the Molecular Cardiology/Whitaker Cardiovascular Institute (N.O., K.W.), Boston University School of Medicine, Mass; and the Department of Pharmacology and Molecular Cardiobiology Program (M.L., W.C.S.), Yale University School of Medicine, New Haven, Conn.
Correspondence to Dr Michael Simons, Section of Cardiology, Dartmouth-Hitchcock Medical Center, One Medical Center Dr, Lebanon, NH 03756. E-mail michael.simons{at}dartmouth.edu
| Abstract |
|---|
|
|
|---|
isoform in regulation of eNOS activity. Overexpression of PKC
in primary endothelial cells was associated with increased eNOS-Ser1179 phosphorylation and increased NO production. Inhibition of PKC
activity either by siRNA transfection or by overexpression of a dominant negative mutant resulted in a marked decrease in FGF2-induced Ser1179 phosphorylation and NO production. In vivo, PKC
transduction in rat femoral arteries resulted in a significant increase in the resting blood flow that was suppressed by treatment with L-NAME, an eNOS inhibitor. In conclusion, these data demonstrate for the first time that PKC
stimulates NO production in endothelial cells and plays a role in regulation of blood flow in vivo.
Key Words: protein kinase C blood flow nitric oxide synthase endothelial cells
| Introduction |
|---|
|
|
|---|
/Akt-1,8 shear stress elicits eNOS phosphorylation on this residue by activating Akt-19 and protein kinase A.7 Other kinases such as AMP-activated protein kinase10 and CaM-dependent kinase II6 also have the ability to phosphorylate the Ser1179 site. The Thr497 residue is known as a negative regulatory site, its phosphorylation being associated with a decrease in the enzyme activity. It has been suggested that constitutively active kinase that phosphorylates eNOS at Thr497 is most probably protein kinase C (PKC).3,6,11 The PKC family comprises roughly 12 different isozymes, which are broadly classified by their activation characteristics. The conventional PKC isozymes (
, ßI, ßII, and
) are Ca2+- and lipid-activated, whereas the so-called novel isozymes (
,
,
, and
) and atypical isozymes (
,
, v, and µ) are Ca2+-independent but activated by distinct lipids.12 Although it is commonly accepted that PKC signaling inhibits eNOS activity in endothelial cells, the distinct role of different PKC isoforms has not been studied so far. The aim of the present study was to analyze the role of PKC
, one of the major PKC isoforms expressed in endothelial cells, in regulation of eNOS activity in vitro and in vivo. | Materials and Methods |
|---|
|
|
|---|
Adenoviral Constructs and Cell Transduction
The wild-type PKC
adenoviral construct was a gift from Dr Motoi Ohba (Showa University, Tokyo, Japan) and has been previously described.14 The virus particle titer was 3.55x109 plaque forming units (pfu) per ml. The dominant negative PKC
construct which was generated by replacing the conserved lysine in the ATP binding domain with arginine (a gift from Dr Dan Rosson, Lankenau Medical Research Center, Wynnewood, Pa) was subcloned in an adenoviral vector (first generation, E1 and E3 deleted) driven by hCMV promoter and also containing green fluorescent protein (GFP). The virus particle titer was 3.7x1010 pfu /mL.
BAEC or mice cardiac endothelial cells were transduced with different adenoviral constructs in half a volume of 0.5% FBS-DMEM. After 4 hours, the cells were completed with half a volume of full-serum medium for overnight incubation. The day after, cells were washed with PBS and incubated in full-serum medium. In these conditions, the transduction efficiency was typically >80% as determined by GFP expression. The experimentations were performed between 48 and 72 hours after transduction.
Specific Silencing of Gene Expression by siRNA in HUVEC
The DNA target sequences were as follows: AAGCACAAGUUCAAAAUCCAC for PKC
and AAGCCCCUAAAGACAAUGAAG for PKC
. Twenty-one-base RNA was synthesized by Xeragon Inc. For annealing, 40 µmol/L of each strand was incubated in annealing buffer containing 100 mmol/L potassium acetate, 30 mmol/L HEPES-KOH, 2 mmol/L magnesium acetate (pH 7.4) for 1 minute at 90°C followed by 1 hour at 37°C. Cells were at 80% to 90% confluence at the time of the transfection (transfection kit from Targeting Systems) with 75 pmols of PKC
or control (Cy3-labeled luciferase) dsRNA. The media was replaced with fresh complete media 24 hours after transfection. Analyses for testing the silencing of PKC
gene were performed between 48 and 72 hours after transfection, including Western blotting for total PKC
and PKC
kinase activity.
PKC
Kinase Activity Assay
PKC
was immunoprecipitated from the cell lysates with 2 µg of anti-PKC
antibody (Santa Cruz Biotech. Inc) and 30 µL of protein G plus/protein A agarose suspension (Calbiochem) and used in an in vitro kinase assay as previously described.15 The reaction mixture (30 µL) contained 50 µmol/L ATP and 5 µCi of [
-32P]ATP (PerkinElmer Life Sciences), 1 mmol/L dithiothreitol, 5 mmol/L MgCl2, 25 mmol/L Tris-HCl (pH 7.5), 20 µmol/L phosphatidylserine, 10 µmol/L diolein, and 0.2 mmol/L CaCl2 and PKCß1 optimal peptide as substrate (100 µmol/L) (Calbiochem). Reactions were started by addition of reaction mixture to the immunoprecipitates and incubated at 30°C for 10 minutes. The reaction was stopped by spotting onto P81 phosphocellulose paper. The filters were washed 3x in 0.75% phosphoric acid and once in acetone and the radioactivity was determined in a scintillation mixture.
Western Blotting
Cells were lysed in RIPA buffer (PBS 1X, Nonidet P-40 1%, Sodium Deoxycholate 0.5% and SDS 0.1%) containing protease inhibitor cocktail (Complete, Roche). Thirty to 50 µg of proteins were resolved by 10% or 7.5% SDS PAGE and transferred to Immobilon membranes (Millipore). The membranes were probed with various primary antibodies followed by incubation with HRP-conjugated secondary antibodies (Vector Laboratories, Inc) as appropriate. Proteins were visualized by enhanced chemiluminescence, according to the instructions of the manufacturer (Pierce). The following primary antibodies have been used: anti-Akt antibodies, antiphospho-eNOS-Ser1179 and antiphospho-p44/42 MAPK (phospho-ERK) from Cell Signaling Technology; antiphospho-eNOS-Thr495 from Upstate Cell Signaling; anti-eNOS from Santa Cruz Biotechnology; anti-PKC
from BD Transduction Laboratories.
Measurement of NO Release From Cells Transduced With Different Adenoviral Constructs
BAEC were plated in 6-well plates and then transduced with WT- or DN-PKC
or GFP as control. Two days later, the medium was aspirated and replaced with 2 mL of starvation medium. The cells were incubated for 12 hours and an aliquot of medium was taken for basal NO measurements, assayed as nitrite, the stable breakdown product of NO in aqueous medium. Nitrite levels were measured using a Sievers NO analyzer. Cells were collected and lysed for protein assay. For the stimulated NO release, transduced cells were starved in serum-free medium overnight. The day after the medium was aspirated and replaced by 2 mL of fresh serum-free medium. After 1 hour, an aliquot was taken for background nitrite measurements and the cells were stimulated with PBS or 50 ng/mL of FGF2 and incubated for an additional 30 minutes. An aliquot of medium was again taken for nitrite measurement and the cells collected and lysed for protein assay.
In Vivo Gene Transfer
All animal experiments were approved by the Institutional Animal Care and Use Committee. Twenty-four (
8 animals in each group) male Sprague Dawley rats (The Jackson Laboratory, Bar Harbor, Me), aged between 6 and 7 weeks and weighing
350 g were used in this study. The animals were anesthetized with intraperitoneal injection of Ketamine (80 mg/kg) and Xylasine (8 mg/kg). Femoral artery and superficial epigastric artery were isolated. After temporary clamping of the proximal and distal femoral artery, 20 µL of adeno-GFP or adeno-WT-PKC
was infused into the femoral artery via superficial epigastric artery and incubated for 15 minutes. Viral titer was brought to 3x109 pfu/ml for each construct. After incubation, the superficial epigastric artery was permanently ligated and clamps on the femoral artery were removed to restore femoral blood flow. Three days after surgery, femoral-artery blood flow was measured using a doppler probe (Transonic Systems Inc). Blood pressure and heart rate were measured using a Millar transducer inserted into the carotid artery. L-NAME was infused as a single bolus injection of 20 µg/kg via the jugular vein. After flow measurements, femoral arteries were harvested, immediately frozen in liquid nitrogen, and kept at 80°C until analyzed. Samples were homogenized in a lysis buffer containing PBS 1X, Nonidet P-40 1%, Sodium Deoxycholate 0.5%, SDS 0.1% and protease inhibitor cocktail (Complete, Roche). Eighty µg of protein was subjected to SDS-PAGE and Western blotting as previously described.
Statistical Analysis
Results are shown as mean±SEM. Differences between 2 groups were determined by Student t test and a 1-way ANOVA with Bonferronis post hoc test was used for multiple comparisons. Probability values <0.05 were considered significant.
| Results |
|---|
|
|
|---|
in regulation of eNOS activity, wild-type PKC
(WT-PKC
) was overexpressed in bovine aortic endothelial cells (BAEC) using an adenoviral construct and phosphorylation of eNOS was assessed at baseline and in response to FGF2. PKC
overexpression was associated with an 8-fold increase in PKC
kinase activity measured by an in vitro kinase assay in the presence of [
-32P]ATP (Figure 1A). In cells transduced with WT-PKC
, eNOS phosphorylation level was increased on the Ser1179 site both at baseline and in response to FGF2 (Figure 1B), whereas phosphorylation of the Thr497 site remained unchanged (Figure 1B). Overexpression of PKC
in BAEC was also associated with a significant increase in the basal level of NO accumulation measured after 12 hours by chemiluminescence, confirming the functional consequence of increased Ser1179 phosphorylation (Figure 1C).
|
To further investigate the role of PKC
in eNOS activation, a catalytically inactive form of PKC
was overexpressed in BAEC using an adenoviral construct. Seventy-two hours after transduction, eNOS phosphorylation was assessed at both Ser1179 and Thr497 sites in response to stimulation with FGF2 (50 ng/mL). Whereas, Thr497 phosphorylation level was unchanged, FGF2-induced Ser1179 phosphorylation was completely inhibited in cells transduced with DN-PKC
(Figure 1D). Stimulated NO release measured as nitrate accumulation 30 minutes after stimulation with FGF2 was also abolished in cells transduced with DN-PKC
construct (Figure 1E).
Protein kinase B
/Akt-1 is the kinase primarily involved in phosphorylation of the Ser1179 in response to growth factor stimulation.2,8 Therefore we evaluated the effect of PKC
alteration on Akt activity assessed by the phosphorylation level of Ser473. Overexpression of wild-type PKC
in BAEC was associated with increased Ser473 phosphorylation both at baseline and after stimulation with FGF2 (Figure 1B). Overexpression of the dominant negative mutant of PKC
in BAEC inhibited FGF2-induced Akt-Ser473 phosphorylation (Figure 1D).
To rule out the possibility that the results generated in cells overexpressing PKC
construct either dominant negative or wild-type may not be physiologically relevant, we used RNA interference to silence endogenous PKC
gene expression. HUVEC were transfected with siRNA directed against PKC
or a control siRNA, directed against the luciferase gene. Seventy-two hours after siRNA transfection, there was a significant reduction in the PKC
protein level in HUVEC treated with PKC
siRNA, although expression of other PKC isoforms was unaffected (Figure 2A). The PKC
kinase activity, measured by an in vitro kinase assay in the presence of [
-32P]ATP, was decreased by 3.5 fold in PKC
siRNA- versus control siRNA-treated-HUVEC (Figure 2B). Seventy-two hours after siRNA-transfection, cells were serum-starved and then stimulated with FGF2 or a vehicle. Although, the level of total eNOS was unchanged, FGF2-induced eNOS-Ser1179 phosphorylation was markedly attenuated in PKC
siRNA-treated HUVEC (Figure 2C). Transfection with PKC
siRNA was also associated with inhibition of FGF-2-induced AktSer473 phosphorylation (Figure 2C).
|
To further check the specificity of these results for PKC
, cells were treated with PKC
siRNA, and then 72 hours later were serum-starved and stimulated with FGF2 or a vehicle. The knockdown of PKC
had no effect on eNOS phosphorylation at Ser1179 or Akt phosphorylation at Ser473 (Figure 2D).
These in vitro results lead us to hypothesize that modulation of PKC
activity in the endothelium may influence blood flow in vivo. To test this hypothesis, the viral constructs containing PKC
or the GFP were infused in the femoral artery temporarily clamped at both extremities, via an arterial branch and incubated for 15 minutes. Previous studies using adeno-ß-gal in a similar femoral artery model of gene transfer have shown a gene transfer efficiency of >50% and a transgene expression exclusively localized in the endothelium.16,17 Three days after transduction, the femoral artery blood flow was measured using a Doppler probe. The blood flow at baseline was significantly increased in femoral arteries transduced with the WT-PKC
construct in comparison with controls transduced with Ad-GFP (Figure 3A). This increase in blood flow was diminished to a level comparable to the baseline level by infusion of L-NAME, an L-arginine analog that inhibits eNOS, suggesting that PKC
effect is mediated through activation of eNOS (Figure 3A). Whereas the level of total eNOS was unchanged, the extent of Akt phosphorylation at the Ser473 site was significantly increased in lysates obtained from femoral arteries transduced with WT-PKC
(Figure 3B).
|
To further evaluate the hypothesis that PKC
effect on eNOS may be mediated by Akt-1, we isolated primary endothelial cells from the heart of Akt-1 knockout mice. FGF2-induced Ser1179 phosphorylation was markedly inhibited in endothelial cells isolated from Akt-1 knockout mice but not in cells from wild-type mice (Figure 4). Overexpression of PKC
in Akt-1/ cells led to an increase in eNOS-Ser1179 phosphorylation at baseline that was further increased after stimulation with FGF2 (Figure 4). Whereas Akt-2 expression level was increased in Akt-1/ cells, PKC
overexpression was not associated with further increase in Akt phosphorylation at Ser473 (Figure 4). These data show that PKC
is able to phosphorylate eNOS at Ser1179 in the absence of Akt-1.
|
| Discussion |
|---|
|
|
|---|
stimulates NO production by activating eNOS in vitro and in vivo. The data demonstrate that PKC
stimulates NO production in endothelial cells by increasing phosphorylation of Ser1179 while having no effect on Thr497 phosphorylation. This is a novel and important finding that differs from previous reports of PKC inhibition of eNOS activity by phosphorylating Thr497 and dephosphorylating Ser1179 3. The likely reason for that is the use of nonspecific pharmacological inhibitors and stimulator of PKC such as PMA that is a potent activator of a number of PKC isoforms.3,6,11 In addition to conventional PKC, PKC
,
, and
have also been shown to be activated and translocated to the membrane following PMA treatment.18 These different isoforms activate distinct downstream pathways that may have quite different effects on eNOS phosphorylation and activity. Different pharmacological inhibitors may also produce different results. Data from our laboratory showed that pretreatment of BAEC with Gö6976, an inhibitor of calcium-dependent PKC inhibits FGF-2 induced eNOS-Ser1179 phosphorylation (data not shown). These data are opposite from the ones using Ro-310645, underlying the nonspecificity of these pharmacological inhibitors. In contrast, in the current study we used tools that specifically and selectively affect the expression and activity of the PKC
isoform in endothelial cells. Overexpression of wild-type PKC
was associated with an increase in NO production and overexpression of the dominant negative mutant with inhibition of FGF2-induced NO release. Interestingly, we did not see further increase in NO levels following FGF2 stimulation in cells transduced with WT- PKC
. One possible explanation is that increased levels of PKC
provide maximum eNOS activation that cannot be further stimulated by FGF2. The other alternative is that nonspecific effects may occur with the levels of PKC
expression achieved here. Indeed, there are limitations to overexpression approaches, such as altered stoichiometry between the overexpressed enzyme and the endogenous substrate, or the absence of normal regulation or subcellular localization of the overexpressed kinase that might lead to nonspecific interactions. However, we did not observe any significant alteration of Akt-Ser473 phosphorylation in a rat fat pad endothelial cell line with stable overexpression of WT or DN PKC
(data not shown). Furthermore, the use of small interference RNA to knockdown the endogenous PKC
allowed us to overcome the limitations of the overexpression approach.
The in vivo results show that enhancement of PKC
activity in the endothelium leads to a significant increase in blood flow in an L-NAME dependent manner, which is consistent with the in vitro data showing that PKC
overexpression in endothelial cells increases NO production. DN-PKC
by itself did not decrease the baseline level of femoral artery blood flow, in the same way that it did not induce a statistically significant decrease in basal NO production from endothelial cells in vitro, suggesting that PKC
-eNOS pathway may not play a significant role in the regulation of resting blood flow. However stimulation of PKC
will induce an increase in blood flow. The in vivo data in our study are comparable to those obtained with acute modulation of Akt-1 activity in the endothelium,16 that also demonstrated increased resting blood flow after Akt-1 transduction whereas Akt-1-DN had little effect on baseline flow. Furthermore, Akt phosphorylation level at the Ser473 site was increased in arteries transduced with Ad-PKC
(Figure 3B).
Although our data clearly demonstrate the ability of PKC
to stimulate eNOS activity, the mechanism of interaction between these 2 molecules is less obvious. Data from our laboratory and others3 have shown that in vitro, PKC
is able to phosphorylate eNOS at Ser1179, suggesting the possibility of a direct interaction between PKC
and eNOS. However, in vivo there is the alternative possibility that PKC
acts upstream of one of the kinases known to directly phosphorylate eNOS, such as Akt, AMP-dependent protein kinase, or protein kinase A. Nevertheless, it is likely that PKC
acts upstream of Akt because we have shown that alteration of PKC
activity is associated with changes in Akt phosphorylation. These data are consistent with our previous study showing that PKC
is able to stimulate Akt activity in endothelial cells via direct phosphorylation of Ser473.19
On the other hand, our data also clearly show that PKC
is able to phosphorylate eNOS in Akt-1/ cells. Furthermore, in these cells, whereas Akt-2 expression level is increased, the level of P-Akt Ser473 is not further increased following transduction with PKC
. These results suggest that PKC
can act both in an Akt-1-dependent and independent manner.
It is also interesting to note that in Akt-1/ CMEC, eNOS-Thr497 was strongly dephosphorylated and PKC
overexpression in these cells did not increase its phosphorylation level suggesting that PKC
isoform is not the PKC responsible for constitutive phosphorylation of eNOS at Thr497 (Figure 4).
In conclusion, the data herein are the first demonstration that PKC
stimulates NO production in the endothelial cells and affects arterial blood flow in vivo; therefore, suggesting that pharmacological modulation of PKC
activity in the endothelium may have utility for the treatment of vascular disorders associated with vascular dysfunction and impaired blood flow.
| Acknowledgments |
|---|
. | Footnotes |
|---|
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Rask-Madsen and G. L. King Differential Regulation of VEGF Signaling by PKC-{alpha} and PKC-{epsilon} in Endothelial Cells Arterioscler. Thromb. Vasc. Biol., May 1, 2008; 28(5): 919 - 924. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Murakami, A. Elfenbein, and M. Simons Non-canonical fibroblast growth factor signalling in angiogenesis Cardiovasc Res, May 1, 2008; 78(2): 223 - 231. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sud, S. Wedgwood, and S. M. Black Protein kinase C{delta} regulates endothelial nitric oxide synthase expression via Akt activation and nitric oxide generation Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L582 - L591. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Madeddu, N. Kraenkel, L. S. Barcelos, M. Siragusa, P. Campagnolo, A. Oikawa, A. Caporali, A. Herman, O. Azzolino, L. Barberis, et al. Phosphoinositide 3-Kinase {gamma} Gene Knockout Impairs Postischemic Neovascularization and Endothelial Progenitor Cell Functions Arterioscler. Thromb. Vasc. Biol., January 1, 2008; 28(1): 68 - 76. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zaccolo and M. A. Movsesian cAMP and cGMP Signaling Cross-Talk: Role of Phosphodiesterases and Implications for Cardiac Pathophysiology Circ. Res., June 8, 2007; 100(11): 1569 - 1578. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ramzy, V. Rao, L. C. Tumiati, N. Xu, R. Sheshgiri, J. Jackman, D. H. Delgado, and H. J. Ross Endothelin-1 accentuates the proatherosclerotic effects associated with C-reactive protein J. Thorac. Cardiovasc. Surg., May 1, 2007; 133(5): 1137 - 1146. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Motley, K. Eguchi, M. M. Patterson, P. D. Palmer, H. Suzuki, and S. Eguchi Mechanism of Endothelial Nitric Oxide Synthase Phosphorylation and Activation by Thrombin Hypertension, March 1, 2007; 49(3): 577 - 583. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takeda, A. R. Kazarov, C. E. Butterfield, B. D. Hopkins, L. E. Benjamin, A. Kaipainen, and M. E. Hemler Deletion of tetraspanin Cd151 results in decreased pathologic angiogenesis in vivo and in vitro Blood, February 15, 2007; 109(4): 1524 - 1532. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Anton, M. Y. Cortez-Cooper, A. E. DeVan, D. B. Neidre, J. N. Cook, and H. Tanaka Resistance training increases basal limb blood flow and vascular conductance in aging humans J Appl Physiol, November 1, 2006; 101(5): 1351 - 1355. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-a Kim, M. Montagnani, K. K. Koh, and M. J. Quon Reciprocal Relationships Between Insulin Resistance and Endothelial Dysfunction: Molecular and Pathophysiological Mechanisms Circulation, April 18, 2006; 113(15): 1888 - 1904. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Cale and I. M. Bird Dissociation of endothelial nitric oxide synthase phosphorylation and activity in uterine artery endothelial cells Am J Physiol Heart Circ Physiol, April 1, 2006; 290(4): H1433 - H1445. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Liu and A. Horowitz A PDZ-binding Motif as a Critical Determinant of Rho Guanine Exchange Factor Function and Cell Phenotype Mol. Biol. Cell, April 1, 2006; 17(4): 1880 - 1887. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Pollock and P. K. Carmines NOS3 Regulation: Renal Tubular Epithelial Cells Are Not Simply Large Endothelial Cells Hypertension, January 1, 2006; 47(1): 19 - 21. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |