| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Departments of Biopathology and Diagnostic Imaging (R.M., F.V., F.S., F.A., A.F., P.S., G.N.), Neuroscience (S.B., I.F.), Internal Medicine (R.M., F.C., R.L., F.R.), and Experimental Medicine and Biochemical Sciences (S.G., C.F.), University of Tor Vergata, Rome, Italy; the Division of Cardiovascular Medicine (J.M., F.R., G.N.), University of Arkansas for Medical Sciences, Little Rock; and the Center of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases (R.M., F.V., F.S., F.A., A.F., P.S. R.L., F.R., G.N.), School of Medicine, University of Tor Vergata, Rome, Italy.
Correspondence to Dr Giuseppe Novelli, Department of Biopathology and Diagnostic Imaging, or Dr Silvia Biocca, Department of Neuroscience, University of Tor Vergata, Via Montpellier 1, Rome, Italy, 00133. Email novelli{at}med.uniroma2.it or biocca@med.uniroma2.it
| Abstract |
|---|
|
|
|---|
Key Words: OLR1 myocardial infarction LOX-1 oxLDL apoptosis
| Introduction |
|---|
|
|
|---|
Most of these effects are mediated by the interaction of oxLDL with its major receptor, named LOX-1, a type-II membrane protein belonging to the C-type lectin family. LOX-1 consists of 4 domains: a short N-terminal cytoplasmic, a transmembrane, a connecting neck, and a lectin-like domain at the C terminus which binds oxLDL.11 Importantly, the integrity of the lectin-like domain is critically required for its binding activity and is highly conserved among species.12 LOX-1 is expressed in endothelial cells, macrophages, SMCs, and platelets. Furthermore, LOX-1 is present in atheroma-derived cells and is overexpressed in humans and animal atherosclerotic lesions in vivo.13 An association of polymorphisms in the human OLR1 gene and MI susceptibility has been recently reported.14,15 In particular, we have identified 7 different single nucleotide polymorphisms (SNPs), 6 of them located within introns 4, 5, and 3' UTR (untranslated region), comprised in a linkage disequilibrium (LD) block strongly associated with the elevated risk to develop MI.14 Because the SNPs related to an increased risk of MI did not affect the coding sequence of the gene, we decided to explore whether the SNPs could give rise to a functional product by examining the existence of messenger RNA (mRNA) isoforms as a consequence of alternative splicing. Using a minigene approach, we show that SNPs located in the LD block regulate the level of the new fully functional transcript by modulating the retention of exon 5 of the OLR1 gene. The identification and characterization of the new splice variant of the OLR1 gene suggest that this variant may have a functional role on plaque instability and therefore in the pathogenesis of myocardial infarction.
| Materials and Methods |
|---|
|
|
|---|
DNA Constructs
To amplify the genomic sequence surrounding the alternatively spliced exon 5 of OLR1 gene, we used the primer pair OLR1-XhoIF (5'-ACA GTC CTC GAG GTG AGT GTT CAT GGA TAT TTG-3') and OLRI-EcoRIR (5'-TGT GTG GAT ATC CTG CAG GTA GGA AAA ACA AAA-3'). We used human genomic DNA homozygous with respect to "risk" or "non-risk" haplotype at LD block of OLR1 gene as the PCR template. The PCR products were cloned into pSPL3 vector (Invitrogen) and sequenced using the primer OLR1SEQF (5'-GTT TCC TAT TCT TTG CTG AAC-3') and OLR1SEQR (5'-GTG GGG AGT AAT GTT TCT GAG-3').
To generate LOX-1-GFP and LOXIN-GFP constructs, the coding sequences of OLR1 gene and the splicing variant LOXIN were PCR-amplified from cDNA, which was derived from the human heart poly A+ RNA (Clontech) using selected oligos. For the amplification of OLR1, primers F1 (5' CCGCTCGAGATGACTTTTGATGACCTAAAG 3') and F2 (5' CGCGGATCCT GTGCTCTTAGGTTTGC 3') were used. For the amplification of LOXIN, primers F1 and F3 (5'CGCGGATCCATCA GATCAGCTGTGCTATT 3') were used. The PCR products were cloned into the XhoI/BamHI-digested pEGFP-N1 vector (Clontech) and sequenced using CEQ2000 (BeckmanCoultard).
Quantitative Real-Time PCR
Real-time RT-PCR was performed on a TaqMAN ABI 7000 Sequence Detection System (Applied Biosystems). By using the Primer Express 2.0 software (Applied Biosystems), we designed primers and MGB probes for the discrimination analysis of the 2 alternatively spliced isoforms (primers and MGB probes sequences are available on request, patent pending).
Commercially available predeveloped TaqMan endogenous reference GAPDH gene (Applied Biosystems) was used to normalize the amount of cDNA added per sample. A comparative CT method was used to determine relative quantification of RNA expression. All PCR reactions were performed in triplicate.
Cell Culture and Transfection
Human monocytes were isolated from peripheral blood mononuclear cells (PBMCs) of subjects homozygous for the "risk" and "non-risk" haplotype. We promoted their transition to macrophages in vitro as previously described.11 Differentiation was determined by flow cytometry using anti-CD36 FITC monoclonal antibody (cell purity >95%). Simian COS-7 fibroblasts were grown in Dulbeccos modified Eagles medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS). Transient transfection of COS-7 was performed using the Nucleofector kit (Amaxa Biosytems). 1 µg of plasmid DNA was added to 5x105 COS-7 suspended in 100 µL of human dermal fibroblast Nucleofector solution. The program A-24 was selected for a high density of transfection. All subjects gave informed consent, and the study protocol was approved by the Tor Vergata University Ethics Committee.
Evaluation of Apoptosis
Differentiated macrophages were cultured without serum for 15 hours and then incubated with oxLDL (100 µg/mL; Intracel) for 8 hours before detection of apoptosis. Apoptosis was evaluated by multiparameter flow cytometry using a method that distinguishes nuclei from apoptotic, necrotic, or viable lymphoid cells.16 Isolated nuclei were analyzed by fluorescence and by forward- and side-angle scatter multiparameter analysis using a FACSscan Flowcytometer (Becton Dikinson). A minimum of 5000 events was collected for each sample.
Apoptotic fibroblasts were visualized by staining with the blue fluorescent dye Hoechst 33342 (Sigma) and phosphatidylserine assay as described previously.17 Annexin V and Hoechst 33342 positive cells were counted from cells transfected with GFP, LOX-1-GFP, and LOXIN-GFP recombinant proteins.
Immunofluorescence Staining
Immunofluorescence was performed as described.18 Affinity purified anti-rabbit LOX-1 (Santa Cruz), goat anti-calnexin (Santa Cruz), and mouse anti-Golgi 58K (Sigma) protein were used as primary antibodies. Texas Red goat anti-rabbit IgG (Calbiochem), Texas Red goat anti-mouse IgG (Calbiochem), and Rhodamine RedX-conjugated affinipure rabbit anti-goat IgG (Jackson Immunoreasearch) were used as secondary antibodies. Hoechst 33342 dye was used at 1 µg/mL. Samples were examined with a DMRA Leica fluorescence microscope equipped with CCD camera. Acquired images were deconvolved using Leica Q-fluoro software and processed using Adobe Photoshop.
Western Blot Analysis and Enzymatic Digestion
PBMCs and COS-7 were lysed for 30 minutes in ice-cold cell extraction buffer (EB) (100 mmol/L NaCl, 10 mmol/L EDTA, 0.5% Nonidet P-40, 0.5% sodium deoxycholate, 10 mmol/L Tris-HCl, pH 7.4, 1 mmol/L PMSF, 10 µg/mL pepstatin A, 10 µg/mL leupeptin and 0.3 µmol/L aprotinin). Nuclei and large debris were removed by centrifugation at 290g for 10 minutes at 4°C. The supernatants were then precipitated with 5 volumes of MeOH at 20°C for 2 hours. After centrifugation (16 000g, 10 minutes, 4°C), protein pellets were dissolved in 4x sample buffer (500 mmol/L Tris-HCl, pH 6.8, 4% SDS, 20% glycerol, 40 mmol/L DTT and 0.02% bromophenol blue) and heated at 95°C for 5 minutes.
Blots were probed with rabbit anti-LOX-1 antibody (Santa Cruz). Immunoreactive bands were detected with sheep anti-rabbit IgG horseradish peroxidase (Amersham) and visualized by ECL (Sigma). Enzymatic deglycosylation was performed as previously described.18
Statistical Analysis
All statistical analyses were performed using SPSS version13 software. Data are presented as means +1 SD. Normal distribution of continuous variables has been verified by KolmogorovSmirnov with Lillefors correction. Differences in means of continuous variables were analyzed by impaired t test or ANOVA as needed. Bonferroni correction was used for multiple comparison.
| Results |
|---|
|
|
|---|
|
SNPs Located in the LD Block Modulate the Levels of the mRNA Isoforms
To find in vivo evidence that SNPs located in the LD block modulate the level of the two mRNA isoforms, we performed an isoform-specific real-time PCR starting from total RNA of human monocyte-derived macrophages of selected patients carrying the "risk" and "non-risk" haplotype at OLR1 gene. By this analysis we noted a marked difference in the mRNA ratio (OLRI/LOXIN) according to the haplotype. In particular, the OLR1/LOXIN mRNA ratio was 33% higher in human monocyte-derived macrophages of subjects homozygous for the "risk" haplotype compared with homozygous for the "non-risk" haplotype (Figure 2A). The finding that the relative amount of the LOXIN transcript is significantly greater in subjects carrying the "non-risk" haplotype strongly suggests a negative link between levels of LOXIN mRNA and the incidence of MI in humans.
|
To further confirm the regulatory role of the intronic polymorphism, we extended these studies by constructing minigenes carrying the "risk" and "non-risk" haplotypes with genomic sequences containing intron 4, exon 5, and intron 5 (Figure 2B). These constructs were transfected in COS-7 fibroblasts and the ratio of unspliced (exon 5+) to spliced (exon 5) transcript was analyzed by real time isoform-specific PCR. As can be seen in Figure 2C, the ratio was 27% higher in RNA extracted from cells transfected with minigenes carrying the "risk" haplotype. These in vitro experiments not only suggest that the relative abundance of the 2 isoforms is modulated by the intronic SNPs mapping within the LD block, but also confirm the previously described in vivo results (Figure 2A).
Subcellular and Membrane Distribution of LOX-1 and the LOXIN Splice Variant
To investigate the cellular localization of the full-length and the splice variant, we constructed two plasmids that allowed the efficient expression of LOX-1 and LOXIN in mammalian cells fused, C-terminally, to the green fluorescent protein (GFP). Immunofluorescence analysis of transfected COS-7 fibroblasts revealed that the intracellular expression of the full-length LOX-1GFP causes a cell-lethal phenotype. Many transfected cells are roundly shaped and tend to detach from the dish. On the contrary, LOXIN-GFP isoform is efficiently expressed, and its expression does not result in cytotoxicity. Notwithstanding the toxic effect, many LOX-1GFP transfected cells retain normal morphology, and this has allowed us to study its intracellular distribution. As shown in Figure 3A, (panels A through C), LOX-1 distributed in the ER and in the Golgi apparatus. At 24 hours after transfection, LOX-1 colocalized almost exclusively with the Golgi 58K protein, indicating that the protein initially traffics along the secretory pathway. In contrast, LOXIN-GFP was not detectable in the Golgi patches of permeabilized COS-7 cells. In these cells we observed a more widespread staining, characteristic of typical ER distribution. In 40% to 50% of transfected cells, an accumulation of fluorescence in the perinuclear area was also detected (Figure 3A, panels D through F).
|
The 2 GFP-tagged isoforms were also labeled for surface receptors in live cells (Figure 3B and 4
). At 24 hours after transfection, over 90% of cells expressing LOX-1GFP showed a typical punctuate plasma membraneassociated fluorescence (Figure 3B, panel C). Remarkably, <10% of COS-7 cells transfected with LOXIN-GFP showed surface staining (Figure 3B, panel F). The very low expression of LOXIN at the plasma membrane demonstrates that truncation of the C-terminal portion in LOXIN protein leads to a profound effect on cellular trafficking of the protein to the plasma membrane.
|
The expression level of the 2 isoforms in transfected fibroblasts was also confirmed in Western blot. A single band corresponding to LOX-1GFP and LOXIN-GFP fusion proteins were detected (Figure 4A, lanes 1 and 2). The molecular weight of the bands corresponded to the predicted molecular weight of nonglycosylated proteins. The LOX-1GFP band was, however, much fainter, probably because of the previously mentioned cytotoxic effect of this construct (Figure 4A, lane 2).
In Vivo Expression of LOX-1 and LOXIN Isoforms
To verify whether LOXIN transcript is indeed translated in vivo and to analyze the level of its expression, we used Western blot to examine the relative amounts of the 2 isoforms in PBMCs derived from selected subjects with different haplotypes. As shown in Figure 4B, immunoreaction of cell lysates showed 2 major bands of 34 and 22 kDa, corresponding to the predicted molecular weight of the 2 isoforms. Interestingly, we noticed a relative increase in the amount of LOXIN in cells derived from subjects homozygous for the "non-risk" haplotype (Figure 4B). Removal of N-linked glycans by PNGase digestion (Figure 4B) resulted in the disappearance of few faint bands, indicating that the two bands, 34 and 22 kDa, correspond to the unglycosylated LOX-1 and LOXIN proteins. In many gels, including the one shown in Figure 4B, a third band of 26 kDa was also observed. This band may represent a degradation product of the LOX-1 protein that we are currently studying.
In Vivo Proapoptotic Effect of LOX-1 and Rescue By LOXIN
We considered that an altered balance between the 2 isoforms could be related to the increased susceptibility to apoptosis. To test this notion, we analyzed oxLDL-induced apoptosis in a monocytes/macrophages in vivo assay.19 Human monocytes were isolated from buffy coats of healthy donors carrying the "risk" and "non-risk" haplotype at LD block of OLR1 gene. After Ficoll gradient centrifugation, monocytes were separated to induce differentiation in macrophages. 100 µg/mL of oxLDL was added to these cells to induce apoptosis. Remarkably, flow cytometric analysis of macrophages derived from subjects homozygous for the "non-risk" haplotype showed a 24% reduction in apoptotic cell number compared with the homozygous for the "risk" haplotype when treated with the oxLDL (Figure 5A). Our data suggest that increased levels of LOXIN in macrophages may relate to reduced level of apoptosis.
|
Because the 2 isoforms are physiologically coexpressed in PBMCs with a different balance related to the haplotype, and increased LOXIN levels relate to the "non-risk" haplotype, we explored the possibility that LOXIN isoform may have a protective effect versus apoptosis. To test this hypothesis, we transfected COS-7 fibroblasts with DNA encoding for LOXIN-GFP and LOX-1GFP alone or cotransfected with a fixed amount of LOX-1 and increasing concentration of LOXIN-GFP plasmids (as indicated in Figure 5B). The phenotype of transfected cells was analyzed using 2 markers of apoptosis. First, we used Annexin V, which detects alteration at the level of the plasma membrane. Next, we examined the uptake of blue-fluorescent Hoechst 33342 dye, which stains the condensed chromatin of apoptotic cells more brightly than the chromatin of nonapoptotic cells. On the basis of the combined staining patterns of these dyes, we were able to distinguish between normal, apoptotic, and dead cells. As mentioned above, cells expressing the LOX-1GFP fusion protein did not thrive, with many of the cells exhibiting cell shrinkage, which is a feature of apoptosis. Thus, LOX-1GFP alone resulted in 36% of cells developing apoptosis. In contrast, LOXIN expression was not toxic and the number of apoptotic cells was comparable to the mock-transfected cells. Interestingly, the coexpression of LOXIN-GFP resulted in a complete dose-dependent rescue of the LOX-1-GFPinduced phenotype. It is worth noting that a very low dose of LOXIN, corresponding to a ratio of 1:4 with LOX-1, resulted in a 72% reduction in the number of apoptotic cells, and a 1:1 ratio of the 2 plasmids used for transfection completely prevented the phenotype. This finding suggests that small differences in LOX-1/LOXIN balance and, especially, a small increase in LOXIN expression, may have a very profound effect on the cytotoxic phenotype also in vivo.
| Discussion |
|---|
|
|
|---|
We show that SNPs located in the LD block modulate the relative abundance of the 2 transcripts. Both in vivo and in vitro experiments indicate that the new splice variant LOXIN is expressed at a similar level as the full-length receptor LOX-1. Interestingly, macrophages from subjects carrying the "non-risk" haplotype express more LOXIN and result in fewer cells undergoing apoptosis on oxLDL induction. Macrophages play an important role in all phases of atherosclerosis, from the development of the fatty steak to the process that ultimately contribute to plaque rupture and myocardial infarction.2123 Indeed, evidence from pathological studies link apoptosis of plaque resident macrophages with rupture and thrombosis of atherosclerotic lesions and subsequent development of acute vascular complication. In particular, it has been proposed that extensive apoptosis of macrophages occurs only at sites of plaque rupture and possibly contributes to the process of rupture and thrombosis.24 Our finding that increased levels of LOXIN in macrophages relate to reduced levels of apoptosis suggests that this in turn could result in plaque stabilization by influencing the nature of the vulnerable plaque.
We report that C-terminal splice variants of LOX-1 receptor differentially traffic from the ER to the plasma membrane. In cell lines we show that LOXIN isoform displays no surface expression in 90% of transfected cells and lower expression in 1/10 of the cells. This is attributable to retention of LOXIN in the ER and accumulation of the protein in the perinuclear region. Regulation of the trafficking of LOX-1 receptors to the plasma membrane may provide an essential mechanism for the control of its function in vivo. In this context, different splice variant isoforms in the C-terminal domain have been reported for other receptors, such as glutamate receptors. In this case, the domain has been shown to be the site of interactions of proteins involved in the trafficking and stabilization of glutamate receptors in the synaptic membrane and, in turn, to play a role in synaptic strength and plasticity.25,26 Whether LOXIN forms heteromeric receptors with LOX-1 and regulates its intracellular traffic in vivo is under study.
LOX-1 receptor, when ectopically expressed in fibroblasts, is toxic and results in a high percentage of cells undergoing apoptosis. We demonstrate here that LOXIN molecules, when coexpressed with LOX-1 receptors, have a protective role and are able to rescue the apoptotic phenotype. The mechanism by which LOXIN exerts its protective role is not known but we propose different hypotheses. First, LOXIN may act on LOX-1 receptors by forming inactive heterodimers. Because the LOXIN splice variant lacks exon 5, it misses the binding region of ox-LDL. By increasing the intracellular LOXIN relative amount, the number of functional receptors able to bind oxLDL may be reduced. Because oxLDL induces apoptosis in macrophages, thereby reducing oxLDL binding sites, fewer cells will go through apoptosis. Secondly, LOXIN may exert its action on the transport of LOX-1 receptors toward the cellular membrane, blocking them into the ER and downregulating their membrane expression. Thirdly, the LOXIN itself may even have an antiapoptotic activity. These different hypotheses warrant further studies.
It is important to note that the expression level of both isoforms in vivo is similar. Subjects homozygous for "non-risk" haplotype show a small increase in LOXIN expression compared with homozygous for "risk" haplotype. In vitro experiments confirmed this fine balance between the 2 isoforms. A small amount of LOXIN is sufficient to rescue the lethal phenotype.
We conclude that SNPs located in the LD block of OLR1 gene, with their functional role, may represent an important genetic risk factor for prediction of susceptibility to myocardial infarction. Moreover LOXIN could represent a new target for prevention of progression and destabilization of atheroslerotic plaque. Therefore, new research or therapeutic strategies favoring increasing expression of LOXIN could be effective for preventing plaque instability.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Steinberg D. Atherogenesis in perspective: hypercholesterolemia and inflammation as partners in crime. Nat Med. 2002; 8: 12111217.[CrossRef][Medline] [Order article via Infotrieve]
3. Suzuki T, Kohno H, Hasegawa A, Toshima S, Amaki T, Kurabayashi M, Nagai R, Suzuki T, Amaki T, Nagai R, Hasegawa A, Toshima S, Kurabayashi MH, Shimada K, Nakamura H, Teramoto T, Yamaguchi H, Nishiyama S, Takahashi H, Michishita I, Sugano Z, Konoshi K. Clinical Trial of Oxidized LDL (CTOL) investigators. Diagnostic implications of circulating oxidized low density lipoprotein levels as a biochemical risk marker of coronary artery disease. Clin Biochem. 2002; 35: 347353.[Medline] [Order article via Infotrieve]
4. Mehta JL, Li D. Identification, regulation and function of a novel lectin-like oxidized low-density lipoprotein receptor. J Am Coll Cardiol. 2002; 39: 14291435.
5. Chen M, Masaki T, Sawamura T. LOX-1, the receptor for oxidized low-density lipoprotein identified from endothelial cells: implications in endothelial dysfunction and atherosclerosis. Pharmacol Ther. 2002; 95: 89100.[CrossRef][Medline] [Order article via Infotrieve]
6. Ehara S, Ueda M, Naruko T, Haze K, Itoh A, Otsuka M, Komatsu R, Matsuo T, Itabe H, Takano T, Tsukamoto Y, Yoshiyama M, Takeuchi K, Yoshikawa J, Becker AE. Elevated levels Elevated levels of oxidized low density lipoprotein show a positive relationship with the severity of acute coronary syndromes. Circulation. 2001; 103: 19551960.
7. Chen J, Mehta JL, Haider N, Zhang X, Narula J, Li D. Role of caspases in Ox-LDL-induced apoptotic cascade in human coronary artery endothelial cells. Circ Res. 2004; 94: 269270.
8. Hardwick SJ, Hegyi L, Clare K, Law NS, Carpenter KL, Mitchinson MJ, Skepper JN. Apoptosis in human monocyte-macrophage exposed to oxidized low-density lipoprotein. J Pathol. 1996; 179: 294302.[CrossRef][Medline] [Order article via Infotrieve]
9. Sata M, Walsh K. Oxidized LDL activates Fas-mediated endothelial cell apoptosis. J Clin Invest. 1998; 102: 16821689.[Medline] [Order article via Infotrieve]
10. Lee T, Chau L. Fas/Fas ligand-mediated death pathway is involved in oxLDL-induced apoptosis in vascular smooth muscle cells. Am J Physiol Cell Physiol. 2001; 280: C709718.
11. Sawamura T, Kume N, Aoyama T, Moriwaki H, Hoshikawa H, Aiba Y, Tanaka T, Miwa S, Katsura Y, Kita T, Masaki T. An endothelial receptor for oxidized low-density lipoprotein. Nature. 1997; 386: 7377.[CrossRef][Medline] [Order article via Infotrieve]
12. Shi X, Niimi S, Ohtani T, Machida S. Characterization of residues and sequences of the carbohydrate recognition domain required for cell surface localization and ligand binding of human lectin-like oxidized LDL receptor. J Cell Sci. 2001; 114: 12731282.[Abstract]
13. Kataoka H, Kume N, Minami M, Moriwaki H, Sawamura T, Masaki T, Kita T. Expression of lectin-like oxidized low-density lipoprotein receptor-1 in human atherosclerotic lesions. Circulation. 1999; 99: 31103117.
14. Mango R, Clementi F, Borgiani P, Forleo GB, Federici M, Contino G, Giardina E, Garza L, Fahdi IE, Lauro R, Mehta JL, Novelli G, Romeo F. Association of single Association of single nucleotide polymorphisms in the oxidized LDL receptor 1 (OLR1) gene in patients with acute myocardial infarction. J Med Genet. 2003; 40: 933936.
15. Tatsuguchi M, Furutani M, Hinagata J, Tanaka T, Furutani Y, Imamura S, Kawana M, Masaki T, Kasanuki H, Sawamura T, Matsuoka R. Oxidized LDL receptor gene (OLR1) is associated with the risk of myocardial infarction. Biochem Biophys Res Commun. 2003; 303: 247250.[CrossRef][Medline] [Order article via Infotrieve]
16. Matteucci C, Grelli S, De Smaele E, Fontana C, Mastino A. Identification of nuclei from apoptotic, necrotic, and viable lymphoid cells by using multiparameter flow cytometry. Cytometry. 1999; 35: 145153.[CrossRef][Medline] [Order article via Infotrieve]
17. Filesi I, Cardinale A, van de Sar S, Cowell IG, Singh P, Biocca S. Loss of Heterochromatin Protein 1(HP1) chromodomain function in mammalian cells by intracellular antibodies causes cell death. J Cell Sci. 2002; 115: 18031813.
18. Cardinale A, Filesi I, Mattei S, Biocca S. Intracellular targeting and functional analysis of single-chain Fv fragments in mammalian cells. Methods. 2004; 34: 171178.[Medline] [Order article via Infotrieve]
19. Heinloth A, Brune B, Fischer B, Galle J. Nitric oxide prevents oxidized LDL-induced p53 accumulation, cytochrome c translocation, and apoptosis in macrophages via guanylate cyclase stimulation. Atherosclerosis. 2002; 162: 93101.[CrossRef][Medline] [Order article via Infotrieve]
20. Pagani F, Baralle FE. Genomic variants in exons and introns: identifying the splicing spoilers. Nat Rev Genet. 2004; 5: 389396.[CrossRef][Medline] [Order article via Infotrieve]
21. Li AC, Glass CK. The macrophage foam cell as a target for therapeutic intervention. Nat Med. 2002; 8: 12351242.[CrossRef][Medline] [Order article via Infotrieve]
22. Kavurma MM, Bhindi R, Lowe HC, Chesterman C, Khachigian LM. Vessel wall apoptosis and atherosclerotic plaque instability. J Thromb Haemost. 2005; 3: 465472.[CrossRef][Medline] [Order article via Infotrieve]
23. Tabas I. Apoptosis and plaque destabilization in atherosclerosis: the role of macrophage apoptosis induced by cholesterol. Cell Death Differ. 2004; 11: 1216.[CrossRef]
24. Kolodgie FD, Narula J, Burke AP, Haider N, Farb A, Hui-Liang Y, Smialek J, Virmani R. Localization of apoptotic macrophages at the site of plaque rupture in sudden coronary death. Am J Pathol. 2000; 157: 12591268.
25. Barry MF, Ziff EB. Receptor trafficking and the plasticity of excitatory synapses. Curr Opin Neurobiol. 2002; 12: 279286.[CrossRef][Medline] [Order article via Infotrieve]
26. Carroll RC, Zukin RS. NMDA-receptor trafficking and targeting: implications for synaptic transmission and plasticity. Trends Neurosci. 2002; 25: 571577.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
T. Chen, Z. Huang, L. Wang, Y. Wang, F. Wu, S. Meng, and C. Wang MicroRNA-125a-5p partly regulates the inflammatory response, lipid uptake, and ORP9 expression in oxLDL-stimulated monocyte/macrophages Cardiovasc Res, July 1, 2009; 83(1): 131 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. L. Francone, M. Tu, L. J. Royer, J. Zhu, K. Stevens, J. J. Oleynek, Z. Lin, L. Shelley, T. Sand, Y. Luo, et al. The hydrophobic tunnel present in LOX-1 is essential for oxidized LDL recognition and binding J. Lipid Res., March 1, 2009; 50(3): 546 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Brinkley, N. Kume, H. Mitsuoka, M. D. Brown, D. A. Phares, R. E. Ferrell, T. Kita, and J. M. Hagberg Variation in the human lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1) gene is associated with plasma soluble LOX-1 levels Exp Physiol, September 1, 2008; 93(9): 1085 - 1090. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Medina, F. Gao, W. Ruan, J. I. Rotter, and R. M. Krauss Alternative Splicing of 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Is Associated With Plasma Low-Density Lipoprotein Cholesterol Response to Simvastatin Circulation, July 22, 2008; 118(4): 355 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Thum and J. Borlak LOX-1 Receptor Blockade Abrogates oxLDL-induced Oxidative DNA Damage and Prevents Activation of the Transcriptional Repressor Oct-1 in Human Coronary Arterial Endothelium J. Biol. Chem., July 11, 2008; 283(28): 19456 - 19464. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |