Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2005;96:831-837
Published online before print March 31, 2005, doi: 10.1161/01.RES.0000164401.21929.CF
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
96/8/831    most recent
01.RES.0000164401.21929.CFv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Y.
Right arrow Articles by Loscalzo, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Y.
Right arrow Articles by Loscalzo, J.
Related Collections
Right arrow Physiological and pathological control of gene expression
Right arrow Oxidant stress
Right arrow Other Vascular biology
(Circulation Research. 2005;96:831.)
© 2005 American Heart Association, Inc.


Molecular Medicine

Adenosine-Dependent Induction of Glutathione Peroxidase 1 in Human Primary Endothelial Cells and Protection Against Oxidative Stress

Yufeng Zhang*, Diane E. Handy*, Joseph Loscalzo

From the Whitaker Cardiovascular Institute and Evans Department of Medicine, Boston University School of Medicine, Boston, Mass.

Correspondence to Joseph Loscalzo, MD, PhD, Boston University School of Medicine, Whitaker Cardiovascular Institute, 715 Albany St, W507, Boston, MA 02118. E-mail jloscalz{at}bu.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cellular glutathione peroxidase (GPx-1), a selenocysteine-containing enzyme, plays a central role in protecting cells from oxidative injury. GPx-1 is ubiquitously expressed in eukaryotic cells where it reduces hydrogen and lipid peroxides to alcohols. Adenosine, which is released from stressed or injured cells, protects against ischemia/reperfusion injury and apoptosis. In this study, we hypothesize that the cytoprotective effect of adenosine involves an increase in the activity of GPx-1. Treatment of human primary pulmonary artery endothelial cells (HPAECs) with 50 µmol/L adenosine in the presence of 10 µmol/L erytho-9-(2-hydroxy-3-nonyl)adenine (EHNA), an adenosine deaminase inhibitor, for 48 hours increased GPx-1 mRNA levels 2-fold. GPx-1 protein and enzyme activity also increased {approx}2-fold after treatment. The induction of GPx-1 expression was found to be a consequence of increased mRNA stability and not an increase in transcription. Bisindolylmaleimide I (BIM), a protein kinase C signaling pathway inhibitor, significantly attenuated the induction of GPx-1 mRNA by {approx}36%. The adenosine/EHNA-treated cells were more resistant to hydrogen peroxide stress. Both pharmacological inhibition and siRNA knockdown of GPx-1 attenuated the protective affect of adenosine/EHNA treatment, indicating that the adenosine-induced increase in GPx-1 contributes to an increase in cellular protection against oxidative stress. These data suggest that adenosine may protect the cardiovascular system from ischemia/reperfusion injury, in part, by enhancing the expression of the central intracellular antioxidant enzyme, GPx-1.


Key Words: adenosine • antioxidant • cellular glutathione peroxidase • endothelial cells • RNA stability


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Adenosine is a ubiquitous molecule with a wide distribution in many tissues and numerous physiological actions in the cardiovascular, nervous, renal, pulmonary, and immune systems. Exposure of rabbit heart to adenosine increases tolerance of the myocardium to subsequent ischemia,1 similar to ischemic preconditioning. In isolated hearts, adenosine enhanced recovery of contractile function after no-flow ischemia compared with control hearts.2 The protective role of adenosine against myocardial ischemia/reperfusion injury has also been observed in situ3 as infarct size is significantly reduced by adenosine infusion during the reperfusion period. The protective role of adenosine in ischemia/reperfusion injury has also been documented in human studies. In a prospective clinical trial, the Acute Myocardial Infarction Study of Adenosine (AMISTAD) trial, adenosine given within 6 hours of the onset of acute myocardial infarction resulted in a significant reduction in infarct size.4 Although the myocardial protective role of adenosine is widely recognized, the underlying mechanism still remains unclear. Owing to an important role of reactive oxygen species (ROS) in ischemia/reperfusion injury in myocardium as well as in the brain,5,6 it is likely that adenosine may increase resistance to oxidative stress. In fact, studies in cultured chick cardiomyocytes showed that the adenosine agonist, AMP579, directly protects these cells by attenuating intracellular oxidant stress during reoxygenation.7 Adenosine attenuates oxidant injury in human proximal tubular cells,8 and in vivo, adenosine treatment before or after ischemia protects the kidney from ischemia/reperfusion injury.9,10 Adenosine also provides protection against oxidant injury in neural cells11 and plays a role in cerebral ischemic preconditioning.12

Glutathione peroxidases (GPxs) are selenocysteine-containing proteins that serve an important role in the cellular defense against oxidant stress by reducing H2O2 and a wide range of organic hydroperoxides. GPx-1, cellular glutathione peroxidase, is the most abundant isoform within eukaryotic cells and is a major intracellular antioxidant enzyme.13 GPx-1 transcription is induced by oxidant stress,14 and levels of GPx-1 increase during ischemia/reperfusion.15,16 Previously, we have found that GPx-1–deficient mice have endothelial dysfunction, an increase in the oxidant stress products iPF2{alpha}-III isoprostanes, and abnormal cardiac function after ischemia/reperfusion injury.17,18 Other studies suggest a protective role for GPx-1 in ischemia/reperfusion as increased expression of GPx-1 in transgenic mice decreases tissue damage after cerebral or myocardial ischemia/reperfusion.19,20 In this report, we examine the relationship between adenosine and GPx-1 in mediating cytoprotection against oxidant stress.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Chemicals and Reagents
Adenosine and EHNA [erytho-9-(2-hydroxy-3-nonyl)adenine] were obtained from Sigma. PD98059, SB203580, bisindolylmaleimide I (BIM), and LY294002 were obtained from Calbiochem. FuGENE 6 transfection reagent was obtained from Roche Molecular Biochemicals. Anti–human GPx-1 monoclonal antibody was purchased from Medical & Biological Laboratories Co, anti–ß-actin antibody was obtained from Santa Cruz Biotechnology, and peroxidase-conjugated anti-mouse and anti-goat antibody were purchased from Sigma.

Cell Culture
Primary human pulmonary artery endothelial cells (HPAECs) were purchased from Cambrex and were used up to passage 10. Cells were grown in endothelial growth medium-2-MV (EGM-2-MV, Cambrex) to 90% to 95% confluence, and then treated with reagents as supplements to endothelial growth medium-2 (EGM-2, Clonetics), as indicated.

Northern Blot Analysis
HPAECs were grown to 90% confluence in EGM-2-MV medium in 60-mm dishes and treated with different reagents in the presence of EGM-2. Total RNA was extracted with Trizol (Invitrogen); 5 µg total RNA from each sample was fractionated on 1.2% formaldehyde-agarose gels and transferred onto GeneScreen Plus membranes. Human GPx-1 or glyceraldehyde-3-phosphate dehydrogenase (G3PDH) cDNA fragments were labeled with {alpha}-[32P]dCTP using a random priming kit (Roche Molecular Biochemicals), and hybridization was performed for 3 hours at 65°C in Quickhyb solution (Strategene), followed by serial washes for 15 minutes each in 0.1X SSC, 0.1% SDS at room temperature, 45°C, and 65°C. Membranes were stripped and rehybridized with the G3PDH probe. The quantitative analysis of hybridization signals was performed using ZeroDscan software or after scanning with a Versadoc imager. Analysis was performed with the QuantityOne software from Biorad. To correct for gel loading, GPx-1 band densities were normalized to G3PDH band densities.

GPX-1 mRNA Stability
HPAECs were grown to 90% confluence in EGM-2-MV and then in EGM-2 medium with or without supplementation with 50 µmol/L adenosine /10 µmol/L EHNA for 48 hours. Actinomycin D at a concentration of 5 µg/mL was then added, and cells were harvested at 2, 4, 6, 9.5, and 11 hours. Total RNA was subjected to Northern blot analysis for GPx-1 expression.

GPx-1 Promoter Activity Analysis
A human GPx-1 promoter fragment (–580/+47) cloned into the pGL-3 basic vector (Promega) was used to assay promoter function. HPAECs were seeded into 12 well plates at a density of 5x104/mL in EGM-2-MV medium. The human GPx-1 promoter construct (0.5 µg) was mixed with 3 µL of FuGENE 6 and 25 ng renilla luciferase control reporter vector, pRL-CMV (Promega), for each well, and incubated with the cells for 6 hours. Medium was then replaced with fresh EGM-2 medium supplemented with various reagents. After 24 hours, cells were lysed, and the luciferase and renilla luciferase activities were measured with a luminometer (Turner Designs, TD-20e). Luciferase activity was corrected with renilla luciferase activity to normalize for transfection efficiency.

Western Blot Analysis of GPx-1
For determination of GPx-1 protein expression levels, HPAECs were lysed with ice-cold RIPA buffer (50 mmol/L Tris-HCl, pH 7.4, 150 mmol/L NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate) supplemented with a protease inhibitor cocktail (Pierce Biotechnology). Protein samples (30 µg) were separated on 10% SDS-polyacrylamide gels (BioRad) and transferred to nitrocellulose membranes. The membranes were probed with 10 µg/mL monoclonal anti-GPx-1 antibody, followed by a 1:2000 dilution of peroxidase-conjugated anti-mouse IgG antibody (Sigma). Detection was accomplished with an ECL reagent (Amersham). The membranes were then stripped and reprobed with 1 µg/mL anti–ß-actin antibody.

Cellular GPx Activity Assay
HPAECs were grown on 100-mm dishes until 80% confluent. Cells were treated with reagents dissolved in EGM-2 for 2 days, with fresh medium and reagents added daily. Cellular extracts were prepared by sonication in ice-cold buffer (50 mmol/L Tris-HCl, pH 7.5, 5 mmol/L EDTA, and 1 mmol/L DTT). After sonication, lysed cells were centrifuged at 10 000g for 20 minutes, and GPx-1 activity was measured in the supernatant. Cellular GPx activity (nmol NADPH/min/mL) was measured using an assay kit (Calbiochem) that measures the coupled oxidation of NADPH during glutathione reductase (GR) recycling of oxidized glutathione from GPx-1–mediated reduction of t-butyl peroxide. In the assay, excess GR, glutathione, and NADPH were added. The activity was normalized to protein concentration.

Trypan Blue Exclusion
HPAECs were treated with or without 50 µmol/L adenosine/10 µmol/L EHNA for 48 hours. Cells were then transferred into 100-mm plates for an additional 4 hours of treatment with adenosine/EHNA and/or 10 mmol/L mercaptosuccinate (MSA), an inhibitor of GPx-1. After removal of this media, cells were then treated with 500 µmol/L H2O2 for 2 hours, after which they were trypsinized and prepared for trypan blue exclusion. Briefly, cells were resuspended in HBSS buffer (Cambrex), mixed 1:1 with 0.4% trypan blue (Sigma), and incubated for 5 minutes, after which stained and unstained cells were counted separately with a hemocytometer. Cells stained blue were considered nonviable, whereas unstained cells were considered viable. The percentage of stained cells was used as an index of cell death.

Transfection With siRNA
Flasks (75 cm2) of nearly confluent HPAECs were transfected for 4.5 hours with a 10-mL solution of OptiMEM1 (Invitrogen) containing 36 nmol/L Stealth siRNA (Invitrogen) and 7.6 µL lipofectamine 2000 (Invitrogen). After transfection, cells were used in the trypan blue assay as earlier. The siRNA 310 sequence was GGUUCGAGCCCAACUUCAUGCUCUU, and the control (scrambled) 310 sequence was GGUAGCGCCAAUCCUUACGUCUCUU.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Adenosine/EHNA Induces GPx-1 Expression
To determine the effects of adenosine on GPx-1 expression, HPAECs were treated with 50 µmol/L adenosine and 10 µmol/L EHNA, or pretreated with 10 µmol/L EHNA for 30 minutes followed by adenosine for 48 hours. Fresh media and reagents were replaced every 24 hours. Adenosine or EHNA alone did not significantly affect GPx-1 mRNA; however, in the presence of EHNA, adenosine significantly induced GPx-1 mRNA expression (P<0.02) (Figure 1A). The induction of GPx-1 mRNA was dose-dependent (P<0.05) (Figure 1B). Additional experiments showed that this effect could not be detected earlier than 24 hours following the initiation of treatment (data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Adenosine/EHNA treatment increases GPx-1 mRNA. A, HPAECs at 90% confluence were treated with 50 µmol/L adenosine (Ado), 10 µmol/L EHNA, or 50 µmol/L adenosine plus 10 µmol/L EHNA for 2 days. Five micrograms of total RNA were analyzed by Northern blot hybridization. *P<0.02 compared with adenosine/EHNA treatment. B, HPAECs were treated with or without adenosine at doses of 10, 25, or 50 µmol/L for 2 days in the presence of EHNA. Isolated total RNA was analyzed by Northern blot hybridization. Dose response was found to be statistically significant; P<0.05.

To assess whether increases in GPx-1 mRNA corresponded to increases in GPx-1 protein expression and enzyme activity, the combination of adenosine/EHNA was used to treat cells for 48 hours, after which cellular extracts were analyzed for GPx-1 protein and for GPx-1 enzyme activity. Western blot analysis showed that adenosine/EHNA increased GPx-1 protein levels 2.3±0.3-fold (P<0.05) (Figure 2A), under conditions where mRNA levels increased {approx}2-fold (P<0.02) (Figure 1A). There was no effect of EHNA or adenosine alone on GPx-1 protein expression (data not shown). Cellular GPx-1 activity was also increased 2.2±0.2-fold (P<0.05) (Figure 2B) with adenosine/EHNA treatment. Similar results were also observed in human coronary artery endothelial cells (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Adenosine/EHNA treatment of HPAECs induces GPx-1 protein and enzyme activity to a similar extent. A, HPAECs were treated with 50 µmol/L adenosine plus 10 µmol/L EHNA for 2 days. Graph shows GPx-1 protein expression levels corrected for ß-actin levels. Difference between treated and untreated samples was statistically significant; P<0.05. B, HPAECs were treated with 50 µmol/L adenosine plus 10 µmol/L EHNA for 2 days. Cell extracts were assayed for GPx-1 activity. Graph shows activity corrected for protein content. Difference between treated and untreated samples was statistically significant; P<0.01.

Adenosine/EHNA Decreases GPx-1 mRNA Degradation
To determine the mechanism by which adenosine/EHNA upregulates GPx-1 mRNA, the human GPx-1 promoter construct was transfected into HPAECs. After 24-hour treatment with adenosine, EHNA, or adenosine/EHNA, luciferase activity was measured (Figure 3A). Adenosine alone had no significant effect on luciferase activity. EHNA caused a small (18%) but significant (P<0.05) increase in luciferase activity. By contrast, adenosine/EHNA decreased the activity of the GPx-1 promoter by {approx}35% (P<0.005), indicating that the upregulation of mRNA levels is a not a result of enhanced GPx-1 gene transcription. In the presence of actinomycin D, GPx-1 mRNA levels decreased by almost 50% after 11 hours of treatment (Figure 3B). Pretreatment with adenosine/EHNA increased GPx-1 mRNA stability such that no change in GPx-1 mRNA was detected in this time frame. Longer treatments with actinomycin D appeared to cause cell death. These data suggest that adenosine/EHNA increased expression of GPx-1 by increasing GPx-1 mRNA stability and not by increasing GPx-1 gene transcription.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Adenosine/EHNA increases GPx-1 mRNA stability. A, HPAECs cultured in 12-well plates were cotransfected with a GPx-1 promoter luciferase reporter construct and a renilla luciferase control reporter construct, pRL-CMV. After transfection, cells were treated with 50 µmol/L adenosine plus 10 µmol/L EHNA for 24 hours. Graph shows the ratio of luciferase/renilla activities in treated and untreated cells (n=36). *P<0.001 compared with adenosine/EHNA treatment; #P<0.05 compared with no treatment. B, HPAECs were grown with or without 50 µmol/L adenosine/10 µmol/L EHNA for 48 hours. Actinomycin D at a concentration of 5 µg/mL was then added, and the cells were harvested at 2 to 11 hours for GPx1 mRNA analysis. Total RNA was subjected to Northern blot analysis.

Signaling Pathways Mediating the Adenosine/EHNA-Dependent Induction of GPx-1
To study the signaling pathway involved in the induction of GPx-1 by adenosine, we performed Northern blot analysis of GPx-1 mRNA from nontreated and adenosine/EHNA-treated HPAECs in the presence or absence of inhibitors of mitogen-activated protein kinase (MAPK), protein kinase C (PKC), and phosphatidylinositol 3-kinase (PI3K) (Figure 4). Northern blot analysis showed that pretreatment with the PKC inhibitor BIM blocked GPx-1 induction by adenosine by {approx}36% (P<0.05), whereas the MAPK inhibitor SB203580 augmented GPx-1 induction by 38% (P<0.05). These results indicate that adenosine-mediated GPx-1 induction is partially mediated by PKC-dependent pathways and suggest that MAPK pathways may suppress GPx-1 expression.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Adenosine/EHNA induction of GPx-1 mRNA involves PKC-dependent pathways. HPAECs were pretreated with the MAP kinase kinase (MEK) inhibitor PD98059 at 20 µmol/L, the p38 MAPK inhibitor SB203580 at 3 µmol/L, the PKC inhibitor BIM at 5 µmol/L, or the PI3K inhibitor LY294002 at 10 µmol/L, each for 30 minutes. After pretreatment, 50 µmol/L adenosine /10 µmol/L EHNA was added for 48 hours. Total RNA was subjected to Northern blot analysis. *P<0.05 compared with adenosine/EHNA treatment.

Adenosine/EHNA Treatment Protects HPAECs From H2O2-Induced Cell Death
To determine whether the increase in GPx-1 expression resulted in an increase in intracellular antioxidant capacity, adenosine/EHNA-treated and untreated cells were challenged with 500 µmol/L H2O2 for 2 hours and assayed for cell death by trypan blue exclusion (Figure 5). Cells not treated with adenosine/EHNA and exposed to H2O2 (Figure 5A and 5B) showed a significant, {approx}2-fold increase in cell death (P<0.05). By contrast, cells treated with adenosine/EHNA and exposed to H2O2 showed only a small, nonsignificant increase in cell death (Figure 5A and 5B). These data suggest that adenosine/EHNA treatment can improve the antioxidant capacity of endothelial cells. Pretreatment of cells with MSA, a GPx-1 inhibitor, led to an {approx}5-fold increase in cell death in both untreated cells and cells treated with adenosine/EHNA, abolishing the protective effects of adenosine/EHNA treatment. To confirm that GPx-1 levels contribute to cellular protection against oxidants, siRNA was used to knockdown the expression of the enzyme, followed by adenosine/EHNA treatment and H2O2 exposure. siRNA transfection significantly increased cell death in response to H2O2 treatment (P<0.0005), whereas adenosine/EHNA cells transfected with the control (scrambled) 310 siRNA showed no significant increase in cell death in response to H2O2 treatment. Importantly, the level of cell death in the siRNA transfection after treatment with H2O2 is significantly greater than that measured in the control transfection treated with H2O2 (P<0.02).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. Adenosine/EHNA treatment protects HPAECs from hydrogen peroxide–induced cellular injury. A, HPAECs treated with or without 50 µmol/L adenosine/10 µmol/L EHNA for 2 days were seeded in 100-mm dishes for 4 hours in the presence or absence of 10 mmol/L mercaptosuccinate (MSA), a GPx-1 inhibitor, after which 500 µmol/L H2O2 was added for 2 hours. Cells were trypsinized, then incubated with trypan blue, and the percentage of blue cells was determined by counting cells on a hemocytometer. Graph shows the fold increase in dead cells under each condition relative to untreated cells. Baseline trypan blue staining in the untreated cells averaged 10.3% in 3 experiments. Overall, cell death from BMSA pretreatment followed by 500 µmol/L H2O2 was {approx}50% in both untreated and adenosine/EHNA-treated cells. B, Cells were mock transfected or transfected with siRNA 310 to knockdown GPx-1 expression or a control (scrambled) 310 siRNA, followed by no additional treatment or adenosine EHNA treatment for 2 days, and then H2O2 treatment as above. Cell death was significantly augmented by H2O2 treatment only in cells that were not treated with adenosine/EHNA (P<0.01) or in adenosine/EHNA-treated cells transfected with siRNA 310; P<0.0005, n=3. Level of cell death with the siRNA 310 in the presence of H2O2 was significantly higher than that measured for any other treatment condition (#). *Significantly different than Ado/EHNA with H2O2 (P<0.05) and Ado/EHNA without H2O2 (P<0.01).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
In this study, we found that adenosine/EHNA can upregulate GPx-1 expression and activity by decreasing GPx-1 mRNA degradation in endothelial cells. Adenosine is released in small amounts at a constant basal rate during normoxia in myocardium. During ischemia, the release of adenosine can increase 50-fold,21 and, therefore, endogenously generated adenosine released during acute myocardial ischemia is likely sufficient to induce GPx-1 expression.

Ischemic preconditioning has two phases, an early phase and a delayed phase. The early phase involves receptor-mediated signaling events that include the opening of potassium channels, the activation of kinases, and, in endothelial cells, the activation of vasodilatory responses.22 It has been speculated that the delayed phase of preconditioning involves de novo synthesis of cardioprotective proteins and posttranslational protein modification.23 The data presented in this study show that adenosine upregulates GPx-1 mRNA levels and that GPx-1 enzyme activity increases in parallel. This upregulation is the result of adenosine’s prolonging the half-life of the GPx-1 mRNA rather than facilitating gene transcription; the relatively long half-life of GPx-1 mRNA accounts for the response to adenosine requiring 24 hours of treatment.

GPx-1 expression and activity are enhanced by ROS14 and hyperoxia,24 and reduced by selenium depletion25 and TGF-ß.26 The effects of ROS and hyperoxia have been shown to be transcriptional, whereas selenium alters mRNA stability and translation of this selenocysteine-containing protein. The unique mechanism of selenocysteine incorporation at a UGA codon involves several translational cofactors, including proteins that bind to the GPx-1 mRNA and stabilize interactions among the mRNA, a specific selenocysteine elongation factor, and a selenocysteine tRNA at the ribosome.13,27 The presence of selenium appears to prevent nonsense-mediated decay of the GPx-1 mRNA.28 Inhibition of translation by puromycin, which disrupts polyribosome formation, leads to a decrease in the half-life of GPx-1 mRNA.29 Thus, there are multiple lines of evidence for a relationship between efficient translation and stability of the GPx-1 mRNA.

BIM-1 treatment partially blocks the adenosine-mediated increase in GPx-1 mRNA. This pharmacological inhibitor was used because it is most effective in targeting all PKC-subtypes; however, it has also been found to interfere with the activity of glycogen synthase kinase.30 Adenosine-mediated signaling is known to result in PKC-activation in many different cell types including endothelial cells; therefore, in our cell system it is most likely that the adenosine-mediated increase in GPx-1 mRNA that is sensitive to BIM 1 treatment is mediated by PKC.

RNA turnover, in some transcripts, is influenced by specific protein binding to AU-rich elements in the 3' untranslated region (UTR) of the mRNA followed by subsequent deadenylation and exonuclease degradation.31 Additional RNA binding factors, such as the hnRNP factors, which recognize UCCCA motifs, and nucleolin, which recognizes U/G CCCG A/G motifs, can stabilize mRNA.32,33 We analyzed the sequence of the 3' UTR of the GPx-1 mRNA for these motifs and identified one site for nucleolin binding. Published reports have shown that nucleolin can bind to the GPx-1 3' UTR,34 and others have reported that nucleolin can be targeted by some PKC isoforms.35 Additional studies are necessary to determine the precise role of PKC, and nucleolin in GPx-1 expression.

Other factors may influence the expression and activity of GPx-1. Recent analysis has suggested that nitric oxide (NO) can posttranslationally modify selenocysteine, thereby inactivating GPx-1; however, this effect requires high levels of NO generated from NO-donors or LPS-activation of iNOS.36,37 Treatments with inhibitors, such as L-buthionine sulfoximine, that decrease glutathione (GSH) production also decrease GPx-1–mediated protection against oxidative stress.38–40 Similarly, treatment with GSH precursors, such as N-acetylcysteine or L-2-oxothiazolidine-4-carboxylic acid, result in an increase in GSH production and augment GPx-1–mediated protection.39,41 Theoretically, oxidation of GSH to GSSG would also decrease GPx-1 activity. Increased GSSG levels have been measured after oxidant stress; however, these changes reflect GSH oxidation by GPx-1.42,43 Levels of reduced GSH are restored and kept virtually unchanged under most cellular conditions by the adaptive responses of glutathione reductase and other enzymes involved in GSH biosynthesis.44

Importantly, in our studies, the increase in mRNA stability correlated with an increase in GPx-1 protein levels and a significant increase in GPx-1 enzyme activity. It is most likely that the increase in enzyme activity in this system is solely a result of an increase in protein levels as the magnitude of these changes are similar. Concurrent with the increase in GPx-1 levels and activity, there was an increase in protection against H2O2-induced cell damage. MSA, a pharmacological inhibitor of GPx-1, blocked protective effects of adenosine/EHNA treatment on endothelial cells; however, MSA may have other effects on the cells. Importantly, specific targeting of GPx-1 with siRNA that resulted in decreased levels of GPx-1 protein also abrogated the protective effects of adenosine/EHNA treatment on endothelial cells.

In endothelial cells, hydrogen peroxide detoxification is primarily mediated by GPx-1 as catalase is reportedly not expressed or expressed at very low levels in these cells.45,46 Our cell culture studies showed that decreasing the levels of GPx-1 increases sensitivity to oxidants, whereas increasing levels of GPx-1 decreases sensitivity to oxidants. These findings are in agreement with other cell culture studies that used transfection methods to overexpress GPx-1, resulting in a protection against oxidative stress.47,48 In vivo studies have found that a reduction of GPx-1 expression by {approx}50%, as in heterozygous murine knockout of GPx-1, is sufficient to cause endothelial dysfunction and oxidative stress.17 Other studies in transgenic and overexpressing mice illustrate the importance of GPx-1 expression to protect against oxidant injury during ischemia/reperfusion or direct oxidant exposure. For example, GPx-1 null mice showed increased infarct size and augmented neuronal sensitivity to apoptosis in a cerebral ischemia/reperfusion model,49 whereas GPx-1 overexpression protected against ischemia/reperfusion injury.19 Similarly, GPx-1–deficient mice have impaired cardiac function after ischemia/reperfusion injury17 and an increased susceptibility to oxidants, such as paraquat and H2O2,14 whereas GPx-1 overexpression protected against myocardial ischemia/reperfusion injury.20 In this current study, the novel finding is that adenosine can mediate increased expression of this antioxidant enzyme, which results in enhanced cellular tolerance to H2O2. Thus, we speculate that augmented activity of GPx-1 may contribute to the cardioprotective role of adenosine in cardiac ischemia/reperfusion and preconditioning, especially late preconditioning, by increasing cellular tolerance to oxidant stress.

Extracellular adenosine mediates physiological responses via activation of G-protein–coupled adenosine receptors, or it is transported into the cells via nucleoside transporters where it is metabolized by adenosine deaminase or adenosine kinase. Adenosine deaminase is the major enzyme that catabolizes this nucleoside.50 Previous studies have shown that adenosine receptors are rapidly desensitized after continued adenosine treatment. In our study, adenosine was replenished in the media daily, and EHNA, an adenosine deaminase inhibitor, was included to increase the half-life of adenosine.

Many studies demonstrate that adenosine has a protective role against ischemia/reperfusion injury and can promote preconditioning for subsequent ischemia. In cultured cells, adenosine was found to activate the cellular antioxidant defense system by enhancing the activities of several antioxidant enzymes, including GPx-151; however, unlike our results, this effect was detected within 1 hour. This study also differs from our study in that cells were first treated with adenosine deaminase to remove endogenous levels of adenosine: this pretreatment actually significantly lowered the levels of the antioxidant enzymes including GPx-1. A single dose of an A1-selective adenosine receptor agonist 24 hours before coronary artery occlusion in rabbits led to protection from ischemic injury, suggesting a delayed, but long-acting, effect of adenosine receptor activation.52

It appears that adenosine enhances GPx-1 expression partially though a PKC-dependent mechanism. By use of specific receptor agonists, both the A1 and A3 subtypes have been associated with protective preconditioning in the myocardium,53 whereas A2A receptors have been shown to promote the vasodilatory effects of endothelial cells.22 It has been established that PKC is an obligatory mediator of delayed ischemic preconditioning,54,55 and A1, A3, and A2A have all been associated with mediating cytoprotection via PKC-dependent pathways. Owing to the timeframe for the upregulation of GPx-1 expression and the ability of the PKC inhibitor to block this increase, our findings suggest that adenosine-mediated increases in GPx-1 levels may play a role in delayed or late-phase ischemic preconditioning.


*    Acknowledgments
 
This study was supported by NIH grants P01 HL 55993, HL 58976, HL 61759, and N01 HV28178. We thank Stephanie Tribuna for her assistance with this manuscript, and members of the Loscalzo laboratory for their helpful discussions.


*    Footnotes
 
*Both authors contributed equally to this study. Back

Original received July 22, 2004; resubmission received January 28, 2005; revised resubmission received February 18, 2005; accepted March 21, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Liu GS, Thornton J, Van Winkle DM, Stanley AW, Olsson RA, Downey JM. Protection against infarction afforded by preconditioning is mediated by A1 adenosine receptors in rabbit heart. Circulation. 1991; 84: 350–356.[Abstract/Free Full Text]

2. Ely SW, Mentzer RM Jr, Lasley RD, Lee BK, Berne RM. Functional and metabolic evidence of enhanced myocardial tolerance to ischemia and reperfusion with adenosine. J Thorac Cardiovasc Surg. 1985; 90: 549–556.[Abstract]

3. Olafsson B, Forman MB, Puett DW, Pou A, Cates CU, Friesinger GC, Virmani R. Reduction of reperfusion injury in the canine preparation by intracoronary adenosine: importance of the endothelium and the no-reflow phenomenon. Circulation. 1987; 76: 1135–11345.[Abstract/Free Full Text]

4. Mahaffey KW, Puma JA, Barbagelata NA, DiCarli MF, Leesar MA, Browne KF, Eisenberg PR, Bolli R, Casas AC, Molina-Viamonte V, Orlandi C, Blevins R, Gibbons RJ, Califf RM, Granger CB. Adenosine as an adjunct to thrombolytic therapy for acute myocardial infarction: results of a multicenter, randomized, placebo-controlled trial: the Acute Myocardial Infarction STudy of ADenosine (AMISTAD) trial. J Am Coll Cardiol. 1999; 34: 1711–1120.[Abstract/Free Full Text]

5. Lefer DJ, Granger DN. Oxidative stress and cardiac disease. Am J Med. 2000; 109: 315–323.[CrossRef][Medline] [Order article via Infotrieve]

6. Kuroda S, Siesjo BK. Reperfusion damage following focal ischemia: pathophysiology and therapeutic windows. Clin Neurosci. 1997; 4: 199–212.[Medline] [Order article via Infotrieve]

7. Xu Z, Cohen MV, Downey JM, Vanden Hoek TL, Yao Z. Attenuation of oxidant stress during reoxygenation by AMP 579 in cardiomyocytes. Am J Physiol Heart Circ Physiol. 2001; 281: H2585–H2589.[Abstract/Free Full Text]

8. Lee HT, Emala CW. Adenosine attenuates oxidant injury in human proximal tubular cells via A(1) and A(2a) adenosine receptors. Am J Physiol Renal Physiol. 2002; 282: F844–F852.[Abstract/Free Full Text]

9. Lee HT, Emala CW. Systemic adenosine given after ischemia protects renal function via A(2a) adenosine receptor activation. Am J Kidney Dis. 2001; 38: 610–618.[Medline] [Order article via Infotrieve]

10. Lee HT, Emala CW. Protein kinase C and G(i/o) proteins are involved in adenosine- and ischemic preconditioning-mediated renal protection. J Am Soc Nephrol. 2001; 12: 233–240.[Abstract/Free Full Text]

11. Almeida CG, de Mendonca A, Cunha RA, Ribeiro JA. Adenosine promotes neuronal recovery from reactive oxygen species induced lesion in rat hippocampal slices. Neurosci Lett. 2003; 339: 127–130.[CrossRef][Medline] [Order article via Infotrieve]

12. Heurteaux C, Lauritzen I, Widmann C, Lazdunski M. Essential role of adenosine, adenosine A1 receptors, and ATP-sensitive K+ channels in cerebral ischemic preconditioning. Proc Natl Acad Sci U S A. 1995; 92: 4666–4670.[Abstract/Free Full Text]

13. Driscoll DM, Copeland PR. Mechanism and regulation of selenoprotein synthesis. Annu Rev Nutr. 2003; 23: 17–40.[CrossRef][Medline] [Order article via Infotrieve]

14. de Haan JB, Bladier C, Griffiths P, Kelner M, O’Shea RD, Cheung NS, Bronson RT, Silvestro MJ, Wild S, Zheng SS, Beart PM, Hertzog PJ, Kola I. Mice with a homozygous null mutation for the most abundant glutathione peroxidase, Gpx1, show increased susceptibility to the oxidative stress-inducing agents paraquat and hydrogen peroxide. J Biol Chem. 1998; 273: 22528–22536.[Abstract/Free Full Text]

15. Ter Horst GJ, Knollema S, Stuiver B, Hom H, Yoshimura S, Ruiters MH, Korf J. Differential glutathione peroxidase mRNA up-regulations in rat forebrain areas after transient hypoxia-ischemia. Ann N Y Acad Sci. 1994; 738: 329–333.[Medline] [Order article via Infotrieve]

16. Das DK. Ischaemic preconditioning and myocardial adaptation to ischaemia. Cardiovasc Res. 1993; 27: 2077–2079.[Free Full Text]

17. Forgione MA, Cap A, Liao R, Moldovan NI, Eberhardt RT, Lim CC, Jones J, Goldschmidt-Clermont PJ, Loscalzo J. Heterozygous cellular glutathione peroxidase deficiency in the mouse: abnormalities in vascular and cardiac function and structure. Circulation. 2002; 106: 1154–1158.[Abstract/Free Full Text]

18. Forgione MA, Weiss N, Heydrick S, Cap A, Klings ES, Bierl C, Eberhardt RT, Farber HW, Loscalzo J. Cellular glutathione peroxidase deficiency and endothelial dysfunction. Am J Physiol Heart Circ Physiol. 2002; 282: H1255–H1261.[Abstract/Free Full Text]

19. Weisbrot-Lefkowitz M, Reuhl K, Perry B, Chan PH, Inouye M, Mirochnitchenko O. Overexpression of human glutathione peroxidase protects transgenic mice against focal cerebral ischemia/reperfusion damage. Brain Res Mol Brain Res. 1998; 53: 333–338.[Medline] [Order article via Infotrieve]

20. Yoshida T, Watanabe M, Engelman DT, Engelman RM, Schley JA, Maulik N, Ho YS, Oberley TD, Das DK. Transgenic mice overexpressing glutathione peroxidase are resistant to myocardial ischemia reperfusion injury. J Mol Cell Cardiol. 1996; 28: 1759–1767.[CrossRef][Medline] [Order article via Infotrieve]

21. Mullane K, Bullough D. Harnessing an endogenous cardioprotective mechanism: cellular sources and sites of action of adenosine. J Mol Cell Cardiol. 1995; 27: 1041–1054.[CrossRef][Medline] [Order article via Infotrieve]

22. Sommerschild HT, Kirkeboen KA. Adenosine and cardioprotection during ischaemia and reperfusion: an overview. Acta Anaesthesiol Scand. 2000; 44: 1038–1055.[CrossRef][Medline] [Order article via Infotrieve]

23. Fryer RM, Auchampach JA, Gross GJ. Therapeutic receptor targets of ischemic preconditioning. Cardiovasc Res. 2002; 55: 520–525.[Abstract/Free Full Text]

24. Jornot L, Junod AF. Hyperoxia, unlike phorbol ester, induces glutathione peroxidase through a protein kinase C–independent mechanism. Biochem J. 1997; 326: 117–123.[Medline] [Order article via Infotrieve]

25. Baker RD, Baker SS, LaRosa K, Whitney C, Newburger PE. Selenium regulation of glutathione peroxidase in human hepatoma cell line Hep3B. Arch Biochem Biophys. 1993; 304: 53–57.[CrossRef][Medline] [Order article via Infotrieve]

26. Islam KN, Kayanoki Y, Kaneto H, Suzuki K, Asahi M, Fujii J, Taniguchi N. TGF-beta1 triggers oxidative modifications and enhances apoptosis in HIT cells through accumulation of reactive oxygen species by suppression of catalase and glutathione peroxidase. Free Radic Biol Med. 1997; 22: 1007–1017.[CrossRef][Medline] [Order article via Infotrieve]

27. Zavacki AM, Mansell JB, Chung M, Klimovitsky B, Harney JW, Berry MJ. Coupled tRNA(Sec)-dependent assembly of the selenocysteine decoding apparatus. Mol Cell. 2003; 11: 773–781.[CrossRef][Medline] [Order article via Infotrieve]

28. Moriarty PM, Reddy CC, Maquat LE. Selenium deficiency reduces the abundance of mRNA for Se-dependent glutathione peroxidase 1 by a UGA-dependent mechanism likely to be nonsense codon-mediated decay of cytoplasmic mRNA. Mol Cell Biol. 1998; 18: 2932–2939.[Abstract/Free Full Text]

29. Bermano G, Nicol F, Dyer JA, Sunde RA, Beckett GJ, Arthur JR, Hesketh JE. Selenoprotein gene expression during selenium-repletion of selenium-deficient rats. Biol Trace Elem Res. 1996; 51: 211–223.[Medline] [Order article via Infotrieve]

30. Hers I, Tavare JM, Denton RM. The protein kinase C inhibitors bisindolylmaleimide I (GF 109203x) and IX (Ro 31–8220) are potent inhibitors of glycogen synthase kinase-3 activity. FEBS Lett. 1999; 460: 433–436.[CrossRef][Medline] [Order article via Infotrieve]

31. Chen CY, Shyu AB. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem Sci. 1995; 20: 465–470.[CrossRef][Medline] [Order article via Infotrieve]

32. Thiele BJ, Doller A, Kahne T, Pregla R, Hetzer R, Regitz-Zagrosek V. RNA-binding proteins heterogeneous nuclear ribonucleoprotein A1, E1, and K are involved in post-transcriptional control of collagen I and III synthesis. Circ Res. 2004; 95: 1058–1066.[Abstract/Free Full Text]

33. Singh K, Laughlin J, Kosinski PA, Covey LR. Nucleolin is a second component of the CD154 mRNA stability complex that regulates mRNA turnover in activated T cells. J Immunol. 2004; 173: 976–985.[Abstract/Free Full Text]

34. Wu R, Shen Q, Newburger PE. Recognition and binding of the human selenocysteine insertion sequence by nucleolin. J Cell Biochem. 2000; 77: 507–516.[CrossRef][Medline] [Order article via Infotrieve]

35. Zhou G, Seibenhener ML, Wooten MW. Nucleolin is a protein kinase C-zeta substrate. Connection between cell surface signaling and nucleus in PC12 cells. J Biol Chem. 1997; 272: 31130–31137.[Abstract/Free Full Text]

36. Asahi M, Fujii J, Suzuki K, Seo HG, Kuzuya T, Hori M, Tada M, Fujii S, Taniguchi N. Inactivation of glutathione peroxidase by nitric oxide. Implication for cytotoxicity. J Biol Chem. 1995; 270: 21035–21039.[Abstract/Free Full Text]

37. Asahi M, Fujii J, Takao T, Kuzuya T, Hori M, Shimonishi Y, Taniguchi N. The oxidation of selenocysteine is involved in the inactivation of glutathione peroxidase by nitric oxide donor. J Biol Chem. 1997; 272: 19152–19157.[Abstract/Free Full Text]

38. Elliott SJ, Doan TN, Henschke PN. Reductant substrate for glutathione peroxidase modulates oxidant inhibition of Ca2+ signaling in endothelial cells. Am J Physiol. 1995; 268: H278–H287.[Medline] [Order article via Infotrieve]

39. Gouaze V, Mirault ME, Carpentier S, Salvayre R, Levade T, Andrieu-Abadie N. Glutathione peroxidase-1 overexpression prevents ceramide production and partially inhibits apoptosis in doxorubicin-treated human breast carcinoma cells. Mol Pharmacol. 2001; 60: 488–496.[Abstract/Free Full Text]

40. Merad-Saidoune M, Boitier E, Nicole A, Marsac C, Martinou JC, Sola B, Sinet PM, Ceballos-Picot I. Overproduction of Cu/Zn-superoxide dismutase or Bcl-2 prevents the brain mitochondrial respiratory dysfunction induced by glutathione depletion. Exp Neurol. 1999; 158: 428–436.[CrossRef][Medline] [Order article via Infotrieve]

41. Rosenblat M, Aviram M. Macrophage glutathione content and glutathione peroxidase activity are inversely related to cell-mediated oxidation of LDL: in vitro and in vivo studies. Free Radic Biol Med. 1998; 24: 305–317.[CrossRef][Medline] [Order article via Infotrieve]

42. Dringen R, Hamprecht B. Involvement of glutathione peroxidase and catalase in the disposal of exogenous hydrogen peroxide by cultured astroglial cells. Brain Res. 1997; 759: 67–75.[CrossRef][Medline] [Order article via Infotrieve]

43. Fu Y, Sies H, Lei XG. Opposite roles of selenium-dependent glutathione peroxidase-1 in superoxide generator diquat- and peroxynitrite-induced apoptosis and signaling. J Biol Chem. 2001; 276: 43004–43009.[Abstract/Free Full Text]

44. Tsukamoto M, Tampo Y, Sawada M, Yonaha M. Paraquat-induced oxidative stress and dysfunction of the glutathione redox cycle in pulmonary microvascular endothelial cells. Toxicol Appl Pharmacol. 2002; 178: 82–92.[CrossRef][Medline] [Order article via Infotrieve]

45. Shingu M, Yoshioka K, Nobunaga M, Yoshida K. Human vascular smooth muscle cells and endothelial cells lack catalase activity and are susceptible to hydrogen peroxide. Inflammation. 1985; 9: 309–320.[CrossRef][Medline] [Order article via Infotrieve]

46. Lin SJ, Shyue SK, Liu PL, Chen YH, Ku HH, Chen JW, Tam KB, Chen YL. Adenovirus-mediated overexpression of catalase attenuates oxLDL-induced apoptosis in human aortic endothelial cells via AP-1 and C-Jun N-terminal kinase/extracellular signal-regulated kinase mitogen-activated protein kinase pathways. J Mol Cell Cardiol. 2004; 36: 129–139.[CrossRef][Medline] [Order article via Infotrieve]

47. Mirault ME, Tremblay A, Beaudoin N, Tremblay M. Overexpression of seleno-glutathione peroxidase by gene transfer enhances the resistance of T47D human breast cells to clastogenic oxidants. J Biol Chem. 1991; 266: 20752–20760.[Abstract/Free Full Text]

48. Weiss N, Zhang YY, Heydrick S, Bierl C, Loscalzo J. Overexpression of cellular glutathione peroxidase rescues homocyst(e)ine-induced endothelial dysfunction. Proc Natl Acad Sci U S A. 2001; 98: 12503–12508.[Abstract/Free Full Text]

49. Crack PJ, Taylor JM, Flentjar NJ, de Haan J, Hertzog P, Iannello RC, Kola I. Increased infarct size and exacerbated apoptosis in the glutathione peroxidase-1 (Gpx-1) knockout mouse brain in response to ischemia/reperfusion injury. J Neurochem. 2001; 78: 1389–1399.[CrossRef][Medline] [Order article via Infotrieve]

50. Tabrizchi R, Bedi S. Pharmacology of adenosine receptors in the vasculature. Pharmacol Ther. 2001; 91: 133–147.[CrossRef][Medline] [Order article via Infotrieve]

51. Maggirwar SB, Dhanraj DN, Somani SM, Ramkumar V. Adenosine acts as an endogenous activator of the cellular antioxidant defense system. Biochem Biophys Res Commun. 1994; 201: 508–515.[CrossRef][Medline] [Order article via Infotrieve]

52. Baxter GF, Zaman MJ, Kerac M, Yellon DM. Protection against global ischemia in the rabbit isolated heart 24 hours after transient adenosine A1 receptor activation. Cardiovasc Drugs Ther. 1997; 11: 83–85.[CrossRef][Medline] [Order article via Infotrieve]

53. Takano H, Bolli R, Black RG Jr, Kodani E, Tang XL, Yang Z, Bhattacharya S, Auchampach JA. A(1) or A(3) adenosine receptors induce late preconditioning against infarction in conscious rabbits by different mechanisms. Circ Res. 2001; 88: 520–528.[Abstract/Free Full Text]

54. Ping P, Zhang J, Cao X, Li RC, Kong D, Tang XL, Qiu Y, Manchikalapudi S, Auchampach JA, Black RG, Bolli R. PKC-dependent activation of p44/p42 MAPKs during myocardial ischemia-reperfusion in conscious rabbits. Am J Physiol. 1999; 276: H1468–H1481.[Medline] [Order article via Infotrieve]

55. Vondriska TM, Zhang J, Song C, Tang XL, Cao X, Baines CP, Pass JM, Wang S, Bolli R, Ping P. Protein kinase C epsilon-Src modules direct signal transduction in nitric oxide-induced cardioprotection: complex formation as a means for cardioprotective signaling. Circ Res. 2001; 88: 1306–1313.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. E. Handy, E. Lubos, Y. Yang, J. D. Galbraith, N. Kelly, Y.-Y. Zhang, J. A. Leopold, and J. Loscalzo
Glutathione Peroxidase-1 Regulates Mitochondrial Function to Modulate Redox-dependent Cellular Responses
J. Biol. Chem., May 1, 2009; 284(18): 11913 - 11921.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Y.K. Lee, H.-F. Tse, C.-W. Siu, S.-G. Zhu, R. Y.K. Man, and P. M. Vanhoutte
Genomic Changes in Regenerated Porcine Coronary Arterial Endothelial Cells
Arterioscler Thromb Vasc Biol, November 1, 2007; 27(11): 2443 - 2449.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
G. Ravn-Haren, A. Olsen, A. Tjonneland, L. O. Dragsted, B. A. Nexo, H. Wallin, K. Overvad, O. Raaschou-Nielsen, and U. Vogel
Associations between GPX1 Pro198Leu polymorphism, erythrocyte GPX activity, alcohol consumption and breast cancer risk in a prospective cohort study
Carcinogenesis, April 1, 2006; 27(4): 820 - 825.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
96/8/831    most recent
01.RES.0000164401.21929.CFv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Y.
Right arrow Articles by Loscalzo, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Y.
Right arrow Articles by Loscalzo, J.
Related Collections
Right arrow Physiological and pathological control of gene expression
Right arrow Oxidant stress
Right arrow Other Vascular biology