Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2005;96:1274-1281
Published online before print June 2, 2005, doi: 10.1161/01.RES.0000172556.05576.4c
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
96/12/1274    most recent
01.RES.0000172556.05576.4cv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, X.
Right arrow Articles by Chen, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, X.
Right arrow Articles by Chen, J.
Related Collections
Right arrow Arrythmias-basic studies
Right arrow Calcium cycling/excitation-contraction coupling
(Circulation Research. 2005;96:1274.)
© 2005 American Heart Association, Inc.


Cellular Biology

Endothelin-1–Induced Arrhythmogenic Ca2+ Signaling Is Abolished in Atrial Myocytes of Inositol-1,4,5-Trisphosphate(IP3)–Receptor Type 2–Deficient Mice

Xiaodong Li, Aleksey V. Zima, Farah Sheikh, Lothar A. Blatter, Ju Chen

From the Department of Medicine (H.L., F.S., J.C.), University of California San Diego, La Jolla, Calif; and the Department of Physiology (A.V.Z., L.A.B.), Loyola University of Chicago, Stritch School of Medicine, Maywood, Ill.

Correspondence to Ju Chen, Department of Medicine, University of California San Diego, 9500 Gilman Dr, La Jolla, CA 92093-0641. E-mail juchen{at}ucsd.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults and Discussion
down arrowReferences
 
Recent studies have suggested that inositol-1,4,5-trisphosphate-receptor (IP3R)–mediated Ca2+ release plays an important role in the modulation of excitation–contraction coupling (ECC) in atrial tissue and the generation of arrhythmias, specifically chronic atrial fibrillation (AF). IP3R type-2 (IP3R2) is the predominant IP3R isoform expressed in atrial myocytes. To determine the role of IP3R2 in atrial arrhythmogenesis and ECC, we generated IP3R2-deficient mice. Our results revealed that endothelin-1 (ET-1) stimulation of wild-type (WT) atrial myocytes caused an increase in basal [Ca2+]i, an enhancement of action potential (AP)-induced [Ca2+]i transients, an improvement of the efficacy of ECC (increased fractional SR Ca2+ release), and the occurrence of spontaneous arrhythmogenic Ca2+ release events as the result of activation of IP3R-dependent Ca2+ release. In contrast, ET-1 did not alter diastolic [Ca2+]i or cause spontaneous Ca2+ release events in IP3R2-deficient atrial myocytes. Under basal conditions the spatio-temporal properties (amplitude, rise-time, decay kinetics, and spatial spread) of [Ca2+]i transients and fractional SR Ca2+ release were not different in WT and IP3R2-deficient atrial myocytes. WT and IP3R2-deficient atrial myocytes also showed a significant and very similar increase in the amplitude of AP-dependent [Ca2+]i transients and Ca2+ spark frequency in response to isoproterenol stimulation, suggesting that both cell types maintained a strong inotropic reserve. No compensatory changes in Ca2+ regulatory protein expression (IP3R1, IP3R3, RyR2, NCX, SERCA2) or morphology of the atria could be detected between WT and IP3R2-deficient mice. These results show that lack of IP3R2 abolishes the positive inotropic effect of neurohumoral stimulation with ET-1 and protects from its arrhythmogenic effects.


Key Words: IP3 receptor • intracellular calcium • atrial arrhythmias • excitation-contraction coupling • endothelin


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults and Discussion
down arrowReferences
 
Chronic atrial fibrillation (AF) is the most common sustained form of cardiac arrhythmia. AF is characterized by an atrial activation rate of typically >400 beats per minute, and is associated with 2 major complications including cardiac dysfunction and thrombus formation, resulting in an increased risk of morbidity because of heart failure and stroke.1,2 In recent years, considerable attention has focused on the cellular and molecular mechanisms involved in AF (for review see Nattel3,4). Whereas a multitude of mechanisms, including ischemic, metabolic, inflammatory, and structural factors, contribute to the etiology of AF,5,6 several studies have suggested that abnormal intracellular calcium homeostasis and perturbations in Ca2+ handling may be an important modulator of atrial arrhythmias,4 including an elevated sarcoplasmic reticulum (SR) Ca2+ load leading to arrhythmogenic intracellular Ca2+ release.7,8

Two types of Ca2+ release channels serve to regulate intracellular Ca2+ concentration ([Ca2+]i): the ryanodine receptor (RyR) and the IP3R. The RyR2 is considered the major Ca2+ release channel required for excitation–contraction coupling (ECC) in the heart.9–11 During ECC, action potential (AP)-induced membrane depolarization leads to the opening of voltage-gated Ca2+ channels and Ca2+ entry. Entering Ca2+ activates the RyR which leads to massive Ca2+ release from the SR by a mechanism known as Ca2+-induced Ca2+ release (CICR12), which is required for inducing contraction.

Cardiac myocytes also contain IP3R channels, however their functional importance in the heart has remained controversial. IP3Rs release Ca2+ from intracellular Ca2+ stores when activated by IP3, a product generated by phospholipase C (PLC) metabolism of phosphoinositol-4,5-bisphosphate (PIP2) in response to G-protein–coupled receptor or receptor tyrosine kinase stimulation.13 In mammalian cells, there are 3 IP3R subtypes referred to as type-1, -2, and -3, each transcribed by 3 distinct genes.14 Each IP3R subtype has a different affinity for IP3 and a differential tissue expression pattern.15,16 IP3R2 is the predominant IP3R expressed in ventricular17 as well as in atrial myocytes,18 but its physiological role still remains unclear and controversial.11,19,20

Recent reports have emphasized the importance of IP3 signaling and IP3-dependent Ca2+ release for ECC in the atria. Atrial myocytes express IP3R2s at 6 to 10x higher levels than ventricular myocytes, and InsP3Rs colocalize with RyRs in the subsarcolemmal space.18,21 Furthermore, it was demonstrated that InsP3-dependent Ca2+ release in atrial myocytes may serve to enhance Ca2+ spark frequency (Ca2+ sparks are referred to as the classical elementary Ca2+ release event from clusters of RyRs22,23) and twitch [Ca2+]i transient amplitude,18,20,24 and thus may have a positive inotropic function. IP3-dependent Ca2+ signaling has been implied in cardiac arrhythmias attributable to ischemia and reperfusion injury, inflammatory processes, and developing cardiac failure.21,25 IP3 receptors are upregulated in heart failure26 and AF.27 In atrial myocytes IP3 caused spontaneous [Ca2+]i transients, Ca2+ waves, and Ca2+ alternans,20,21 and facilitated the generation of early (EADs) and delayed (DADs) after-depolarizations,21 all disturbances in Ca2+ signaling related to cardiac arrhythmias (see Kockscamper et al7). Notably these effects were absent in ventricular myocytes.20

To study the role of IP3-dependent Ca2+ release in heart at the cellular level has been difficult for several reasons, one of which is that the small IP3-dependent Ca2+ signals are difficult to discern from the large [Ca2+]i transients brought on by Ca2+ entry and Ca2+ release from RyRs during normal ECC.20 Furthermore, many of the pharmacological activators and inhibitors of the IP3R cannot be applied to intact cells or lack sufficient specificity to dissect and isolate contributions from IP3Rs.28 Therefore, we set out to generate IP3R2-deficient mice to determine the role of IP3R2 in the atrium and its potential role in AF.

Our results revealed that in response to endothelin-1 (ET-1), IP3R2-deficient atrial myocytes failed to increase diastolic [Ca2+]i and to have a positive inotropic response. ET-1 also failed to cause spontaneous Ca2+ release events in IP3R2-deficient atrial myocytes. On the other hand, both wild-type (WT) and IP3R2-deficient atrial myocytes showed a very similar strong positive inotropic response and enhanced Ca2+ spark activity after ß-adrenergic stimulation. No compensatory changes in the expression of Ca2+ regulatory proteins (IP3R1, IP3R3, RyR2, NCX, SERCA2) or morphology of the atria could be detected between WT and IP3R2-deficient mice. These results show that IP3R2 can be a major modulator of intracellular Ca2+ homeostasis in atrial myocytes and may play an important role for the initiation and perpetuation of AF.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults and Discussion
down arrowReferences
 
Gene Targeting and Generation of IP3R2-Deficient Mice
The IP3R2 genomic DNA was isolated from a 129SVJ mouse genomic library (Stratagene) and used to construct the IP3R2 targeting vector by standard techniques.29 Briefly, 2 fragments of the IP3R2 gene were cloned into a targeting vector that contained a neomycin selection cassette flanked by FRT sites. A 539-bp fragment containing exon 3 of IP3R2 (116 bp) was inserted into 2 flanking LoxP sites (Figure 1A). The targeting vector was linearized with NotI and subsequently electroporated into R1 embryonic stem (ES) cells. G418-resistant ES clones (480 clones) were screened for homologous recombination by DNA blot analysis, as described below. Two independent homologous recombinant ES clones were microinjected into blastocysts from C57BL/6J mice to generate male chimeras. Male chimeras were bred with female Black Swiss mice to generate germline transmitted floxed heterozygous mice (IP3R2+/flox). IP3R2+/flox mice were subsequently intercrossed and crossed with Pro-Cre mice,30 which restricted Cre expression to male germ cells undergoing spermatogenesis, to generate mice which were doubly heterozygous for IP3R2 floxed allele and Pro-Cre allele (Pro-Cre, IP3R2+/flox). Pro-Cre, IP3R2+/flox males were crossed to female breeders to generate germline heterozygous null mutant offsprings (IP3R2+/–). Intercrosses of the IP3R2+/– were used to generate homozygous null mutant mice (IP3R2–/–).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Targeted generation of IP3R2-deficient mice. A, Targeting strategy, restriction map of the relevant genomic gene of IP3R2 is shown in the top panel, the targeting construct is shown in the center, and the mutated locus after recombination is shown at the bottom. The targeting construct was generated by flanking exon 3 of IP3R2 with 2 loxP sites and flanking the neo-cassette by frt sites. B indicates BamHI; K, KpnI; N, NotI, Neo represents neomycin resistance gene; arrowheads represent LoxP sites; and the long boxes represent frt sites. B, Detection of WT and targeted alleles by Southern blot analysis, DNAs isolated from 3 neo positive electroporated ES cells (lane 1 to lane 3) were digested with Acc65I and analyzed by DNA blot analysis with the probe as shown in A. The 14- and 7-kb bands represent WT and mutant allele, respectively. C, Protein analysis of IP3R2 in WT and IP3R2-deficient mice. Protein extracts from atria, ventricle, and lungs from mice were subjected to protein analysis, using IP3R2 specific antibodies. Antibodies specific for sarcomeric {alpha}-actinin were used to normalize for protein loading.

DNA Analyses
Genomic DNA was extracted from G418-resistant ES cell clones and mouse tails, as previously described.31 ES cell DNA was digested using Acc65I, electrophoresed on a 1% (wt/vol) agarose gel, and subsequently blotted onto a nitrocellulose membrane. A 400-bp fragment was generated by polymerase chain reaction (PCR) using mouse genomic DNA and specific IP3R2 primers (forward, TGGAAAGGTCTGGGTGAGTC; reverse, GGCTGCTGAGATGGACAAG). The PCR product was subsequently radiolabeled using {alpha}-[32P]dATP by random priming (Invitrogen). DNA blots were hybridized with the radiolabeled probe and visualized by autoradiography.

Offspring from intercrosses were genotyped by PCR analysis using mouse tail DNA and WT (forward, ACCCTGATGAGGGAAGGTCT; reverse, ATCGATTCATAGGGCACACC) and mutant allele specific primers (neo-specific primer: forward, AATGGGCTGACCGCTTCCTCGT; reverse, TCTGAGAGTGCCTGGCTTTT). PCR products were visualized by ethidium bromide staining.

Protein Blot Analysis
Total protein extracts were prepared from cardiac atria, ventricle, and lung from WT as well as IP3R2-deficient (4-week-old) mice and protein analysis was performed, as previously described.29 Immunodetection of IP3R2 (270 kDa) was performed in cardiac atria, ventricular, and lung samples by using a rabbit polyclonal antibody to IP3R2 (1:2000), as previously described.32 Immunodetection of {alpha}-actinin (100 kDa) was performed on samples by using a mouse monoclonal antibody to sarcomeric {alpha}-actinin (1:2000; Sigma). Immunodetection of IP3R1 (274 kDa), IP3R3 (267 kDa), ryanodine receptor type 2 (RyR2; 565 kDa), sodium-calcium exchanger (NCX;160 and 120 kDa), and sarcoplasmic reticulum Ca2+ ATPase (SERCA2a; 110 kDa) was performed on atrial samples by using rabbit polyclonal antibodies to IP3R1 (1:2000), IP3R3 (1:2000), and SERCA2a (1:10 000) or mouse monoclonal antibodies to RyR2 (1:3000; Affinity BioReagents) and NCX (1:500; Swant), as previously described.33 Membranes were subsequently incubated with horseradish peroxidase–conjugated anti-rabbit Ig (1:3000; Sigma) or anti-mouse Ig (1:3000; Zymed). All results were visualized by using enhanced chemiluminescence (Amersham).

Cell Isolation
The procedure for cell isolation was in full compliance with the guidelines approved by the Institutional Animal Care and Use Committee of Loyola University Chicago, Stritch School of Medicine. Mice were anesthetized in a gas chamber with 3% to 5% isoflurane in a 100% O2 atmosphere. Hearts were excised from adult IP3R2-deficient and age- and strain-matched WT mice. Hearts were mounted on a Langendorff-perfusion apparatus and perfused for 6 minutes at 37°C with nominally Ca2+-free Dulbecco’s modified Eagle’s medium (DMEM; GIBCO type 22300) gassed with a 95% O2/5% CO2 mixture. Perfusion was then switched to the same solution containing 0.5 to 0.8 mg/mL collagenase (type B, Boehringer Mannheim) and 20 µmol/L Ca2+ with perfusion continuing until the heart became flaccid (7 to 12 minutes). Atria were removed, enzyme activity was stopped by switching the solution to DMEM containing 0.5% to 1% BSA, and the atria were cut into smaller pieces and gently triturated with a glass pipette to separate individual cells. Isolated myocytes were plated on glass cover slips which formed the bottom of the experimental superfusion chamber, mounted on an inverted microscope for [Ca2+]i measurements. All experiments were performed at room temperature (22 to 24°C).

[Ca2+]i Measurements
[Ca2+]i was measured with fluorescence laser scanning confocal microscopy. Intact atrial myocytes were loaded with the Ca2+ indicator fluo-4x20 minutes incubation in Tyrode solution containing 20 µmol/L fluo-4 acetoxymethyl ester (fluo-4/AM; Molecular Probes) at room temperature. Cells were superfused continuously with normal Tyrode solution (in mM: NaCl 140; KCl 4; CaCl2 1; MgCl2 1; glucose 10; HEPES 10; pH 7.4). Fifteen to 20 minutes was allowed for deesterification of the dye. The laser scanning confocal microscope was a Radiance 2000 MP (BioRad) attached to a Nikon TE300 inverted microscope and equipped with a 40x oil-immersion objective lens (Nikon CFI Plan Fluor; N.A.=1.3). Fluo-4 was excited with the 488 nm line of an argon ion laser and fluorescence was measured at wavelengths >515 nm. Images were acquired in the transverse linescan mode (3 or 6 ms/scan; pixel size 0.1 µm). [Ca2+]i transients are presented as background-subtracted normalized fluorescence (F/F0) where F is the fluorescence intensity and F0 is resting fluorescence recorded under steady-state conditions at the beginning of an experiment. [Ca2+]i transients were evoked by electrical field stimulation (0.5 Hz). Ca2+ spark frequencies are expressed as number of observed sparks per second and per 100 µm of scanned distance in the confocal linescan mode (sparks* s–1*(100 µm)–1)

Drugs
Endothelin-1, 2-aminoethoxydiphenyl borate (2-APB) and isoproterenol were obtained from Sigma.

Statistics
Data are presented as means±SEM obtained from n different cells. Statistical differences between data sets were evaluated by Student t test.


*    Results and Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results and Discussion
down arrowReferences
 
Targeted Disruption of the Mouse IP3R2 Gene
The IP3R2 gene replacement targeting construct is depicted in Figure 1A (middle). The targeting construct was designed to flank exon 3 of the IP3R2 gene by loxP sites (triangles) as well as to contain the neomycin (Neo) selection cassette flanked by FRT sites (black rectangles; Figure 1A, middle). Targeted ES cells were identified by Southern blot hybridization analysis, giving the expected 7-kb mutant fragment compared with the WT 14-kb fragment (Figure 1B). Two of 480 neo resistant ES cells were identified as targeted ES cells. These 2 ES cell clones were independently injected into blastocysts which gave rise to chimeric mice that were then used to breed to generate germline-transmitting heterozygous floxed mice (IP3R2+/flox). The IP3R2+/flox mice were crossed with protamine-cre (Pro-Cre) mice,30 generating mice which were doubly heterozygous (Pro-Cre, IP3R2+/flox). Cre expression in Pro-Cre mice is restricted to male germ cells undergoing spermatogenesis. Therefore, Pro-Cre, IP3R2+/flox males were crossed with female breeders to generate germline heterozygous null mutant offsprings (IP3R2+/–). Intercrosses of the IP3R2+/– mice were used to generate homozygous null mutant mice (IP3R2–/–).

To ensure that the mutant allele is a true null allele, protein blot analysis was performed using protein samples from cardiac atria, ventricle, and lung extracts from WT and IP3R2-deficient hearts, using specific IP3R2 antibodies. As shown in Figure 1C, no IP3R2 protein could be detected in the IP3R2-deficient tissues. Furthermore, the data revealed that IP3R2s appear to be more abundant in atrial tissue when compared with ventricle.

Homozygous IP3R2-deficient mice were viable and fertile. Assessment of Mendelian ratios from IP3R2 intercrosses revealed that of the 327 offspring analyzed, 82 (25.1%) were homozygous for the disrupted allele and 91 (27.8%) were WT, indicating that IP3R2 is not essential for normal embryonic development and survival. This is in contrast to IP3R1-deficient mice, as the majority of IP3R1 homozygous mutants are embryonic lethal and those surviving have severe ataxia and tonic/tonic-clonic seizures and die by the weaning period.34 These data suggest that IP3R subtypes have distinct functional roles already during development.

Action Potential Induced [Ca2+]i Transients in Intact WT and IP3R2-Deficient Atrial Myocytes
To study the functional consequences of IP3R2 deficiency in cardiac ECC and Ca2+ signaling, we focused on atrial myocytes, because previous studies have demonstrated IP3R-dependent Ca2+ release in this tissue,20,21,24 but not in ventricular cells.20 Single atrial myocytes were isolated from IP3R2-deficient (IP3R2-KO) and WT littermate mice and loaded with the Ca2+-sensitive indicator fluo-4/AM to record changes in [Ca2+]i by confocal microscopy. AP-dependent [Ca2+]i transient were evoked by field stimulation (0.5 Hz; Figure 2A and 2C, left). As summarized in supplemental Table I (available online at http://circres.ahajournals.org) the spatiotemporal properties of [Ca2+]i transients (amplitude, rise time, decay kinetics, and spatial spread from the periphery to the center of the cells) did not differ significantly between WT and IP3R2-KO atrial myocytes. The data suggest that under basal conditions the absence of the IP3R2 had little or no effect on ECC.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Effects of ET-1 on Ca2+ signaling in intact WT and IP3R2-deficient atrial myocytes. Confocal linescan (raw fluo-4 fluorescence) images and spatially averaged [Ca2+]i (F/F0) transients recorded from field-stimulated (0.5 Hz) WT (A and B) and IP3R2-deficient (KO) (C) atrial myocytes. The traces were spatially averaged over the region marked by the red boxes to the left of the images. A, [Ca2+]i transients under control conditions (left) and during exposure to 100 nM ET-1 (right) in WT cells. Arrowheads and asterisks indicate spontaneous (nontriggered) Ca2+ release attributable to after-depolarizations and Ca2+ sparks, respectively. B, [Ca2+]i transients under control conditions (left) and during exposure to 100 nM ET-1 (right) in WT cells in the presence of the IP3R blocker 2-APB (5 µmol/L). C, [Ca2+]i transients under control conditions (left) and during exposure to 100 nM ET-1 in IP3R2-KO atrial myocytes. Average changes in diastolic [Ca2+]i (D) and electrically evoked [Ca2+]i transient amplitude (E) in the presence of ET-1, normalized to control conditions (100%, dashed line). Statistical significance levels: *P<0.05; +P<0.01; #P<0.001.

Endothelin-1 Effects on Ca2+ Signaling in Intact IP3R2-KO and WT Atrial Myocytes
ET-1 has been shown to increase endogenous [IP3] in atrial cells35 and to cause IP3-dependent Ca2+ release.20,21 Consequently, we used ET-1 to assess the effects of IP3R2 deficiency on Ca2+ signaling in atrial myocytes. In electrically stimulated WT cells (Figure 2A), exposure to ET-1 (100 nM) resulted in a significant increase in diastolic [Ca2+]i (146±5% compared with control; n=17 cells; P<0.001; Figure 2D) and AP-dependent [Ca2+]i transient amplitude (135±6% compared with control; n=17; P<0.001; Figure 2E). Furthermore, signs of spontaneous Ca2+ release activity were observed in WT atrial myocytes in the presence of ET-1. Specifically, WT atrial myocytes revealed spontaneous Ca2+ sparks (asterisks in Figure 2A, right; see also Figures 3 and 4Down) and Ca2+ release events triggered by spontaneous APs or delayed after depolarizations (DAD) (Figure 2A; arrowheads). The effects of ET-1 on diastolic [Ca2+]i and [Ca2+]i transient amplitude could be abolished by preincubation with the membrane permeant IP3R antagonist 2-APB (Figure 2B, 2D, and 2E) that has been used successfully to inhibit IP3R-dependent Ca2+ release in cardiac cells.20,21,36



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. SR functon in WT and IP3R2-deficient atrial myocytes. A, Fluo-4 linescan images and F/F0 traces of electrically evoked [Ca2+]i transients, followed by caffeine (10 mmol/L) application to estimate SR Ca2+ load. B, Average fractional SR Ca2+ release in WT and IP3R2-KO atrial myocytes. [ET-1]=100 nM, [2-APB]=5 µmol/L. C, Fluo-4 linescan images and F/F0 traces of electrically evoked [Ca2+]i transients recorded under control conditions and in the presence of isoproterenol (ISO; 1 µmol/L) in WT (top) and IP3R2-deficient (KO; bottom) atrial myocytes. D, Average normalized increase in [Ca2+]i transient amplitude by ISO in WT and IP3R2-deficient (KO) atrial myocytes (100%=control). Whole-cell [Ca2+]i transients were obtained by averaging the entire cellular fluorescence signal from the line scanned.



View larger version (98K):
[in this window]
[in a new window]
 
Figure 4. Ca2+ sparks in WT (A and B) and IP3R2-deficient (C through E) atrial myocytes. Fluo-4 linescan images and selected plots of subcellular [Ca2+]i transients recorded from the areas marked by the red boxes. The images shown represent periods between 2 subsequent evoked [Ca2+]i transient. A, Basal spark activity under control conditions and in the presence of ET-1 (100 nM) in WT atrial myoctes. B, Effect of ET-1 in the presence of the IP3R blocker 2-APB (5 µmol/L) in WT cells. Ca2+ sparks in IP3R2-KO atrial myocyes in the presence of (C) ET-1, (D) isoproterenol (ISO, 1 µmol/L), and (E) after a period of high frequency (2 Hz) stimulation.

ET-1 exposure failed to significantly increase diastolic [Ca2+]i in atrial myocytes from IP3R2-deficient mice (Figure 2C and 2D), and no signs of spontaneous Ca2+ release were observed. In fact, ET-1 stimulation caused a decrease in [Ca2+]i transient amplitude in IP3R2-deficient atrial myocytes (Figure 2E). The [Ca2+]i transient amplitude recovered after removal of ET-1 (data not shown). The same decrease in [Ca2+]i transient amplitude was observed in WT myocytes pretreated with 2-APB. The latter suggests that basal IP3 levels may have a small positive inotropic effect under control conditions. This is consistent with the slightly smaller [Ca2+]i transient amplitude of IP3R2-KO myocytes (supplemental Table I) even though this difference was not statistically significant.

SR Function in WT and IP3R2-KO Atrial Myocytes
To assess whether the failure of IP3R2-deficient atrial myocytes to respond to ET-1 was caused by differences in the efficacy of ECC, we measured SR Ca2+ load and fractional SR Ca2+ release. For this purpose SR Ca2+ load was measured by exposure of WT and IP3R-KO cells to 10 mmol/L caffeine (Figure 3A). The amplitude of the caffeine-induced [Ca2+]i transient was not significantly different between WT and IP3R-KO mice (supplemental Table I). Fractional release, defined as the fraction (%) of Ca2+ release during an AP-induced twitch compared with total releasable Ca2+, is approximated by comparing the amplitudes of AP-induced [Ca2+]i transients with caffeine-induced [Ca2+]i transients ([Ca2+]i,twitch/[Ca2+]i,caffeine). The average fractional release under control conditions was 55±4% in WT (n=6) and 56±4% in IP3R2-KO (n=9) myocytes, respectively (Figure 3B). Whereas there was no significant difference in fractional SR Ca2+ release under control conditions, the fractional release increased significantly (68±3%; n=6; P<0.01) in WT cells in the presence of ET-1 (Figure 3B). In contrast, ET-1 had no effect of fractional release in IP3R2-KO myocytes (58±4%; n=5). Furthermore, 2-APB prevented the effect of ET-1 on fractional release in WT cells (59±7%; n=3; Figure 3B). The data revealed that in WT atrial cells, ET-1 exerts its positive inotropic effect through improvement of the efficacy of ECC. Because this effect was absent in IP3R2-KO cells and was abolished by 2-APB in WT cells, we concluded that IP3-dependent Ca2+ signaling plays a crucial role in mediating the ET-1 effect.

We also tested the availability of releasable Ca2+ from the SR through ß-adrenergic stimulation (isoproterenol, 1 µmol/L). Isoproterenol causes a positive inotropic effect by affecting [Ca2+]i regulation and ECC through various mechanisms.19 In electrically stimulated WT and IP3R2-deficient atrial myocytes, isoproterenol increased the amplitude of the [Ca2+]i transient to 300% to 350% of control (Figure 3C and 3D). The relative increase in transient amplitude was not significantly different between WT and IP3R2-deficient atrial myocytes, indicating that both cell types have the same significant inotropic reserve.

Ca2+ Sparks in IP3R2-Deficient and WT Atrial Myoctes
Ca2+ sparks are considered the elementary Ca2+ release events during ECC and represent a localized nonpropagating elevation of [Ca2+]i that results from the concerted opening of a group of clustered RyRs in the SR membrane.22,23 In WT atrial myocytes (Figure 4A), ET-1 increased the Ca2+ spark frequency {approx}4-fold (from 0.49±0.20 in control [n=12] to 2.14±0.64 sparks*s–1*[100 µm]–1 in the presence of ET-1 [n=10]; P<0.01; Figure 5). This effect was abolished in the presence of the IP3R blocker 2-APB (n=5; Figures 4B and 5Down). 2-APB alone had very little effect on Ca2+ sparks (n=5). In IP3R2-deficient atrial myocytes, the overall Ca2+ spark frequency was >5-fold lower (0.09±0.06 sparks*s–1*[100 µm]–1; n=5) compared with WT cells, and ET-1 had no significant effect on Ca2+ spark frequency. However, different interventions had a profound effect on Ca2+ spark frequency also in IP3R2-KO myocytes. ß-adrenergic stimulation with isoproterenol ([ISO]=1 µmol/L) significantly increased the Ca2+ spark frequency to 2.45±0.46 sparks*s–1*(100 µm)–1. In WT myocytes, ISO stimulation caused a virtually identical increase in spark frequency (2.48±1.00 sparks*s–1*[100 µm]–1; Figure 5). Electrical stimulation at higher frequency (2 Hz) was followed by a period of intense spark activity (HF in Figures 4E and 5Down). The data suggest that in conditions that lead to increased SR Ca2+ load (ß-adrenergic and HF stimulation) IP3R2-KO atrial myocytes are capable of higher Ca2+ spark activity, despite the lack of IP3R2. The results further confirm that the effect of ET-1 on Ca2+ sparks in WT cells critically depend on a functional IP3R2-dependent Ca2+ release. In WT atrial myocytes, IP3-dependent Ca2+ release has been shown to facilitate Ca2+ sparks from RyRs through a mechanism by which Ca2+ release from IP3Rs increases [Ca2+]i in the vicinity of RyRs and thereby increases the probability of CICR.18,20 Our observation that IP3R2-deficient atrial myocytes revealed an overall lower spark activity may suggest that in WT cells, basal levels of IP3 cause a small background release of Ca2+ from IP3Rs which enhances the propensity of spontaneous Ca2+ sparks.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 5. Ca2+ spark frequencies. Ca2+ spark frequencies measured in WT (black bars) and IP3R2-KO (gray bars) atrial myocytes. Spark frequency is expressed as the number of sparks per second and per 100 µm of scanned distance (sparks*s–1*[100 µm]–1). Experimental conditions: ET-1, 100 nM; ISO, 1 µmol/L; 2-ABP, 5 µmol/L; HF, high frequency stimulation at 2 Hz. Statistical significance levels: *P<0.05; +P<0.01; #P<0.001.

Expression of Ca2+ Regulatory Proteins in IP3R2-Deficient and WT Atria
To assess whether the failure of IP3R2-deficient atrial myocytes to respond to ET-1 could be attributable to perturbations in the baseline expression of other IP3R subtypes or well-established Ca2+ regulatory proteins in WT and IP3R2-deficient atria, we performed protein blot analysis on cardiac atria extracts to assess for IP3R1, IP3R3, RyR2, NCX, and SERCA2 expression, using specific antibodies. As shown in Figure 6, no compensatory changes in IP3R1 and IP3R3 protein levels could be detected in the IP3R2-deficient atria. In addition, no significant changes in RyR2, NCX, and SERCA2 protein could be detected between WT and IP3R2-deficient atria (Figure 6), suggesting that IP3R2 deficiency does not affect the expression of other Ca2+ regulatory proteins relevant for ECC. Furthermore, no significant changes in atria weight/body weight (BW) ratios were observed between WT (left atria/BW: 0.013±0.001; right atria/BW: 0.011±0.0006; n=5), and IP3R2-deficient (left atria/BW: 0.012±0.0008; right atria/BW: 0.012±0.0009; n=7) atria, suggesting that IP3R2-deficient atria were not grossly morphologically different from WT atria. As a result, the failure of IP3R2-deficient atrial myocytes to respond to ET-1 was not attributable to changes in atrial morphology or expression profile of Ca2+ regulatory proteins in IP3R2-deficient atria.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 6. Protein analysis of IP3R1, IP3R3, RyR2, NCX, and SERCA2 in WT and IP3R2-deficient mice. Atrial extracts from WT and IP3R2-deficient mice were subjected to protein analysis, using IP3R1, IP3R2, IP3R3, RyR2, NCX, and SERCA2 specific antibodies. Antibodies specific for sarcomeric {alpha}-actinin were used to normalize for protein loading (data not shown).

Summary and Conclusions
Neurohormonal agents (ET-1, angiotensin II, catecholamines), which activate the G protein–PLC signaling pathway and IP3 production, have been implicated in the generation of atrial arrhythmias and fibrillation.25,37 Recent studies have suggested that IP3R expression and IP3R-dependent Ca2+ release play an important role in the generation of arrhythmias and atrial fibrillation (see introduction), however many aspects of the underlying mechanisms linking IP3R/Ca2+ signaling and AF have remained elusive. Nonetheless, in cardiac hypertrophy and heart failure, not only IP3Rs are upregulated, but also levels of neurohumoral factors, including ET-1 levels, are elevated and ET-receptor expression is altered.38 IP3R-dependent Ca2+ release has been shown to enhance ECC and to have positive inotropic effects. This positive inotropic effect occurs through IP3R-dependent Ca2+ release in the vicinity of clusters of RyRs, which in turn facilitates CICR from RyRs and consequently enhances contraction. Whereas this, in principal, represents an additional mechanism of inotropic reserve and therefore can be considered beneficial, it also can become detrimental to normal Ca2+ release and ECC: enhanced IP3-signaling and IP3-dependent Ca2+ release also increases the likelihood of spontaneous Ca2+ release (Ca2+ sparks and waves), leads to Ca2+ alternans (a proarrhythmic condition;7), and to spontaneous action potentials and spontaneous [Ca2+]i transients. Thus, through such a mechanism IP3-dependent Ca2+ release can enhance the propensity of atrial arrhythmias18,20,21 which are common in cardiac hypertrophy and heart failure.

Whereas previous studies on the role of IP3R-dependent Ca2+ signaling for atrial arrhythmias relied heavily (and almost exclusively) on pharmacological tools to perturb the IP3 signaling cascade, we present in this study a new animal model exquisitely suitable to study IP3R2-dependent Ca2+ signaling for cardiac function. The IP3R2-deficient mice, which we generated, are viable and develop phenotypically normal. Under basal conditions the Ca2+ signals during ECC in IP3R2-KO atrial cells appear to be indistinguishable from WT cells, and both cell types reveal a similar responsiveness ([Ca2+]i transients and Ca2+ sparks) to ß-adrenergic stimulation. Furthermore, no compensatory changes in Ca2+ regulatory protein expression (IP3R1, IP3R3, RyR2, NCX, SERCA2) or morphology of the atria could be detected in IP3R2-deficient mice. However, the responsiveness to the neurohumoral agonist ET-1 is altered, and atrial cells from IP3R2-deficient mice are significantly less prone to develop proarrhythmic disturbances in Ca2+ signaling. IP3R2-deficient mice represent an important model for future studies of IP3R2 signaling in cardiac ECC and arrhythmias.


*    Acknowledgments
 
This work was supported by the National Institutes of Health (R01HL66100 to J.C. and R01HL62231 to L.A.B.) and the Potts Estate, Loyola University Chicago (RFC 107457 to A.V.Z.). We thank Dr Gregory A. Mignery for providing us the IP3R1, IP3R2, and IP3R3 antibodies and Dr Wolfgang H. Dillmann (University of California, San Diego) for providing us with the SERCA2 antibody. We thank Brian French for excellent assistance with the myocyte isolation, and Drs Donald M. Bers and Gregory A. Mignery (Loyola University of Chicago) for valuable comments on the manuscript.


*    Footnotes
 
Original received March 8, 2005; resubmission received May 11, 2005; accepted May 24, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults and Discussion
*References
 
1. Hart RG, Halperin JL. Atrial fibrillation and stroke: concepts and controversies. Stroke. 2001; 32: 803–808.[Free Full Text]

2. Hart RG, Halperin JL. Atrial fibrillation and thromboembolism: a decade of progress in stroke prevention. Ann Intern Med. 1999; 131: 688–695.[Abstract/Free Full Text]

3. Nattel S. Therapeutic implications of atrial fibrillation mechanisms: can mechanistic insights be used to improve AF management? Cardiovasc Res. 2002; 54: 347–360.[Abstract/Free Full Text]

4. Nattel S. New ideas about atrial fibrillation 50 years on. Nature. 2002; 415: 219–226.[CrossRef][Medline] [Order article via Infotrieve]

5. Van Wagoner DR. Molecular basis of atrial fibrillation: a dream or a reality? J Cardiovasc Electrophysiol. 2003; 14: 667–669.[CrossRef][Medline] [Order article via Infotrieve]

6. Van Wagoner DR, Nerbonne JM. Molecular basis of electrical remodeling in atrial fibrillation. J Mol Cell Cardiol. 2000; 32: 1101–1117.[CrossRef][Medline] [Order article via Infotrieve]

7. Kockskamper J, Blatter LA. Subcellular Ca2+ alternans represents a novel mechanism for the generation of arrhythmogenic Ca2+ waves in cat atrial myocytes. J Physiol. 2002; 545: 65–79.[Abstract/Free Full Text]

8. Stern MD, Capogrossi MC, Lakatta EG. Spontaneous calcium release from the sarcoplasmic reticulum in myocardial cells: mechanisms and consequences. Cell Calcium. 1988; 9: 247–256.[CrossRef][Medline] [Order article via Infotrieve]

9. Bers DM. Cardiac excitation-contraction coupling. Nature. 2002; 415: 198–205.[CrossRef][Medline] [Order article via Infotrieve]

10. Blatter LA, Kockskamper J, Sheehan KA, Zima AV, Huser J, Lipsius SL. Local calcium gradients during excitation-contraction coupling and alternans in atrial myocytes. J Physiol. 2003; 546: 19–31.[Abstract/Free Full Text]

11. Marks AR. Cardiac intracellular calcium release channels: role in heart failure. Circ Res. 2000; 87: 8–11.[Free Full Text]

12. Fabiato A. Calcium-induced release of calcium from the cardiac sarcoplasmic reticulum. Am J Physiol. 1983; 245: C1–14.[Medline] [Order article via Infotrieve]

13. Streb H, Irvine RF, Berridge MJ, Schulz I. Release of Ca2+ from a nonmitochondrial intracellular store in pancreatic acinar cells by inositol-1,4,5-trisphosphate. Nature. 1983; 306: 67–69.[CrossRef][Medline] [Order article via Infotrieve]

14. Sudhof TC, Newton CL, Archer BT, 3rd, Ushkaryov YA, Mignery GA. Structure of a novel InsP3 receptor. Embo J. 1991; 10: 3199–3206.[Medline] [Order article via Infotrieve]

15. Newton CL, Mignery GA, Sudhof TC. Co-expression in vertebrate tissues and cell lines of multiple inositol 1,4,5-trisphosphate (InsP3) receptors with distinct affinities for InsP3. J Biol Chem. 1994; 269: 28613–28619.[Abstract/Free Full Text]

16. Ramos-Franco J, Fill M, Mignery GA. Isoform-specific function of single inositol 1,4,5-trisphosphate receptor channels. Biophys J. 1998; 75: 834–839.[Medline] [Order article via Infotrieve]

17. Perez PJ, Ramos-Franco J, Fill M, Mignery GA. Identification and functional reconstitution of the type 2 inositol 1,4,5-trisphosphate receptor from ventricular cardiac myocytes. J Biol Chem. 1997; 272: 23961–23969.[Abstract/Free Full Text]

18. Lipp P, Laine M, Tovey SC, Burrell KM, Berridge MJ, Li W, Bootman MD. Functional InsP3 receptors that may modulate excitation-contraction coupling in the heart. Curr Biol. 2000; 10: 939–942.[CrossRef][Medline] [Order article via Infotrieve]

19. Bers DM. Excitation-Contraction Coupling and Cardiac Contractile Force. Dordrecht, Netherlands: Kluwer; 2001.

20. Zima AV, Blatter LA. Inositol-1,4,5-trisphosphate-dependent Ca(2+) signalling in cat atrial excitation-contraction coupling and arrhythmias. J Physiol. 2004; 555: 607–615.[Abstract/Free Full Text]

21. Mackenzie L, Bootman MD, Laine M, Berridge MJ, Thuring J, Holmes A, Li WH, Lipp P. The role of inositol 1,4,5-trisphosphate receptors in Ca(2+) signalling and the generation of arrhythmias in rat atrial myocytes. J Physiol. 2002; 541: 395–409.[Abstract/Free Full Text]

22. Blatter LA, Huser J, Rios E. Sarcoplasmic reticulum Ca2+ release flux underlying Ca2+ sparks in cardiac muscle. Proc Natl Acad Sci U S A. 1997; 94: 4176–4181.[Abstract/Free Full Text]

23. Cheng H, Lederer WJ, Cannell MB. Calcium sparks: elementary events underlying excitation-contraction coupling in heart muscle. Science. 1993; 262: 740–744.[Abstract/Free Full Text]

24. Mackenzie L, Roderick HL, Berridge MJ, Conway SJ, Bootman MD. The spatial pattern of atrial cardiomyocyte calcium signalling modulates contraction. J Cell Sci. 2004; 117: 6327–6337.[Abstract/Free Full Text]

25. Woodcock EA, Matkovich SJ, Binah O. Ins(1,4,5)P3 and cardiac dysfunction. Cardiovasc Res. 1998; 40: 251–256.[Free Full Text]

26. Go LO, Moschella MC, Watras J, Handa KK, Fyfe BS, Marks AR. Differential regulation of two types of intracellular calcium release channels during end-stage heart failure. J Clin Invest. 1995; 95: 888–894.[Medline] [Order article via Infotrieve]

27. Yamada J, Ohkusa T, Nao T, Ueyama T, Yano M, Kobayashi S, Hamano K, Esato K, Matsuzaki M. [Upregulation of inositol 1, 4, 5-trisphosphate receptor expression in atrial tissue in patients with chronic atrial fibrillation]. J Cardiol. 2002; 39: 57–58.[Medline] [Order article via Infotrieve]

28. Taylor CW, Broad LM. Pharmacological analysis of intracellular Ca2+ signalling: problems and pitfalls. Trends Pharmacol Sci. 1998; 19: 370–375.[CrossRef][Medline] [Order article via Infotrieve]

29. Zhou Q, Chu PH, Huang C, Cheng CF, Martone ME, Knoll G, Shelton GD, Evans S, Chen J. Ablation of Cypher, a PDZ-LIM domain Z-line protein, causes a severe form of congenital myopathy. J Cell Biol. 2001; 155: 605–612.[Abstract/Free Full Text]

30. O’Gorman S, Dagenais NA, Qian M, Marchuk Y. Protamine-Cre recombinase transgenes efficiently recombine target sequences in the male germ line of mice, but not in embryonic stem cells. Proc Natl Acad Sci U S A. 1997; 94: 14602–14607.[Abstract/Free Full Text]

31. Moens CB, Stanton BR, Parada LF, Rossant J. Defects in heart and lung development in compound heterozygotes for two different targeted mutations at the N-myc locus. Development. 1993; 119: 485–499.[Abstract]

32. Ramos-Franco J, Bare D, Caenepeel S, Nani A, Fill M, Mignery G. Single-channel function of recombinant type 2 inositol 1,4, 5-trisphosphate receptor. Biophys J. 2000; 79: 1388–1399.[Medline] [Order article via Infotrieve]

33. Maier LS, Zhang T, Chen L, DeSantiago J, Brown JH, Bers DM. Transgenic CaMKIIdeltaC overexpression uniquely alters cardiac myocyte Ca2+ handling: reduced SR Ca2+ load and activated SR Ca2+ release. Circ Res. 2003; 92: 904–911.[Abstract/Free Full Text]

34. Matsumoto M, Nakagawa T, Inoue T, Nagata E, Tanaka K, Takano H, Minowa O, Kuno J, Sakakibara S, Yamada M, Yoneshima H, Miyawaki A, Fukuuchi Y, Furuichi T, Okano H, Mikoshiba K, Noda T. Ataxia and epileptic seizures in mice lacking type 1 inositol 1,4,5-trisphosphate receptor. Nature. 1996; 379: 168–171.[CrossRef][Medline] [Order article via Infotrieve]

35. Vogelsang M, Broede-Sitz A, Schafer E, Zerkowski HR, Brodde OE. Endothelin ETA-receptors couple to inositol phosphate formation and inhibition of adenylate cyclase in human right atrium. J Cardiovasc Pharmacol. 1994; 23: 344–347.[Medline] [Order article via Infotrieve]

36. Bootman MD, Collins TJ, Mackenzie L, Roderick HL, Berridge MJ, Peppiatt CM. 2-aminoethoxydiphenyl borate (2-APB) is a reliable blocker of store-operated Ca2+ entry but an inconsistent inhibitor of InsP3-induced Ca2+ release. Faseb J. 2002; 16: 1145–1150.[Abstract/Free Full Text]

37. Du XJ, Anderson KE, Jacobsen A, Woodcock EA, Dart AM. Suppression of ventricular arrhythmias during ischemia-reperfusion by agents inhibiting Ins(1,4,5)P3 release. Circulation. 1995; 91: 2712–2716.[Abstract/Free Full Text]

38. Loffler BM, Roux S, Kalina B, Clozel M, Clozel JP. Influence of congestive heart failure on endothelin levels and receptors in rabbits. J Mol Cell Cardiol. 1993; 25: 407–416.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. J. Betzenhauser, J. L. Fike, L. E. Wagner II, and D. I. Yule
Protein Kinase A Increases Type-2 Inositol 1,4,5-Trisphosphate Receptor Activity by Phosphorylation of Serine 937
J. Biol. Chem., September 11, 2009; 284(37): 25116 - 25125.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Harzheim, M. Movassagh, R. S.-Y. Foo, O. Ritter, A. Tashfeen, S. J. Conway, M. D. Bootman, and H. L. Roderick
Increased InsP3Rs in the junctional sarcoplasmic reticulum augment Ca2+ transients and arrhythmias associated with cardiac hypertrophy
PNAS, July 7, 2009; 106(27): 11406 - 11411.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
E. A. Woodcock, P. M. Kistler, and Y.-K. Ju
Phosphoinositide signalling and cardiac arrhythmias
Cardiovasc Res, May 1, 2009; 82(2): 286 - 295.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Zheng, H. Cheng, X. Li, J. Zhang, L. Cui, K. Ouyang, L. Han, T. Zhao, Y. Gu, N. D. Dalton, et al.
Cardiac-specific ablation of Cypher leads to a severe form of dilated cardiomyopathy with premature death
Hum. Mol. Genet., February 15, 2009; 18(4): 701 - 713.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Oestreich, S. Malik, S. A. Goonasekera, B. C. Blaxall, G. G. Kelley, R. T. Dirksen, and A. V. Smrcka
Epac and Phospholipase C{epsilon} Regulate Ca2+ Release in the Heart by Activation of Protein Kinase C{epsilon} and Calcium-Calmodulin Kinase II
J. Biol. Chem., January 16, 2009; 284(3): 1514 - 1522.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. K. Nagaleekar, S. A. Diehl, I. Juncadella, C. Charland, N. Muthusamy, S. Eaton, L. Haynes, L. A. Garrett-Sinha, J. Anguita, and M. Rincon
IP3 Receptor-Mediated Ca2+ Release in Naive CD4 T Cells Dictates Their Cytokine Program
J. Immunol., December 15, 2008; 181(12): 8315 - 8322.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. Riise, C. H.T. Nguyen, E. Qvigstad, D. L. Sandnes, J.-B. Osnes, T. Skomedal, F. O. Levy, and K. A. Krobert
Prostanoid F receptors elicit an inotropic effect in rat left ventricle by enhancing myosin light chain phosphorylation
Cardiovasc Res, December 1, 2008; 80(3): 407 - 415.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. S. Park, M. J. Betzenhauser, J. H. Won, J. Chen, and D. I. Yule
The Type 2 Inositol (1,4,5)-Trisphosphate (InsP3) Receptor Determines the Sensitivity of InsP3-induced Ca2+ Release to ATP in Pancreatic Acinar Cells
J. Biol. Chem., September 19, 2008; 283(38): 26081 - 26088.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Petravicz, T. A. Fiacco, and K. D. McCarthy
Loss of IP3 Receptor-Dependent Ca2+ Increases in Hippocampal Astrocytes Does Not Affect Baseline CA1 Pyramidal Neuron Synaptic Activity
J. Neurosci., May 7, 2008; 28(19): 4967 - 4973.
[Abstract] [Full Text] [PDF]


Home page
Circ Arrhythm ElectrophysiolHome page
S. Nattel, B. Burstein, and D. Dobrev
Atrial Remodeling and Atrial Fibrillation: Mechanisms and Implications
Circ Arrhythm Electrophysiol, April 1, 2008; 1(1): 62 - 73.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. L. Domeier, A. V. Zima, J. T. Maxwell, S. Huke, G. A. Mignery, and L. A. Blatter
IP3 receptor-dependent Ca2+ release modulates excitation-contraction coupling in rabbit ventricular myocytes
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H596 - H604.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. D. Bootman and H. L. Roderick
Why, where, and when do cardiac myocytes express inositol 1,4,5-trisphosphate receptors?
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H579 - H581.
[Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. Kockskamper, L. Seidlmayer, S. Walther, K. Hellenkamp, L. S. Maier, and B. Pieske
Endothelin-1 enhances nuclear Ca2+ transients in atrial myocytes through Ins(1,4,5)P3-dependent Ca2+ release from perinuclear Ca2+ stores
J. Cell Sci., January 15, 2008; 121(2): 186 - 195.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart J SupplHome page
S. G. Haworth
The cell and molecular biology of right ventricular dysfunction in pulmonary hypertension
Eur. Heart J. Suppl., December 1, 2007; 9(suppl_H): H10 - H16.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. V. Zima, D. J. Bare, G. A. Mignery, and L. A. Blatter
IP3-dependent nuclear Ca2+ signalling in the mammalian heart
J. Physiol., October 15, 2007; 584(2): 601 - 611.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
N. Gaborit, S. Le Bouter, V. Szuts, A. Varro, D. Escande, S. Nattel, and S. Demolombe
Regional and tissue specific transcript signatures of ion channel genes in the non-diseased human heart
J. Physiol., July 15, 2007; 582(2): 675 - 693.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
H. L. Roderick and M. D. Bootman
Pacemaking, arrhythmias, inotropy and hypertrophy: the many possible facets of IP3 signalling in cardiac myocytes
J. Physiol., June 15, 2007; 581(3): 883 - 884.
[Full Text] [PDF]


Home page
J. Physiol.Home page
N. Kapur and K. Banach
Inositol-1,4,5-trisphosphate-mediated spontaneous activity in mouse embryonic stem cell-derived cardiomyocytes
J. Physiol., June 15, 2007; 581(3): 1113 - 1127.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
H. E. D. J. ter Keurs and P. A. Boyden
Calcium and Arrhythmogenesis
Physiol Rev, April 1, 2007; 87(2): 457 - 506.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
J. K. Foskett, C. White, K.-H. Cheung, and D.-O. D. Mak
Inositol Trisphosphate Receptor Ca2+ Release Channels
Physiol Rev, April 1, 2007; 87(2): 593 - 658.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Oestreich, H. Wang, S. Malik, K. A. Kaproth-Joslin, B. C. Blaxall, G. G. Kelley, R. T. Dirksen, and A. V. Smrcka
Epac-mediated Activation of Phospholipase C{epsilon} Plays a Critical Role in beta-Adrenergic Receptor-dependent Enhancement of Ca2+ Mobilization in Cardiac Myocytes
J. Biol. Chem., February 23, 2007; 282(8): 5488 - 5495.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. D. Bootman, D. R. Higazi, S. Coombes, and H. L. Roderick
Calcium signalling during excitation-contraction coupling in mammalian atrial myocytes.
J. Cell Sci., October 1, 2006; 119(Pt 19): 3915 - 3925.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Proven, H. L. Roderick, S. J. Conway, M. J. Berridge, J. K. Horton, S. J. Capper, and M. D. Bootman
Inositol 1,4,5-trisphosphate supports the arrhythmogenic action of endothelin-1 on ventricular cardiac myocytes
J. Cell Sci., August 15, 2006; 119(16): 3363 - 3375.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. E. Wagner II, M. J. Betzenhauser, and D. I. Yule
ATP Binding to a Unique Site in the Type-1 S2- Inositol 1,4,5-Trisphosphate Receptor Defines Susceptibility to Phosphorylation by Protein Kinase A
J. Biol. Chem., June 23, 2006; 281(25): 17410 - 17419.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
K. A. Sheehan, A. V. Zima, and L. A. Blatter
Regional differences in spontaneous Ca2+ spark activity and regulation in cat atrial myocytes
J. Physiol., May 1, 2006; 572(3): 799 - 809.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. A. Lanzafame, L. Turnbull, F. Amiramahdi, J. F. Arthur, H. Huynh, and E. A. Woodcock
Inositol phospholipids localized to caveolae in rat heart are regulated by {alpha}1-adrenergic receptors and by ischemia-reperfusion
Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H2059 - H2065.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. Wang, E. A. Oestreich, N. Maekawa, T. A. Bullard, K. L. Vikstrom, R. T. Dirksen, G. G. Kelley, B. C. Blaxall, and A. V. Smrcka
Phospholipase C {epsilon} Modulates {beta}-Adrenergic Receptor- Dependent Cardiac Contraction and Inhibits Cardiac Hypertrophy
Circ. Res., December 9, 2005; 97(12): 1305 - 1313.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
96/12/1274    most recent
01.RES.0000172556.05576.4cv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, X.
Right arrow Articles by Chen, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, X.
Right arrow Articles by Chen, J.
Related Collections
Right arrow Arrythmias-basic studies
Right arrow Calcium cycling/excitation-contraction coupling