Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2005;96:e77-e82
Published online before print May 12, 2005, doi: 10.1161/01.RES.0000169067.51055.72
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
96/10/e77    most recent
01.RES.0000169067.51055.72v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cerrone, M.
Right arrow Articles by Priori, S. G
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cerrone, M.
Right arrow Articles by Priori, S. G
Related Collections
Right arrow Clinical genetics
Right arrow Arrythmias-basic studies
Right arrow Calcium cycling/excitation-contraction coupling
Right arrow Genetically altered mice
Right arrow Ion channels/membrane transport
Right arrow Electrocardiology
Right arrow Genetics of cardiovascular disease
Right arrowRelated Article
(Circulation Research. 2005;96:e77.)
© 2005 American Heart Association, Inc.


UltraRapid Communications

Bidirectional Ventricular Tachycardia and Fibrillation Elicited in a Knock-In Mouse Model Carrier of a Mutation in the Cardiac Ryanodine Receptor

Marina Cerrone*, Barbara Colombi*, Massimo Santoro*, Marina Raffaele di Barletta, Mario Scelsi, Laura Villani, Carlo Napolitano, Silvia G Priori

From the Molecular Cardiology (M.C., B.C., M.S., M.R., C.N. S.G.P.) IRCCS Fondazione S. Maugeri, Pavia, Italy; the University of Pavia, Pavia (S.G.P.), Italy; and the Pathology Division (M.S., L.V.), IRCCS Fondazione S. Maugeri, Pavia, Italy.

Correspondence to Dr Silvia G Priori, Molecular Cardiology, Maugeri Foundation, University of Pavia, Via Ferrata 8, 27100- Pavia- Italy. E-mail spriori{at}fsm.it


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Catecholaminergic polymorphic ventricular tachycardia (CPVT) is an inherited disease characterized by adrenergically mediated polymorphic ventricular tachycardia leading to syncope and sudden cardiac death. The autosomal dominant form of CPVT is caused by mutations in the RyR2 gene encoding the cardiac isoform of the ryanodine receptor. In vitro functional characterization of mutant RyR2 channels showed altered behavior on adrenergic stimulation and caffeine administration with enhanced calcium release from the sarcoplasmic reticulum. As of today no experimental evidence is available to demonstrate that RyR2 mutations can reproduce the arrhythmias observed in CPVT patients. We developed a conditional knock-in mouse model carrier of the R4496C mutation, the mouse equivalent to the R4497C mutations identified in CPVT families, to evaluate if the animals would develop a CPVT phenotype and if beta blockers would prevent arrhythmias. Twenty-six mice (12 wild-type (WT) and 14RyRR4496C) underwent exercise stress testing followed by epinephrine administration: none of the WT developed ventricular tachycardia (VT) versus 5/14 RyRR4496C mice (P=0.02). Twenty-one mice (8 WT, 8 RyRR4496C, and 5 RyRR4496C pretreated with beta-blockers) received epinephrine and caffeine: 4/8 (50%) RyRR4496C mice but none of the WT developed VT (P=0.02); 4/5 RyRR4496C mice pretreated with propranolol developed VT (P=0.56 nonsignificant versus RyRR4496C mice). These data provide the first experimental demonstration that the R4496C RyR2 mutation predisposes the murine heart to VT and VF in response caffeine and/or adrenergic stimulation. Furthermore, the results show that analogous to what is observed in patients, beta adrenergic stimulation seems ineffective in preventing life-threatening arrhythmias.


Key Words: arrhythmias • genetics • ion channels • transgenic mice • calcium • catecholamine


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Catecholaminergic polymorphic ventricular tachycardia (CPVT; OMIM: 604772) is a highly malignant cardiac disease manifesting in childhood and adolescence. It is characterized by adrenergically-mediated bidirectional or polymorphic ventricular tachycardia leading to syncope and/or sudden cardiac death.1,2 Based on previously reported linkage data that had mapped the disease to chromosome 1q42–43,3 we reported that the gene for the autosomal dominant variant of CPVT was RyR2; ie, the gene encoding for the cardiac isoform of the ryanodine receptor.4 The first family in which a RyR2 mutation was identified was affected by a highly malignant form of the disease that was resistant to beta blockers; the mutation present in the family (R4497C) is a hot spot that we subsequently identified in other CPVT patients unrelated to the first kindred. The R4497C mutation has been extensively investigated in different in vitro models that demonstrated that it enhances the release of calcium from the sarcoplasmic reticulum.5–8 It has therefore been inferred that arrhythmias may develop as a consequence of abnormal calcium release from intracellular stores. However, experimental evidence linking this mutation to the development of life-threatening arrhythmias is still lacking. Here we report on a conditional knock-in mouse-model carrier of the R4496C mutation that is the mouse equivalent of the human mutation R4497C. The objectives of the present study were to evaluate if the R4496C mutation results in a CPVT phenotype in the mouse and thus to provide experimental proof to the concept that abnormalities in the ryanodine receptor cause a severe form of polymorphic ventricular tachycardia.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Generation of Conditional Knock-In of RyR2 in Mouse Model
We amplified by PCR a 900 bp segment encompassing exons 94 and 95 of the RyR2 gene using exonic primers identified on mouse RyR2 cDNA. This fragment was used as a probe to screen a 129-SV/J lambda mouse genomic library (Stratagene): 800.000 phages were screened and 2 positive plaques were isolated. Through Southern blot hybridization we identified one 3850 bp fragment (BamHI) and one 3500 bp fragment (XbaI) that were cloned into pBluescript (Stratagene) and sequenced to define the genomic structure of the mouse RyR2 gene. Site-direct mutagenesis (Quick-Change, Stratagene) was performed to introduce the point mutation R4496C in exon 94 in the BamHI fragment.

The targeting vector pFrlt1 contained a PGK-Neo gene flanked by Frt sites used for the selection with G418 (Geneticin), a HSV-TK cassette (outside the region of homology) for the selection with gancyclovir and 2 LoxP sites for the conditional knock-in. The 0.6 kb PstI/ApaI blunted fragment containing exon 94 with the R4496C mutation isolated from pBluescript-3850 was inserted into the BamHI blunted site of pFrlt1 between LoxP sites. The 2.3 kb SalI fragment, containing the intronic region between exon 93 and exon 94 isolated from pBluescript-3850, was cloned into the SalI site of pFrlt1. The 1.2 XhoI fragment containing the exon 95 isolated from pBluescript-3500, was cloned into the XhoI site of pFrlt1. The targeting vector linearized with KpnI was transfected into the TVB2 embryonic stem (ES) cells by electroporation (Figure 1). Cells were plated in 100-mm dishes and were cultured for 48 hours. Positive and negative selections were performed using Geneticin (G418) and gancyclovir respectively. Two hundred clones were obtained and analyzed for the homologous recombination into the mouse RyR2 gene by PCR using the vector primer PF-1951+ (5'- CCGGTGGATGTGGAATGTGTGCG -3') and exon primer P-96R (5'- GATCACAAGTCTGTCCCACTGGCC -3'). One positive clone was isolated and confirmed by Southern blot using an external probe to the target sequence of homology. The positive clone was injected into the blastocysts of C57BL/6 mice and chimeric animals were obtained (Core Facility for Conditional Mutagenesis, Dibit- San Raffaele Scientific Institute, Milan). Chimeric male mice were bred to C57BL/6 female mice to establish a hybrid line. In fact, germ-line transmission has generated RyR2+/RyRR4496C-neo mice with genetic background 129SV/J from ES cells and C57BL/6 from blastocysts. The genotypes from the F1 and F2 generations were determined by PCR on DNA from tail biopsy specimens (DNeasy Tissue Kit Qiagen, Madison, Wis). RyR2+/RyRR4496C-neo male mice were bred to female mice that expressed Flp recombinase to remove the selectable marker (neo). The genotypes from F1 generation without neo were determined by PCR on DNA from tail biopsy specimens (DNeasy Tissue Kit Qiagen, Madison, Wis).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of the genomic structure of mouse RyR2 (a); the targeting vector used to generate the knock-in RyRR4496C mouse strain (b); the recombining genomic structure of RyRR4496C (c). Ex=exon; For abbreviations see methods.

Animals were maintained and bred at the Charles River Laboratories in Calco, Italy, and transferred to the Maugeri Foundation for characterization of the phenotype. Animals were maintained and studied according to the protocols approved by the Animal Care and Use facility at the Maugeri Foundation.

ECG Monitoring, Exercise Stress Testing, and Drug Testing
ECG radiotelemetry monitors (Data Sciences International) were implanted intra-abdominally under general anesthesia (Avertin 0.025 mg/kg). Body temperature was maintained at 37°C by use of a thermally controlled heating pad (Harvard Apparatus). ECG was continuously monitored starting 48 hours after surgery. After 72 hours of recovery from surgery, phenotype characterization was performed.

One group (Group 1) of animals exercised on a treadmill until exhaustion. The animals were then injected with epinephrine 2 mg/kg i.p. (WT n=12, RyR2+/RyRR4496C n=14). A second group of animals (Group 2) was injected with epinephrine (2 mg/kg ip) and caffeine (120 mg/kg i.p.) (WT, n=8, RyR2+/RyRR4496C, n=7). ECG monitoring was performed continuously during both exercise and drug testing protocols. Five additional RyR2+/RyRR4496C animals were treated for 24 hours with propranolol i.p. (2 mg/Kg) every 12 hours before being exposed to the epinephrine and caffeine protocol.

Analysis of the Allele-Specific Transcription of the RyR2 Gene
At the end of the experimental protocols, animals were anesthetized and sacrified by cervical dislocation and the heart was immediately excised. Total mRNA was extracted using a RNAEasy Fibrous Tissue Midi Kit (Qiagen). cDNA was generated using random examer from 2.5 µg of mRNA using a Thermoscript RT-PCR system (Invitrogen). PCR fragments encompassing the mutation were amplified from cDNAs using p93F and p94R primers (5' CACATCGCTATGGGGAGCCGAAG 3' and 5' CGAAGGCAACAAACAAGGCCAGC 3') using Taq Platinum (Invitrogen). PCR products were purified with a QIAquick gel Extraction Kit (Qiagen) and quantified with an UV/visible spectrophotometer. Single nucleotide primer extension was performed with a SnaPshot Multiplex Kit (Applied Biosystems) as suggested by the manufacturer in a 10 µL reaction using 0.36 pmol of the template and 0.2 µmol/L primer 5' CAGCATTCTCATGTTGTAAAAGTTGC 3' (HPSF purified, MWG-Biotech). The reactions were run on an ABI PRISM 310 Genetic Analyzer and analyzed using the Gene Scan software (Applied Biosystems).

Histology
Hearts of 8-month old mice (WT n=2 and RyR2+/RyRR4496C n=3) were excised, stored in 10% formalin and serially sectioned. Sections were fixed with 10% formalin and stained with hematoxylin-eosin and/or Masson stain and analyzed with routine light microscopy.

Statistical Analysis and Definitions
Statistical analysis was performed using the SPSS statistical package (v. 12.01). Parametric tests were used to compare normally distributed variables (unpaired t-test and ANOVA with Bonferroni correction for multiple comparisons). Cross tabulations with chi-square or Fisher’s exact test were used as appropriate for categorical variables. Data are expressed as mean±SD.

Arrhythmias were defined as follows: non-sustained ventricular tachycardia (VTns) was defined as a series of 4 to 10 consecutive repetitive ventricular ectopic beats (VEBs), sustained VT (VTsust) was defined as a run of >10 consecutive VEBs, ventricular fibrillation (VF) was defined as a VTsust degenerating into ventricular fibrillation leading to sudden death.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Development and Pathology of WT and RyR2+/RyRR4496C Mice
No difference between the WT versus RyR2+/RyRR4496C animals was present in the duration of the pregnancy, delivery, size and survival of litters, development, and behavior. Young adult mice of both genders entered the experimental protocol: no difference in the weight between WT and RyR2+/RyRR4496C mice was observed (mean weight WT 25.6±3.6 gr; RyR2+/RyRR4496C 27.3±4.9 gr: P=0.189).

Gross inspection did not show any macroscopic alteration of the heart and vessels. Histological examination did not show any tissue abnormalities, no fibrous-fatty infiltration was observed, no signs suggestive of right ventricular cardiomyopathy were identified (Figure 2).



View larger version (102K):
[in this window]
[in a new window]
 
Figure 2. Top Left: Hematoxylin-Eosin stain (250X) of a section of the right ventricle of a WT mouse. Top Right: Trichromic Masson stain (400X) of a section of the right ventricle of a WT mouse. Bottom Left: Hematoxylin-Eosin stain (250X) of a section of the right ventricle of a RyRR4496C mouse. Bottom Right: Trichromic Masson stain (400X) of a section of the right ventricle of a RyRR4496C mouse. Endo=endocardium; Epi=epicardium.

Phenotype Characterization
Continuous ECG monitoring revealed the absence of spontaneous ventricular arrhythmias both in WT and RyR2+/RyRR4496C mice. Interestingly the RyR2+/RyRR4496C, at variance with CPVT patients, did not manifest supraventricular arrhythmias during EG monitoring.

Group 1 included 26 mice (12 WT and 14 RyR2+/RyRR4496C) that underwent exercise stress testing followed by epinephrine administration. The QT interval and RR interval of the WT and of the mutant mice did not present significant differences (Table 1). None of the 12 WT mice developed repetitive ventricular arrhythmias although 5/14 RyR2+/RyRR4496C mice developed VTsus (n=3) or VTns (n=2; Figure 3B) (WT versus RyR2+/RyRR4496C; P=0.02; Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. A, ECG recording of nonsustained bidirectional VT in a CPVT patient. B, ECG recording of a nonsustained bidirectional VT in a RyR2+/RyRR4496C mouse. msec indicates milliseconds

Group 2 included 21 mice (8 WT, 8 RyR2+/RyRR4496C, and 5 RyR2+/RyRR4496C pretreated with beta-blockers) that received epinephrine and caffeine i.p. The QT interval (measured using the tangent method9 and RR interval of the WT and of the mutant mice did not present significant differences (Table 1), the RR interval was significantly prolonged in the RyR2+/RyRR4496C animals pretreated with beta blockers (Table 1). The epinephrine and caffeine test induced more severe arrhythmias than the exercise protocol. Two WT mice developed VTns 6 had no arrhythmias; thus none of the WT animals experienced sustained cardiac arrhythmias. Among the RyR2+/RyRR4496C mice 4/8 or 50% developed sustained arrhythmias (VTsust n=2; Figure 4B and VF n=2; Figure 5B P=0.02 versus WT; Table 1).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. A, ECG recording of sustained and self terminating bidirectional VT in a CPVT patient. B, ECG recording of a sustained and self terminating bidirectional VT in a RyR2+/RyRR4496C mouse. msec=milliseconds; sec=seconds



View larger version (35K):
[in this window]
[in a new window]
 
Figure 5. A, ECG recording of a bidirectional VT degenerating into VF in a CPVT patient. B, ECG recording of a bidirectional VT degenerating into VF in a RyR2+/RyRR4496C mouse. msec=milliseconds; min=minutes

It is remarkable that VT in the RyR2+/RyRR4496C mice had the typical bidirectional morphology that is considered the most distinguishing characteristics of CPVT patients (Figure 3, 4, and 5 UpUpA).

The coupling interval of the beats initiating VTs was only slightly shorter than the preceding RR interval (Table 1), R-on T phenomenon was never observed: these features are similar to those observed in CPVT patients (Figure 6). Panel B of Figure 3, 4, and 5UpUp show examples of a non-sustained VT, of a sustained VT that spontaneously terminates and of a sustained VT degenerating into VF respectively. In panel A of the same figure similar arrhythmias recorded in CPVT patients are shown.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 6. A, Coupling interval of the initiating beat of polymorphic ventricular tachycardia in CPVT patients. B, Coupling interval of the initiating beat of polymorphic ventricular tachycardia in RyR2+/RyRR4496C mice. CI=Coupling Interval; interval in msec between an extrasystolic beat and the preceding sinus beat; RR=interval between 2 consecutive sinus beats; CI/RR=ratio between the coupling interval of an extrasystolic beat and the preceding RR interval; msec=milliseconds.

Five RyR2+/RyRR4496C mice were treated with propranolol to evaluate if antiadrenergic compounds could prevent induction of arrhythmias. After drug administration we observed a prolongation of RR interval from 94.5±13 to 118±13 ms beats per minute (P<0.001). Interestingly, the effect of beta blockers on heart rate in RyR2+/RyRR4496C mice was not different from the effect on WT mice (mean prolongation or RR interval was as follows: RyR2+/RyRR4496C mice 23.62+0.14 ms versus WT mice 22.92+3.6 ms P=0.69; the percentage of RR change after beta blockers ({Delta}%={Delta}RR* 100/RR baseline) was RyR2+/RyRR4496C mice 25±3% versus WT mice 27±5% P=0.52). Despite pretreatment with beta blockers, the administration of caffeine and epinephrine elicited VTsust in 2 and VF in 2 (sustained arrhythmias in 4 mice); only 1 mouse had no arrhythmias (P=0.56; ie, nonsignificant versus RyR2+/RyRR4496C mice).

We used a single nucleotide primer extension method to perform a relative quantification of allele-specific expression10 of the RyR2 gene in the heterozygous mice. Total mRNA was available for 24/27 RyR2+/RyRR4496C mice from Group 1 and Group 2. 10/24 of the mice developed either VTns or VTs whereas 14 had no arrhythmias. The WT-to-R4496C mRNA ratio was similar in the 2 groups (R4496C-mRNA=0.66±0.14 in the heart of the mice without arrhythmias and 0.67±0.02 in the mice with arrhythmias; NS).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Our data provide the previously missing demonstration that the presence of the R4496C mutation predisposes the murine heart to the development of bidirectional and polymorphic VT and to ventricular fibrillation on administration of caffeine and of adrenergic agonists. Combined with the evidence provided by in vitro characterization of the same RyR2 mutant5–8 it seems plausible to suggest that arrhythmias in the RyR2+/RyRR4496C mice are caused by enhanced calcium release from the sarcoplasmic reticulum through the defective RyR2 channels.

The cardiac ryanodine receptor (RyR2) is a tetrameric intracellular calcium release channel located in the sarcoplasmic reticulum (SR) that has a pivotal role in cardiac excitation-contraction coupling. In response to a small intracellular calcium influx through the L-type voltage dependent calcium channels, RyR2 releases from the SR the large amount of calcium that is needed to elicit contraction of the cardiac cell. However, in addition to such a tightly regulated physiological process, RyR2 may also release calcium in response to SR calcium overload, which may occur under pathological conditions such as physical and emotional stress and digitalis toxicity and may be arrhythmogenic.

Previously, we reported that mutations in the gene encoding for RyR2 cause the autosomal dominant form of catecholaminergic polymorphic ventricular tachycardia (CPVT).4 Shortly after our report, other groups identified novel RyR2 mutations in patients affected by CPVT.11 To date 34 RyR2 mutations have been reported in the "Gene Connection for the Heart" mutation database for inherited arrhythmogenic diseases (http://pc4.fsm.it:81/cardmoc).

The first mutation that we identified in an Italian CPVT family lead to the replacement of arginine at position 4497 with a cysteine. Because this mutation was associated with a highly malignant phenotype it has been selected by several authors for their in vitro studies aimed at the functional characterization of RyR2 mutants. Jiang et al6 were the first to investigate the R4496C mouse equivalent of the R4497C human mutation. They suggested that when expressed in HEK293 cells, the mutation enhances the basal channel activity and the propensity for spontaneous calcium release at rest and in response to caffeine. More recently, the same authors further elaborated their results and proposed that the R4496C, as well as other RyR2 mutations identified in CPVT families, increase the sensitivity of RyR2 channels to luminal calcium thus facilitating the spontaneous release of calcium from the SR.5 George et al7 investigated the same mutation by expression in HL-1 cardiac myocytes. At variance with what was suggested by Jiang et at5 based on their studies in HEK 293 cells, George et al7 reported that the R4496C mutant presents no enhancement of basal activity, but they confirmed that after exposure to the RyR agonist caffeine or to beta adrenergic stimulation, calcium release was significantly augmented in the mutant channels. George et al also showed that the dissociation of the FKBP12.6 protein from the mutant was similar to that observed in the WT RyR2 thus challenging the hypothesis advanced by Wehrens et al8 who proposed that the enhanced calcium release observed in the mutant during beta adrenergic stimulation was caused by the excessive dissociation of the RyR2:FKBP12.6 complex. Overall, although disagreement exists on the mechanisms by which the R4496C mutation sensitizes the RyR2 channel to agonists, three independent groups have confirmed that on caffeine and beta adrenergic stimulation RyR2R4496C channels respond with an augmented calcium release.

None of the functional studies performed so far proved that the presence of RyR2R4496C channels is able to induce sustained ectopic activity leading to VT and VF on exposure to the RyR-agonist caffeine or during adrenergic stimulation. The present study fills that gap by showing that polymorphic and even bidirectional VT may be elicited in the RyR2+/RyRR4496C mice under conditions that strictly resemble those eliciting cardiac arrhythmias in CPVT patients. Consistent with the incomplete penetrance of the CPVT phenotype in humans, not all RyR2+/RyRR4496C mice developed arrhythmias. The cause for incomplete penetrance is today the most puzzling aspect of inherited arrhythmogenic diseases and no satisfactory explanation has been provided to account for the major differences in the clinical manifestations observed among affected patients, even when they are members of the same family. Both genetic and environmental factors12 have been advocated to account for this variability but a robust hypothesis supported by experimental data is missing.

We used a single nucleotide primer extension method to perform a relative quantification of allele-specific transcription of the RyR2 gene in the heterozygous mice to investigate if the variability in the pattern of arrhythmias elicited in response to exercise and/or pharmacological challenges correlates with the allele specific transcription of RyR2. When we measured the relative transcription of WT and mutant mRNA in the hearts of the RyR2+/RyRR4496C mice and showed that the mutant mRNA was slightly underrepresented as compared with the WT mRNA, but no differences in the levels of the mutant mRNA were present between the animals that developed arrhythmias and those that remained asymptomatic throughout the provocative tests. It is concluded that the severity of the arrhythmias is not related to the allele-specific transcription of RyR2.

Patients affected by the R4497C mutation appear to have an extremely lethal form of the disease. Cardiac arrest occurred in 7/13 (53%) carriers of the mutation and in 4 patients it was a lethal event. Furthermore VT or VF occurred in 5 patients also during beta-blocker therapy suggesting that the protection afforded by these agents may not be sufficient to prevent life-threatening events in CPVT.2 Treatment with propranolol was not effective in preventing arrhythmias in RyR2+/RyRR4496C mice thus confirming the observation made in humans. Whether the R4496C mutation is particularly resistant to antiadrenergic interventions cannot yet be defined.

In conclusion, the phenotype of the murine model that we have developed presents remarkable similarity with the clinical manifestations of patient carriers of the R4497C mutations in terms of arrhythmias morphology, severity, and the incomplete response to beta blockers. It is expected that this knock-in model will allow us to clarify several yet uncertain aspects of CPVT and may provide a valuable tool for investigating novel treatments for CPVT patients.


*    Acknowledgments
 
This work was supported by the following grants: Telethon GP0227Y01 and GGP04066, Ricerca Finalizzata 2003/180, Fondo per gli Investimenti della Ricerca di Base RBNE01XMP4_006, RBCa034X_002, and COFIN 2001067817_003.


*    Footnotes
 
*These authors have contributed equally to this work. Back

Original received March 28, 2005; resubmission received April 21, 2005; revised resubmission received April 28, 2005; accepted April 28, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Leenhardt A, Lucet V, Denjoy I, Grau F, Ngoc DD, Coumel P. Catecholaminergic polymorphic ventricular tachycardia in children. A 7-year follow-up of 21 patients. Circulation. 1995; 91: 1512–1519.[Abstract/Free Full Text]

2. Priori SG, Napolitano C, Memmi M, Colombi B, Drago F, Gasparini M, DeSimone L, Coltorti F, Bloise R, Keegan R, Cruz Filho FE, Vignati G, Benatar A, DeLogu A. Clinical and molecular characterization of patients with catecholaminergic polymorphic ventricular tachycardia. Circulation. 2002; 106: 69–74.[Abstract/Free Full Text]

3. Swan H, Piippo K, Viitasalo M, Heikkila P, Paavonen T, Kainulainen K, Kere J, Keto P, Kontula K, Toivonen L. Arrhythmic disorder mapped to chromosome 1q42–q43 causes malignant polymorphic ventricular tachycardia in structurally normal hearts. J Am Coll Cardiol. 1999; 34: 2035–2042.[Abstract/Free Full Text]

4. Priori SG, Napolitano C, Tiso N, Memmi M, Vignati G, Bloise R, Sorrentino VV, Danieli GA. Mutations in the cardiac ryanodine receptor gene (hRyR2) underlie catecholaminergic polymorphic ventricular tachycardia. Circulation. 2001; 103: 196–200.[Abstract/Free Full Text]

5. Jiang D, Xiao B, Yang D, Wang R, Choi P, Zhang L, Cheng H, Chen SR. RyR2 mutations linked to ventricular tachycardia and sudden death reduce the threshold for store-overload-induced Ca2+ release (SOICR). Proc Natl Acad Sci U S A. 2004; 101: 13062–13067.[Abstract/Free Full Text]

6. Jiang D, Xiao B, Zhang L, Chen SR. Enhanced basal activity of a cardiac Ca2+ release channel (ryanodine receptor) mutant associated with ventricular tachycardia and sudden death. Circ Res. 2002; 91: 218–225.[Abstract/Free Full Text]

7. George CH, Higgs GV, Lai FA. Ryanodine receptor mutations associated with stress-induced ventricular tachycardia mediate increased calcium release in stimulated cardiomyocytes. Circ Res. 2003; 93: 531–540.[Abstract/Free Full Text]

8. Wehrens XH, Lehnart SE, Huang F, Vest JA, Reiken SR, Mohler PJ, Sun J, Guatimosim S, Song LS, Rosemblit N, D’Armiento JM, Napolitano C, Memmi M, Priori SG, Lederer WJ, Marks AR. FKBP12.6 deficiency and defective calcium release channel (ryanodine receptor) function linked to exercise-induced sudden cardiac death. Cell. 2003; 113: 829–840.[CrossRef][Medline] [Order article via Infotrieve]

9. Lande G, Demolombe S, Bammert A, Moorman A, Charpentier F, Escande D. Transgenic mice overexpressing human KvLQT1 dominant-negative isoform. Part II. Pharmacological profile. Cardiovasc Res. 2001; 50: 328–334.[Abstract/Free Full Text]

10. Tournier I, Raux G, Di Fiore F, Marechal I, Leclerc C, Martin C, Wang Q, Buisine MP, Stoppa-Lyonnet D, Olschwang S, Frebourg T, Tosi M. Analysis of the allele-specific expression of the mismatch repair gene MLH1 using a simple DHPLC-Based Method. Hum Mutat. 2004; 23: 379–384.[CrossRef][Medline] [Order article via Infotrieve]

11. Laitinen PJ, Brown KM, Piippo K, Swan H, Devaney JM, Brahmbhatt B, Donarum EA, Marino M, Tiso N, Viitasalo M, Toivonen L, Stephan DA, Kontula K. Mutations of the cardiac ryanodine receptor (RyR2) gene in familial polymorphic ventricular tachycardia. Circulation. 2001; 103: 485–490.[Abstract/Free Full Text]

12. Priori SG. Inherited Arrhythmogenic diseases: the complexity beyond monogenic disorders. Circ Res. 2004; 94: 140–145.[Abstract/Free Full Text]


Related Article:

Can Novel Therapies for Arrhythmias Caused by Spontaneous Sarcoplasmic Reticulum Ca2+ Release be Developed Using Mouse Models?
Steven R. Houser
Circ. Res. 2005 96: 1031-1032. [Extract] [Full Text] [PDF]



This article has been cited by other articles:


Home page
Biol Res NursHome page
T. A. Beery, M. J. Shah, and D. W. Benson
Genetic Characterization of Familial CPVT After 30 Years
Biol Res Nurs, July 1, 2009; 11(1): 66 - 72.
[Abstract] [PDF]


Home page
Circ. Res.Home page
M. Fernandez-Velasco, A. Rueda, N. Rizzi, J.-P. Benitah, B. Colombi, C. Napolitano, S. G. Priori, S. Richard, and A. M. Gomez
Increased Ca2+ Sensitivity of the Ryanodine Receptor Mutant RyR2R4496C Underlies Catecholaminergic Polymorphic Ventricular Tachycardia
Circ. Res., January 30, 2009; 104(2): 201 - 209.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Rizzi, N. Liu, C. Napolitano, A. Nori, F. Turcato, B. Colombi, S. Bicciato, D. Arcelli, A. Spedito, M. Scelsi, et al.
Unexpected Structural and Functional Consequences of the R33Q Homozygous Mutation in Cardiac Calsequestrin: A Complex Arrhythmogenic Cascade in a Knock In Mouse Model
Circ. Res., August 1, 2008; 103(3): 298 - 306.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. Liu and S. G. Priori
Disruption of calcium homeostasis and arrhythmogenesis induced by mutations in the cardiac ryanodine receptor and calsequestrin
Cardiovasc Res, January 15, 2008; 77(2): 293 - 301.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
L. A. Venetucci, A. W. Trafford, S. C. O'Neill, and D. A. Eisner
The sarcoplasmic reticulum and arrhythmogenic calcium release
Cardiovasc Res, January 15, 2008; 77(2): 285 - 292.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Xiao, X. Tian, P. P. Jones, J. Bolstad, H. Kong, R. Wang, L. Zhang, H. J. Duff, A. M. Gillis, S. Fleischer, et al.
Removal of FKBP12.6 Does Not Alter the Conductance and Activation of the Cardiac Ryanodine Receptor or the Susceptibility to Stress-induced Ventricular Arrhythmias
J. Biol. Chem., November 30, 2007; 282(48): 34828 - 34838.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Jiang, W. Chen, R. Wang, L. Zhang, and S. R. W. Chen
Loss of luminal Ca2+ activation in the cardiac ryanodine receptor is associated with ventricular fibrillation and sudden death
PNAS, November 13, 2007; 104(46): 18309 - 18314.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. G. Akar
The Perfect Storm: Defective Calcium Cycling in Insulated Fibers With Reduced Repolarization Reserve
Circ. Res., November 9, 2007; 101(10): 968 - 970.
[Full Text] [PDF]


Home page
Circ. Res.Home page
M. Cerrone, S. F. Noujaim, E. G. Tolkacheva, A. Talkachou, R. O'Connell, O. Berenfeld, J. Anumonwo, S. V. Pandit, K. Vikstrom, C. Napolitano, et al.
Arrhythmogenic Mechanisms in a Mouse Model of Catecholaminergic Polymorphic Ventricular Tachycardia
Circ. Res., November 9, 2007; 101(10): 1039 - 1048.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
W. P. Dirksen, V. A. Lacombe, M. Chi, A. Kalyanasundaram, S. Viatchenko-Karpinski, D. Terentyev, Z. Zhou, S. Vedamoorthyrao, N. Li, N. Chiamvimonvat, et al.
A mutation in calsequestrin, CASQ2D307H, impairs Sarcoplasmic Reticulum Ca2+ handling and causes complex ventricular arrhythmias in mice
Cardiovasc Res, July 1, 2007; 75(1): 69 - 78.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
H. E. D. J. ter Keurs and P. A. Boyden
Calcium and Arrhythmogenesis
Physiol Rev, April 1, 2007; 87(2): 457 - 506.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
V. Iyer, R. J. Hajjar, and A. A. Armoundas
Mechanisms of Abnormal Calcium Homeostasis in Mutations Responsible for Catecholaminergic Polymorphic Ventricular Tachycardia
Circ. Res., February 2, 2007; 100(2): e22 - e31.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. J. Kannankeril, B. M. Mitchell, S. A. Goonasekera, M. G. Chelu, W. Zhang, S. Sood, D. L. Kearney, C. I. Danila, M. De Biasi, X. H. T. Wehrens, et al.
Mice with the R176Q cardiac ryanodine receptor mutation exhibit catecholamine-induced ventricular tachycardia and cardiomyopathy
PNAS, August 8, 2006; 103(32): 12179 - 12184.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Liu, B. Colombi, M. Memmi, S. Zissimopoulos, N. Rizzi, S. Negri, M. Imbriani, C. Napolitano, F. A. Lai, and S. G. Priori
Arrhythmogenesis in Catecholaminergic Polymorphic Ventricular Tachycardia: Insights From a RyR2 R4496C Knock-In Mouse Model
Circ. Res., August 4, 2006; 99(3): 292 - 298.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Fernandez-Velasco, A. M. Gomez, and S. Richard
Unzipping RyR2 in adult cardiomyocytes: Getting closer to mechanisms of inherited ventricular arrhythmias?
Cardiovasc Res, June 1, 2006; 70(3): 407 - 409.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. E. Lehnart, C. Terrenoire, S. Reiken, X. H. T. Wehrens, L.-S. Song, E. J. Tillman, S. Mancarella, J. Coromilas, W. J. Lederer, R. S. Kass, et al.
Stabilization of cardiac ryanodine receptor prevents intracellular calcium leak and arrhythmias
PNAS, May 16, 2006; 103(20): 7906 - 7910.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. H. George, H. Jundi, N. Walters, N. L. Thomas, R. R. West, and F. A. Lai
Arrhythmogenic Mutation-Linked Defects in Ryanodine Receptor Autoregulation Reveal a Novel Mechanism of Ca2+ Release Channel Dysfunction
Circ. Res., January 6, 2006; 98(1): 88 - 97.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. E. Anderson
The Fire From Within: The Biggest Ca2+ Channel Erupts and Dribbles
Circ. Res., December 9, 2005; 97(12): 1213 - 1215.
[Full Text] [PDF]


Home page
Circ. Res.Home page
S. G. Priori and C. Napolitano
Intracellular Calcium Handling Dysfunction and Arrhythmogenesis: A New Challenge for the Electrophysiologist
Circ. Res., November 25, 2005; 97(11): 1077 - 1079.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. J. Milan and C. A. MacRae
Animal models for arrhythmias
Cardiovasc Res, August 15, 2005; 67(3): 426 - 437.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. R. Houser
Can Novel Therapies for Arrhythmias Caused by Spontaneous Sarcoplasmic Reticulum Ca2+ Release be Developed Using Mouse Models?
Circ. Res., May 27, 2005; 96(10): 1031 - 1032.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
96/10/e77    most recent
01.RES.0000169067.51055.72v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cerrone, M.
Right arrow Articles by Priori, S. G
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cerrone, M.
Right arrow Articles by Priori, S. G
Related Collections
Right arrow Clinical genetics
Right arrow Arrythmias-basic studies
Right arrow Calcium cycling/excitation-contraction coupling
Right arrow Genetically altered mice
Right arrow Ion channels/membrane transport
Right arrow Electrocardiology
Right arrow Genetics of cardiovascular disease
Right arrowRelated Article