UltraRapid Communications |
From the Molecular Cardiology (M.C., B.C., M.S., M.R., C.N. S.G.P.) IRCCS Fondazione S. Maugeri, Pavia, Italy; the University of Pavia, Pavia (S.G.P.), Italy; and the Pathology Division (M.S., L.V.), IRCCS Fondazione S. Maugeri, Pavia, Italy.
Correspondence to Dr Silvia G Priori, Molecular Cardiology, Maugeri Foundation, University of Pavia, Via Ferrata 8, 27100- Pavia- Italy. E-mail spriori{at}fsm.it
| Abstract |
|---|
|
|
|---|
Key Words: arrhythmias genetics ion channels transgenic mice calcium catecholamine
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
The targeting vector pFrlt1 contained a PGK-Neo gene flanked by Frt sites used for the selection with G418 (Geneticin), a HSV-TK cassette (outside the region of homology) for the selection with gancyclovir and 2 LoxP sites for the conditional knock-in. The 0.6 kb PstI/ApaI blunted fragment containing exon 94 with the R4496C mutation isolated from pBluescript-3850 was inserted into the BamHI blunted site of pFrlt1 between LoxP sites. The 2.3 kb SalI fragment, containing the intronic region between exon 93 and exon 94 isolated from pBluescript-3850, was cloned into the SalI site of pFrlt1. The 1.2 XhoI fragment containing the exon 95 isolated from pBluescript-3500, was cloned into the XhoI site of pFrlt1. The targeting vector linearized with KpnI was transfected into the TVB2 embryonic stem (ES) cells by electroporation (Figure 1). Cells were plated in 100-mm dishes and were cultured for 48 hours. Positive and negative selections were performed using Geneticin (G418) and gancyclovir respectively. Two hundred clones were obtained and analyzed for the homologous recombination into the mouse RyR2 gene by PCR using the vector primer PF-1951+ (5'- CCGGTGGATGTGGAATGTGTGCG -3') and exon primer P-96R (5'- GATCACAAGTCTGTCCCACTGGCC -3'). One positive clone was isolated and confirmed by Southern blot using an external probe to the target sequence of homology. The positive clone was injected into the blastocysts of C57BL/6 mice and chimeric animals were obtained (Core Facility for Conditional Mutagenesis, Dibit- San Raffaele Scientific Institute, Milan). Chimeric male mice were bred to C57BL/6 female mice to establish a hybrid line. In fact, germ-line transmission has generated RyR2+/RyRR4496C-neo mice with genetic background 129SV/J from ES cells and C57BL/6 from blastocysts. The genotypes from the F1 and F2 generations were determined by PCR on DNA from tail biopsy specimens (DNeasy Tissue Kit Qiagen, Madison, Wis). RyR2+/RyRR4496C-neo male mice were bred to female mice that expressed Flp recombinase to remove the selectable marker (neo). The genotypes from F1 generation without neo were determined by PCR on DNA from tail biopsy specimens (DNeasy Tissue Kit Qiagen, Madison, Wis).
|
Animals were maintained and bred at the Charles River Laboratories in Calco, Italy, and transferred to the Maugeri Foundation for characterization of the phenotype. Animals were maintained and studied according to the protocols approved by the Animal Care and Use facility at the Maugeri Foundation.
ECG Monitoring, Exercise Stress Testing, and Drug Testing
ECG radiotelemetry monitors (Data Sciences International) were implanted intra-abdominally under general anesthesia (Avertin 0.025 mg/kg). Body temperature was maintained at 37°C by use of a thermally controlled heating pad (Harvard Apparatus). ECG was continuously monitored starting 48 hours after surgery. After 72 hours of recovery from surgery, phenotype characterization was performed.
One group (Group 1) of animals exercised on a treadmill until exhaustion. The animals were then injected with epinephrine 2 mg/kg i.p. (WT n=12, RyR2+/RyRR4496C n=14). A second group of animals (Group 2) was injected with epinephrine (2 mg/kg ip) and caffeine (120 mg/kg i.p.) (WT, n=8, RyR2+/RyRR4496C, n=7). ECG monitoring was performed continuously during both exercise and drug testing protocols. Five additional RyR2+/RyRR4496C animals were treated for 24 hours with propranolol i.p. (2 mg/Kg) every 12 hours before being exposed to the epinephrine and caffeine protocol.
Analysis of the Allele-Specific Transcription of the RyR2 Gene
At the end of the experimental protocols, animals were anesthetized and sacrified by cervical dislocation and the heart was immediately excised. Total mRNA was extracted using a RNAEasy Fibrous Tissue Midi Kit (Qiagen). cDNA was generated using random examer from 2.5 µg of mRNA using a Thermoscript RT-PCR system (Invitrogen). PCR fragments encompassing the mutation were amplified from cDNAs using p93F and p94R primers (5' CACATCGCTATGGGGAGCCGAAG 3' and 5' CGAAGGCAACAAACAAGGCCAGC 3') using Taq Platinum (Invitrogen). PCR products were purified with a QIAquick gel Extraction Kit (Qiagen) and quantified with an UV/visible spectrophotometer. Single nucleotide primer extension was performed with a SnaPshot Multiplex Kit (Applied Biosystems) as suggested by the manufacturer in a 10 µL reaction using 0.36 pmol of the template and 0.2 µmol/L primer 5' CAGCATTCTCATGTTGTAAAAGTTGC 3' (HPSF purified, MWG-Biotech). The reactions were run on an ABI PRISM 310 Genetic Analyzer and analyzed using the Gene Scan software (Applied Biosystems).
Histology
Hearts of 8-month old mice (WT n=2 and RyR2+/RyRR4496C n=3) were excised, stored in 10% formalin and serially sectioned. Sections were fixed with 10% formalin and stained with hematoxylin-eosin and/or Masson stain and analyzed with routine light microscopy.
Statistical Analysis and Definitions
Statistical analysis was performed using the SPSS statistical package (v. 12.01). Parametric tests were used to compare normally distributed variables (unpaired t-test and ANOVA with Bonferroni correction for multiple comparisons). Cross tabulations with chi-square or Fishers exact test were used as appropriate for categorical variables. Data are expressed as mean±SD.
Arrhythmias were defined as follows: non-sustained ventricular tachycardia (VTns) was defined as a series of 4 to 10 consecutive repetitive ventricular ectopic beats (VEBs), sustained VT (VTsust) was defined as a run of >10 consecutive VEBs, ventricular fibrillation (VF) was defined as a VTsust degenerating into ventricular fibrillation leading to sudden death.
| Results |
|---|
|
|
|---|
Gross inspection did not show any macroscopic alteration of the heart and vessels. Histological examination did not show any tissue abnormalities, no fibrous-fatty infiltration was observed, no signs suggestive of right ventricular cardiomyopathy were identified (Figure 2).
|
Phenotype Characterization
Continuous ECG monitoring revealed the absence of spontaneous ventricular arrhythmias both in WT and RyR2+/RyRR4496C mice. Interestingly the RyR2+/RyRR4496C, at variance with CPVT patients, did not manifest supraventricular arrhythmias during EG monitoring.
Group 1 included 26 mice (12 WT and 14 RyR2+/RyRR4496C) that underwent exercise stress testing followed by epinephrine administration. The QT interval and RR interval of the WT and of the mutant mice did not present significant differences (Table 1). None of the 12 WT mice developed repetitive ventricular arrhythmias although 5/14 RyR2+/RyRR4496C mice developed VTsus (n=3) or VTns (n=2; Figure 3B) (WT versus RyR2+/RyRR4496C; P=0.02; Table 1).
|
|
Group 2 included 21 mice (8 WT, 8 RyR2+/RyRR4496C, and 5 RyR2+/RyRR4496C pretreated with beta-blockers) that received epinephrine and caffeine i.p. The QT interval (measured using the tangent method9 and RR interval of the WT and of the mutant mice did not present significant differences (Table 1), the RR interval was significantly prolonged in the RyR2+/RyRR4496C animals pretreated with beta blockers (Table 1). The epinephrine and caffeine test induced more severe arrhythmias than the exercise protocol. Two WT mice developed VTns 6 had no arrhythmias; thus none of the WT animals experienced sustained cardiac arrhythmias. Among the RyR2+/RyRR4496C mice 4/8 or 50% developed sustained arrhythmias (VTsust n=2; Figure 4B and VF n=2; Figure 5B P=0.02 versus WT; Table 1).
|
|
It is remarkable that VT in the RyR2+/RyRR4496C mice had the typical bidirectional morphology that is considered the most distinguishing characteristics of CPVT patients (Figure 3, 4, and 5 ![]()
A).
The coupling interval of the beats initiating VTs was only slightly shorter than the preceding RR interval (Table 1), R-on T phenomenon was never observed: these features are similar to those observed in CPVT patients (Figure 6). Panel B of Figure 3, 4, and 5![]()
show examples of a non-sustained VT, of a sustained VT that spontaneously terminates and of a sustained VT degenerating into VF respectively. In panel A of the same figure similar arrhythmias recorded in CPVT patients are shown.
|
Five RyR2+/RyRR4496C mice were treated with propranolol to evaluate if antiadrenergic compounds could prevent induction of arrhythmias. After drug administration we observed a prolongation of RR interval from 94.5±13 to 118±13 ms beats per minute (P<0.001). Interestingly, the effect of beta blockers on heart rate in RyR2+/RyRR4496C mice was not different from the effect on WT mice (mean prolongation or RR interval was as follows: RyR2+/RyRR4496C mice 23.62+0.14 ms versus WT mice 22.92+3.6 ms P=0.69; the percentage of RR change after beta blockers (
%=
RR* 100/RR baseline) was RyR2+/RyRR4496C mice 25±3% versus WT mice 27±5% P=0.52). Despite pretreatment with beta blockers, the administration of caffeine and epinephrine elicited VTsust in 2 and VF in 2 (sustained arrhythmias in 4 mice); only 1 mouse had no arrhythmias (P=0.56; ie, nonsignificant versus RyR2+/RyRR4496C mice).
We used a single nucleotide primer extension method to perform a relative quantification of allele-specific expression10 of the RyR2 gene in the heterozygous mice. Total mRNA was available for 24/27 RyR2+/RyRR4496C mice from Group 1 and Group 2. 10/24 of the mice developed either VTns or VTs whereas 14 had no arrhythmias. The WT-to-R4496C mRNA ratio was similar in the 2 groups (R4496C-mRNA=0.66±0.14 in the heart of the mice without arrhythmias and 0.67±0.02 in the mice with arrhythmias; NS).
| Discussion |
|---|
|
|
|---|
The cardiac ryanodine receptor (RyR2) is a tetrameric intracellular calcium release channel located in the sarcoplasmic reticulum (SR) that has a pivotal role in cardiac excitation-contraction coupling. In response to a small intracellular calcium influx through the L-type voltage dependent calcium channels, RyR2 releases from the SR the large amount of calcium that is needed to elicit contraction of the cardiac cell. However, in addition to such a tightly regulated physiological process, RyR2 may also release calcium in response to SR calcium overload, which may occur under pathological conditions such as physical and emotional stress and digitalis toxicity and may be arrhythmogenic.
Previously, we reported that mutations in the gene encoding for RyR2 cause the autosomal dominant form of catecholaminergic polymorphic ventricular tachycardia (CPVT).4 Shortly after our report, other groups identified novel RyR2 mutations in patients affected by CPVT.11 To date 34 RyR2 mutations have been reported in the "Gene Connection for the Heart" mutation database for inherited arrhythmogenic diseases (http://pc4.fsm.it:81/cardmoc).
The first mutation that we identified in an Italian CPVT family lead to the replacement of arginine at position 4497 with a cysteine. Because this mutation was associated with a highly malignant phenotype it has been selected by several authors for their in vitro studies aimed at the functional characterization of RyR2 mutants. Jiang et al6 were the first to investigate the R4496C mouse equivalent of the R4497C human mutation. They suggested that when expressed in HEK293 cells, the mutation enhances the basal channel activity and the propensity for spontaneous calcium release at rest and in response to caffeine. More recently, the same authors further elaborated their results and proposed that the R4496C, as well as other RyR2 mutations identified in CPVT families, increase the sensitivity of RyR2 channels to luminal calcium thus facilitating the spontaneous release of calcium from the SR.5 George et al7 investigated the same mutation by expression in HL-1 cardiac myocytes. At variance with what was suggested by Jiang et at5 based on their studies in HEK 293 cells, George et al7 reported that the R4496C mutant presents no enhancement of basal activity, but they confirmed that after exposure to the RyR agonist caffeine or to beta adrenergic stimulation, calcium release was significantly augmented in the mutant channels. George et al also showed that the dissociation of the FKBP12.6 protein from the mutant was similar to that observed in the WT RyR2 thus challenging the hypothesis advanced by Wehrens et al8 who proposed that the enhanced calcium release observed in the mutant during beta adrenergic stimulation was caused by the excessive dissociation of the RyR2:FKBP12.6 complex. Overall, although disagreement exists on the mechanisms by which the R4496C mutation sensitizes the RyR2 channel to agonists, three independent groups have confirmed that on caffeine and beta adrenergic stimulation RyR2R4496C channels respond with an augmented calcium release.
None of the functional studies performed so far proved that the presence of RyR2R4496C channels is able to induce sustained ectopic activity leading to VT and VF on exposure to the RyR-agonist caffeine or during adrenergic stimulation. The present study fills that gap by showing that polymorphic and even bidirectional VT may be elicited in the RyR2+/RyRR4496C mice under conditions that strictly resemble those eliciting cardiac arrhythmias in CPVT patients. Consistent with the incomplete penetrance of the CPVT phenotype in humans, not all RyR2+/RyRR4496C mice developed arrhythmias. The cause for incomplete penetrance is today the most puzzling aspect of inherited arrhythmogenic diseases and no satisfactory explanation has been provided to account for the major differences in the clinical manifestations observed among affected patients, even when they are members of the same family. Both genetic and environmental factors12 have been advocated to account for this variability but a robust hypothesis supported by experimental data is missing.
We used a single nucleotide primer extension method to perform a relative quantification of allele-specific transcription of the RyR2 gene in the heterozygous mice to investigate if the variability in the pattern of arrhythmias elicited in response to exercise and/or pharmacological challenges correlates with the allele specific transcription of RyR2. When we measured the relative transcription of WT and mutant mRNA in the hearts of the RyR2+/RyRR4496C mice and showed that the mutant mRNA was slightly underrepresented as compared with the WT mRNA, but no differences in the levels of the mutant mRNA were present between the animals that developed arrhythmias and those that remained asymptomatic throughout the provocative tests. It is concluded that the severity of the arrhythmias is not related to the allele-specific transcription of RyR2.
Patients affected by the R4497C mutation appear to have an extremely lethal form of the disease. Cardiac arrest occurred in 7/13 (53%) carriers of the mutation and in 4 patients it was a lethal event. Furthermore VT or VF occurred in 5 patients also during beta-blocker therapy suggesting that the protection afforded by these agents may not be sufficient to prevent life-threatening events in CPVT.2 Treatment with propranolol was not effective in preventing arrhythmias in RyR2+/RyRR4496C mice thus confirming the observation made in humans. Whether the R4496C mutation is particularly resistant to antiadrenergic interventions cannot yet be defined.
In conclusion, the phenotype of the murine model that we have developed presents remarkable similarity with the clinical manifestations of patient carriers of the R4497C mutations in terms of arrhythmias morphology, severity, and the incomplete response to beta blockers. It is expected that this knock-in model will allow us to clarify several yet uncertain aspects of CPVT and may provide a valuable tool for investigating novel treatments for CPVT patients.
| Acknowledgments |
|---|
| Footnotes |
|---|
Original received March 28, 2005; resubmission received April 21, 2005; revised resubmission received April 28, 2005; accepted April 28, 2005.
| References |
|---|
|
|
|---|
2. Priori SG, Napolitano C, Memmi M, Colombi B, Drago F, Gasparini M, DeSimone L, Coltorti F, Bloise R, Keegan R, Cruz Filho FE, Vignati G, Benatar A, DeLogu A. Clinical and molecular characterization of patients with catecholaminergic polymorphic ventricular tachycardia. Circulation. 2002; 106: 6974.
3. Swan H, Piippo K, Viitasalo M, Heikkila P, Paavonen T, Kainulainen K, Kere J, Keto P, Kontula K, Toivonen L. Arrhythmic disorder mapped to chromosome 1q42q43 causes malignant polymorphic ventricular tachycardia in structurally normal hearts. J Am Coll Cardiol. 1999; 34: 20352042.
4. Priori SG, Napolitano C, Tiso N, Memmi M, Vignati G, Bloise R, Sorrentino VV, Danieli GA. Mutations in the cardiac ryanodine receptor gene (hRyR2) underlie catecholaminergic polymorphic ventricular tachycardia. Circulation. 2001; 103: 196200.
5. Jiang D, Xiao B, Yang D, Wang R, Choi P, Zhang L, Cheng H, Chen SR. RyR2 mutations linked to ventricular tachycardia and sudden death reduce the threshold for store-overload-induced Ca2+ release (SOICR). Proc Natl Acad Sci U S A. 2004; 101: 1306213067.
6. Jiang D, Xiao B, Zhang L, Chen SR. Enhanced basal activity of a cardiac Ca2+ release channel (ryanodine receptor) mutant associated with ventricular tachycardia and sudden death. Circ Res. 2002; 91: 218225.
7. George CH, Higgs GV, Lai FA. Ryanodine receptor mutations associated with stress-induced ventricular tachycardia mediate increased calcium release in stimulated cardiomyocytes. Circ Res. 2003; 93: 531540.
8. Wehrens XH, Lehnart SE, Huang F, Vest JA, Reiken SR, Mohler PJ, Sun J, Guatimosim S, Song LS, Rosemblit N, DArmiento JM, Napolitano C, Memmi M, Priori SG, Lederer WJ, Marks AR. FKBP12.6 deficiency and defective calcium release channel (ryanodine receptor) function linked to exercise-induced sudden cardiac death. Cell. 2003; 113: 829840.[CrossRef][Medline] [Order article via Infotrieve]
9. Lande G, Demolombe S, Bammert A, Moorman A, Charpentier F, Escande D. Transgenic mice overexpressing human KvLQT1 dominant-negative isoform. Part II. Pharmacological profile. Cardiovasc Res. 2001; 50: 328334.
10. Tournier I, Raux G, Di Fiore F, Marechal I, Leclerc C, Martin C, Wang Q, Buisine MP, Stoppa-Lyonnet D, Olschwang S, Frebourg T, Tosi M. Analysis of the allele-specific expression of the mismatch repair gene MLH1 using a simple DHPLC-Based Method. Hum Mutat. 2004; 23: 379384.[CrossRef][Medline] [Order article via Infotrieve]
11. Laitinen PJ, Brown KM, Piippo K, Swan H, Devaney JM, Brahmbhatt B, Donarum EA, Marino M, Tiso N, Viitasalo M, Toivonen L, Stephan DA, Kontula K. Mutations of the cardiac ryanodine receptor (RyR2) gene in familial polymorphic ventricular tachycardia. Circulation. 2001; 103: 485490.
12. Priori SG. Inherited Arrhythmogenic diseases: the complexity beyond monogenic disorders. Circ Res. 2004; 94: 140145.
Related Article:
Circ. Res. 2005 96: 1031-1032.
This article has been cited by other articles:
![]() |
T. A. Beery, M. J. Shah, and D. W. Benson Genetic Characterization of Familial CPVT After 30 Years Biol Res Nurs, July 1, 2009; 11(1): 66 - 72. [Abstract] [PDF] |
||||
![]() |
M. Fernandez-Velasco, A. Rueda, N. Rizzi, J.-P. Benitah, B. Colombi, C. Napolitano, S. G. Priori, S. Richard, and A. M. Gomez Increased Ca2+ Sensitivity of the Ryanodine Receptor Mutant RyR2R4496C Underlies Catecholaminergic Polymorphic Ventricular Tachycardia Circ. Res., January 30, 2009; 104(2): 201 - 209. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rizzi, N. Liu, C. Napolitano, A. Nori, F. Turcato, B. Colombi, S. Bicciato, D. Arcelli, A. Spedito, M. Scelsi, et al. Unexpected Structural and Functional Consequences of the R33Q Homozygous Mutation in Cardiac Calsequestrin: A Complex Arrhythmogenic Cascade in a Knock In Mouse Model Circ. Res., August 1, 2008; 103(3): 298 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Liu and S. G. Priori Disruption of calcium homeostasis and arrhythmogenesis induced by mutations in the cardiac ryanodine receptor and calsequestrin Cardiovasc Res, January 15, 2008; 77(2): 293 - 301. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Venetucci, A. W. Trafford, S. C. O'Neill, and D. A. Eisner The sarcoplasmic reticulum and arrhythmogenic calcium release Cardiovasc Res, January 15, 2008; 77(2): 285 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xiao, X. Tian, P. P. Jones, J. Bolstad, H. Kong, R. Wang, L. Zhang, H. J. Duff, A. M. Gillis, S. Fleischer, et al. Removal of FKBP12.6 Does Not Alter the Conductance and Activation of the Cardiac Ryanodine Receptor or the Susceptibility to Stress-induced Ventricular Arrhythmias J. Biol. Chem., November 30, 2007; 282(48): 34828 - 34838. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Jiang, W. Chen, R. Wang, L. Zhang, and S. R. W. Chen Loss of luminal Ca2+ activation in the cardiac ryanodine receptor is associated with ventricular fibrillation and sudden death PNAS, November 13, 2007; 104(46): 18309 - 18314. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. G. Akar The Perfect Storm: Defective Calcium Cycling in Insulated Fibers With Reduced Repolarization Reserve Circ. Res., November 9, 2007; 101(10): 968 - 970. [Full Text] [PDF] |
||||
![]() |
M. Cerrone, S. F. Noujaim, E. G. Tolkacheva, A. Talkachou, R. O'Connell, O. Berenfeld, J. Anumonwo, S. V. Pandit, K. Vikstrom, C. Napolitano, et al. Arrhythmogenic Mechanisms in a Mouse Model of Catecholaminergic Polymorphic Ventricular Tachycardia Circ. Res., November 9, 2007; 101(10): 1039 - 1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. P. Dirksen, V. A. Lacombe, M. Chi, A. Kalyanasundaram, S. Viatchenko-Karpinski, D. Terentyev, Z. Zhou, S. Vedamoorthyrao, N. Li, N. Chiamvimonvat, et al. A mutation in calsequestrin, CASQ2D307H, impairs Sarcoplasmic Reticulum Ca2+ handling and causes complex ventricular arrhythmias in mice Cardiovasc Res, July 1, 2007; 75(1): 69 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. D. J. ter Keurs and P. A. Boyden Calcium and Arrhythmogenesis Physiol Rev, April 1, 2007; 87(2): 457 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Iyer, R. J. Hajjar, and A. A. Armoundas Mechanisms of Abnormal Calcium Homeostasis in Mutations Responsible for Catecholaminergic Polymorphic Ventricular Tachycardia Circ. Res., February 2, 2007; 100(2): e22 - e31. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Kannankeril, B. M. Mitchell, S. A. Goonasekera, M. G. Chelu, W. Zhang, S. Sood, D. L. Kearney, C. I. Danila, M. De Biasi, X. H. T. Wehrens, et al. Mice with the R176Q cardiac ryanodine receptor mutation exhibit catecholamine-induced ventricular tachycardia and cardiomyopathy PNAS, August 8, 2006; 103(32): 12179 - 12184. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Liu, B. Colombi, M. Memmi, S. Zissimopoulos, N. Rizzi, S. Negri, M. Imbriani, C. Napolitano, F. A. Lai, and S. G. Priori Arrhythmogenesis in Catecholaminergic Polymorphic Ventricular Tachycardia: Insights From a RyR2 R4496C Knock-In Mouse Model Circ. Res., August 4, 2006; 99(3): 292 - 298. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fernandez-Velasco, A. M. Gomez, and S. Richard Unzipping RyR2 in adult cardiomyocytes: Getting closer to mechanisms of inherited ventricular arrhythmias? Cardiovasc Res, June 1, 2006; 70(3): 407 - 409. [Full Text] [PDF] |
||||
![]() |
S. E. Lehnart, C. Terrenoire, S. Reiken, X. H. T. Wehrens, L.-S. Song, E. J. Tillman, S. Mancarella, J. Coromilas, W. J. Lederer, R. S. Kass, et al. Stabilization of cardiac ryanodine receptor prevents intracellular calcium leak and arrhythmias PNAS, May 16, 2006; 103(20): 7906 - 7910. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. George, H. Jundi, N. Walters, N. L. Thomas, R. R. West, and F. A. Lai Arrhythmogenic Mutation-Linked Defects in Ryanodine Receptor Autoregulation Reveal a Novel Mechanism of Ca2+ Release Channel Dysfunction Circ. Res., January 6, 2006; 98(1): 88 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Anderson The Fire From Within: The Biggest Ca2+ Channel Erupts and Dribbles Circ. Res., December 9, 2005; 97(12): 1213 - 1215. [Full Text] [PDF] |
||||
![]() |
S. G. Priori and C. Napolitano Intracellular Calcium Handling Dysfunction and Arrhythmogenesis: A New Challenge for the Electrophysiologist Circ. Res., November 25, 2005; 97(11): 1077 - 1079. [Full Text] [PDF] |
||||
![]() |
D. J. Milan and C. A. MacRae Animal models for arrhythmias Cardiovasc Res, August 15, 2005; 67(3): 426 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Houser Can Novel Therapies for Arrhythmias Caused by Spontaneous Sarcoplasmic Reticulum Ca2+ Release be Developed Using Mouse Models? Circ. Res., May 27, 2005; 96(10): 1031 - 1032. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |