| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Centre for Vascular Research, The University of New South Wales, and the Department of Haematology, The Prince of Wales Hospital, Sydney, Australia.
Correspondence to Levon M. Khachigian, PhD, Centre for Vascular Research, Department of Pathology, The University of New South Wales, Sydney NSW 2052, Australia. E-mail L.Khachigian{at}unsw.edu.au
| Abstract |
|---|
|
|
|---|
-receptor, which binds PDGF-A. These findings identify a functional cis-acting element for Ets-1 in the PDGF-A promoter and demonstrate that Sp1 and Ets-1 cooperatively activate PDGF-A transcription in vascular SMCs.
Key Words: Ets-1 smooth muscle cells transcription growth Sp1 autocrine
| Introduction |
|---|
|
|
|---|
but not receptor-ß.9 Somatic cell hybrid chromosome segregation analysis and in situ hybridization studies assigned PDGF-A to chromosome 7 (7p217p22).10,11 Previous studies by our group have revealed that PDGF-A gene expression in SMCs and endothelial cells is under the positive transcriptional control of the zinc finger transcription factors specificity protein 1 (Sp1), Sp3, and early growth response-1 (Egr-1).1215 These transcription factors interact with overlapping nucleotide recognition elements located at bp 71/55 in the proximal region of PDGF-A promoter. Conversely, PDGF-A is repressed by the Wilms tumor suppressor gene product WT-1,16,17 GCF2,18and NF-1(X).19
Ets-1 belongs to the ets gene family, which has been implicated in a variety of biological pathways regulating cell growth, differentiation, and apoptosis. It is defined by a highly conserved DNA-binding domain comprising
85 amino acids recognizing the central core motif 5'GGAA/T3'.20,21 Ets-1, like PDGF-A, is upregulated at exposure to agonists such as serum in vitro2225 and is expressed in injured vasculature.2628 It is also expressed by SMCs in human carotid atherosclerotic lesions.29 However, whether PDGF-A transcription is influenced by Ets-1 is presently unknown.
Here we have identified a functional cis-acting element for Ets-1 in the PDGF A-chain promoter that mediates cooperative activation by Sp1. Gel shift, chromatin immunoprecipitation (ChIP), pull-down, and transient transfection analyses demonstrate that Ets-1 physically and functionally interacts with the PDGF-A promoter. We show that Ets-1 and Sp1 stimulate primary rat aortic SMC growth. This is attributable, at least in part, to Ets-1-dependent autocrine PDGF-A activation of PDGFR-
.
| Materials and Methods |
|---|
|
|
|---|
Plasmid Constructs
Cytomegalovirus (CMV)-Sp1 was obtained from Robert Tjian (Howard Hughes Medical Institute, University of California). p643A-luc, containing 643 bp of the human PDGF-A promoter upstream of Firefly luciferase, was generated in the our laboratory.30 mEts-1-643A-luc plasmid was generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene). Ets-1 cDNA was excised from pKCR3-Ets-1 (a gift from Ian Cassidy, Department of Biochemistry and Molecular Biology, University of Queensland, Australia) and cloned into pcDNA3 (Invitrogen). pKCR3-DN-Ets-1 was generated previously by us.29
Nuclear Extract Preparation and Electrophoretic Mobility Shift Assays
Cells, transfected as indicated, were washed and scraped in 10 mL of cold PBS, pH. 7.4, and transferred to precooled centrifuge tubes. Cells were pelleted by centrifugation at 1200 rpm for 10 minutes at 4°C and lysed by incubation in Solution A (10 mmol/L Hepes, pH 8.0, 1.5 mmol/L MgCl2, 10 mmol/L KCl, 0.5% Nonidet P-40, 1 mmol/L dithiothreitol [DTT], 0.5 mmol/L phenylmethylsulfonyl fluoride [PMSF], 4 µg/mL aprotinin, and 10 µg/mL leupeptin). Samples were spun at 14 000 rpm for 40 seconds. The pellet was resuspended in Solution C (29 mmol/L Hepes, pH 7.9, 1.5 mmol/L MgCl2, 420 mmol/L NaCl, 0.2 mmol/L EDTA, 1 mmol/L DTT, 0.5 mmol/L PMSF, 4 µg/mL aprotinin, and 10 µg/mL leupeptin) and incubated by gently shaking for 20 minutes at 4°C. Supernatants were transferred to precooled microfuge tubes containing an equal volume of Solution D (20 mmol/L Hepes, pH 7.9, 100 mmol/L KCl, 0.2 mmol/L EDTA, 20% glycerol, 1 mmol/L DTT, 0.5 mmol/L PMSF, 4 µg/mL aprotinin, and 10 µg/mL leupeptin) and stored immediately at 80°C until use. Nuclear extracts were incubated with the indicated 32P-labeled double-stranded oligonucleotides (150 000 cpm) in a total volume of 20 µL containing 10 mmol/L Tris-HCl, pH 8.0, 50 mmol/L MgCl2, 1 mmol/L EDTA, 1 mmol/L DTT, 5% glycerol, 1 µg salmon sperm DNA, 5% sucrose, 1 µg of poly(dI.dC), and 1 mmol/L PMSF. The mixture was incubated for 35 minutes at 22°C. In supershift experiments, nuclear extract was incubated with 2 µg of antibody before addition of the probe. Samples were loaded onto 6% nondenaturing polyacrylamide gel electrophoresis and visualized by autoradiography.
Western Blot Analysis
Total cell lysates were resolved by denaturing SDS-PAGE and then transferred into polyvinylidene difluoride membrane (Immobilon; Millipore). The membrane was blocked for 1 hour with 5% skim milk in PBS with 0.05% Tween 20. Ets-1 and Sp1 were detected with appropriate antibodies (1:1000; Santa Cruz Biotechnology) and by chemiluminescence. BSA-PBS-Tween 20 buffer was used for blocking and incubation purposes only when phosphotyrosine monoclonal antibodies (1:1000; BD Transduction Labs) were used.
Reverse Transcription-Polymerase Chain Reaction
Total RNA was extracted using TRIzol reagent (Invitrogen), and cDNA was generated using Superscript II reverse transcriptase (Invitrogen) with random primers according to the instructions of the manufacturer. Polymerase chain reaction (PCR) for PDGF-A was done in 20 µL reaction containing 1 mmol/L MgCl2, 50 µmol/L 2'-deoxynucleoside 5'-triphosphate (dNTP), 0.1 µmol/L primers, 1 µL cDNA, and 1 U of Platinum Taq Polymerase (Invitrogen) using an Applied Biosystem GeneAmp PCR system 2400 (Perkin Elmer). Amplification conditions are as follows: 94°C for 1 minute, 25 cycles of 94°C for 10 seconds, 57°C for 30 seconds, 72°C for 1 minute, and an extension at 72°C for 4 minutes. Sequences of the primers were as follows: forward ratPDGFAf97 5'CCTCCCTGCCGAGCTTC3', reverse ratPDGFAr710 5'CCGTCTCCT CCTCCCGATGGTC3', forward GAPDH 5'ACCACAGTCCATGCCATCAC3' and reverse GAPDH 5'TCCACCACCCTGTTGCTGTA3'. For GAPDH amplification, essentially the same conditions as those of PDGF-A amplification were used except 1.5 mmol/L MgCl2, 21 cycles with annealing temperature of 58°C. The reaction was loaded onto 1.2% agarose gel, and amplicons were visualized by ethidium bromide staining.
Immunohistochemistry
Paraffin-embedded sections of human atherosclerotic lesions were immunostained with rabbit polyclonal antibodies to Ets-1 and Sp1 (Santa Cruz Biotechnology) or PDGF-A (Genzyme) as described previously.31
ChIP Analysis
SMCs seeded into 100-mm Petri dishes were transfected overnight with 20 µg of indicated plasmids. Cells were washed with PBS, pH 7.4, before ChIP19 using the appropriate antibody. PCR was performed in 1 mmol/L MgCl2, 0.1 mmol/L dNTP, 0.1 µmol/L primers, and 1 U Platinum Taq Polymerase (Invitrogen). Cycling conditions were as follows: 94°C for 2 minutes; 40 cycles of 94°C for 30 seconds; 56°C for 10 seconds; and 72°C for 1 minute; and with another extension time of 4 minutes. Rat PDGF-A promoter was amplified using primers ratprom800-1000F 5'GCCAAGAGAGTAAGGGGAGAG3', ratprom800-1000R 5'CGATGTGAAAATCCAGGAAGA3', ratprom500-800F 5'GAGGGGTTAGGGGTCATTGT3', and ratprom500-700R 5'CGAGGGTGGTAAGAGCTTGT3'.
Small Interfering RNA
SMCs were seeded in Petri dishes and growth arrested with serum-free medium 6 hours before transfection with 0.2 µmol/L small interfering RNA (siRNA; Qiagen) targeting endogeneous rat Ets-1 and Sp1. PDGF-A was inducibly expressed by the addition of FBS (Invitrogen) to the final concentration of 10% for 1 hour. Total RNA was extracted using the TrIzol method; cDNA synthesis and RT-PCR were done as mentioned previously in this section. The sequence of siRNA Sp1 targeting nucleotides 418 to 438 (accession No. D12768) was 5'r(GGAACAGAGUGGCAACAGU)d(TT)3' and its corresponding complementary strand 5'r(ACUGUUGCCACUCUGUUCC)d(TT)3'. Nucleotides 1240 to 1260 of the rat Ets-1 (GenBank accession No. L20681.1) was targeted by siRNA with the sequence 5'r(GGACAAGCCUGUCAUUCCU)d(TT)3' and its corresponding complementary strand 5'r(AGGAAUGACAGGCUUGUCC)d(TT)3'. An irrelevant siRNA (Irr siRNA) molecule of identical size (5'r(GCGAGUAGCGCUAGGAAGU)d(TT)3'/5'r(ACUUCCUAGC GCUACUCGC)d(TT)3') was used as a negative control in experiments where indicated.
Immunoprecipitation
Cytoplasmic or nuclear extracts were precleared with Protein G-Sepharose 4 Fast Flow Beads (Amersham) for 2 hours at 4°C before addition of the indicated antibody and gentle shaking overnight at 4°C. Pull-downs were performed using fresh beads during 2 hours with shaking. After sequential washing, SDS loading buffer was added to the beads, boiled, and loaded onto SDS-PAGE.
Total Cell Count
SMCs were seeded into 96-well titer plates and rendered growth quiescent by incubation in serum-free medium for 24 hours. Plasmid transfections were performed using FuGENE6 in medium containing 5% serum 6 hours before addition of neutralizing antibodies to PDGF-A (Genzyme) or rabbit IgG control (Sigma). Cells were quantitated using the automated Coulter Z1 counter (Beckman).
| Results and Discussion |
|---|
|
|
|---|
|
Endogenous Ets-1 Interacts With the 555TTCC552 Motif in the PDGF-A Promoter
Inspection of the PDGF-A promoter revealed a putative reverse Ets binding motif (TTCC) located at bp 555/552 relative to the transcriptional start site.11 To determine whether this element could support an interaction with Ets-1, we performed an electrophoretic mobility shift assay (EMSA) in which we incubated nuclear extracts of SMCs with 32P-Oligo A568/540, a 32P-labeled double-stranded oligonucleotide spanning bp 568/540 in the PDGF-A promoter. This produced several discreet nucleoprotein complexes (Figure 2A, lane 2). However, only 1 of these complexes failed to form when the putative Ets binding motif was mutated from 555TTCC552 to 555TACA552 in probe 32P-Oligo mA568/540 (Figure 2A, lane 4, arrow). Preincubation of the extracts with Ets-1 antibodies reduced formation of this specific complex (Figure 2A).
|
Ets-1 Binds to the Authentic PDGF-A Promoter
To provide confirmatory evidence for the physical interaction of Ets-1 with the endogenous PDGF-A promoter, we performed ChIP analysis using cells that had been transfected with pcDNA3-Ets-1 or pcDNA3, in combination with Ets-1 antibodies. Figure 2B demonstrates that Ets-1 binds to the endogenous PDGF-A promoter in SMCs transfected with pcDNA3. The intensity of the PDGF-A amplicon increased in cells transfected with pcDNA3-Ets-1. That the amplicon, the identity of which was confirmed by sequencing, could no longer be observed in the absence of the Ets-1 antibodies using extracts of cells transfected with either pcDNA3-Ets-1 or the empty expression vector demonstrates that Ets-1 interacts with the authentic PDGF-A promoter.
To provide additional evidence that Ets-1 interacts with the endogenous PDGF-A gene, we performed ChIP analysis with cells transfected with pKCR3-DN-Ets-1 or its backbone control, pKCR3. pKCR3-DN-Ets-1 generates a form of Ets-1 protein bearing only the DNA-binding domain and lacking the transactivation domain,29 thus functioning as a dominant-negative inhibitor of endogenous Ets-1. This mutant also lacks the C-terminal epitope of the Ets-1 antipeptide antibody and therefore should evade pull-down by the Ets-1 antibody. DN-Ets-1 decreased the interaction of endogenous Ets-1 with the PDGF-A promoter (Figure 2C, top). The nucleotide 500 to 700 region of the rat PDGF-A promoter (accession No. L06238)32 does not contain Ets consensus elements (5'GGAA/T3') and therefore should not be pulled down with Ets-1 antibodies and amplified. This region is detected in the input but is not associated with an Ets-1 immunoprecipitate (Figure 2C, bottom).
To ensure that these observations were not an artifact of the Ets-1 antibody, we performed ChIP analysis using epitope-tagged Ets-1 in combination with antibodies to the tag. We transfected SMCs with pGST-Ets-1, which produces the DNA-binding domain of Ets-1 fused to GST. GST antibodies pulled down the authentic PDGF-A promoter in pGST-Ets-1 transfectants (Figure 2D) but not in GST-negative pcDNA3 transfectants (Figure 2D). These findings provide further evidence, independently of Ets-1 antibodies, that Ets-1 physically binds the endogenous PDGF-A promoter.
Mutation of the 555TTCC552 Motif Lowers Basal and Ets-1-Inducible PDGF-A Promoter Activity
To determine the functional importance of the 555TTCC552 element in PDGF-A promoter, we cotransfected pcDNA3-Ets-1 with p643A-luc(555TACA552), in which 555TTCC552 had been mutated to 555TACA552. This mutation significantly reduced basal activity of the PDGF-A promoter (Figure 3A), consistent with observations that Ets-1 is required for basal expression of certain other target genes.33 Ets-1, as expected, activated the wild-type PDGF-A promoter (Figure 3A). However, the mutant PDGF-A promoter failed to respond to Ets-1 (Figure 3A). Thus, introduction of a mutation in the PDGF-A promoter that ablates Ets-1 nucleoprotein complex formation compromised Ets-1 induction of the promoter. To complement these findings, we cotransfected SMCs with p643A-luc together with pKCR3-DN-Ets-1 or its backbone control, pKCR3. Unlike activation of PDGF-A promoter-dependent expression by wild-type Ets-1, this mutant form of Ets-1 failed to stimulate the promoter and even reduced basal promoter activity (Figure 3B).
|
Ets-1 Activates PDGF-A Transcription Cooperatively With Sp1
We demonstrated previously that Ets-1 and Sp1 physically interact and cooperatively activate the FasL promoter in the spontaneously transformed WKY12-22 (pup rat-derived) SMC line.29 To our knowledge, Ets-1/Sp1 interaction and cooperativity has not been demonstrated in SMCs. We had also established the existence of a functional cis-acting element for Sp1 in the proximal region (located at 71/55) of the PDGF-A promoter.12 We hypothesized that Ets-1 and Sp1 together may activate the PDGF-A promoter in a cooperative manner, a mechanism hitherto not demonstrated in the context of any PDGF gene. Immunoprecipitation of nuclear extracts with polyclonal Sp1 antibodies followed by Western blot analysis with Ets-1 antibodies revealed that endogenous Ets-1 and Sp1 physically interact (Figure 4A). Conversely, precipitation with polyclonal Ets-1 antibodies followed by Western analysis with Sp1 antibodies further confirmed the interaction (Figure 4B). Immunohistochemical analyses using these antibodies indicate that Ets-1 and Sp1 are expressed together with PDGF-A in human atherosclerotic lesions (Figure 4C).
|
Overexpression of Sp1 alone increased PDGF-A promoter-dependent expression by almost 3-fold (Figure 5). However, Sp1 failed to activate the promoter when the Ets binding site had been mutated (Figure 5). The promoter was induced 6-fold when Ets-1 and Sp1 were coexpressed with the wild-type PDGF-A promoter-reporter construct (Figure 6A). Ets-1 activation of PDGF-A transcription was blocked by construct pEBG-DN-Sp1 (Figure 6B), which generates a mutant form of Sp1 containing only the DNA-binding domain. This dominant-negative form of Sp1 reduced cooperative activation of PDGF-A promoter-dependent expression with Ets-1 (Figure 6B, compare bars 6 and 7). That Ets-1-inducible PDGF-A transcription is blocked by siRNA targeting Sp1 and Ets-1 (Figure 6C) but not by an Irr siRNA molecule of identical size and concentration (Figure 6C) strengthens the evidence for cooperative Ets-1/Sp1 transactivation of the PDGF-A promoter.
|
|
We used siRNA to Ets-1 to provide further evidence for the positive regulatory role of endogenous Ets-1 in the regulation of PDGF-A gene expression. Ets-1 siRNA inhibited serum-inducible PDGF-A mRNA levels within 6 hours of transfection (data not shown). siRNA targeting Sp1, which we demonstrated previously, plays a critical role in PDGF-A transcription-12 abrogated serum-inducible PDGF-A expression. To demonstrate that a defined agonist can induce PDGF-A transcription via an Ets-1/Sp1-dependent mechanism, we used PDGF-BB, which stimulates Ets-1 expression in SMCs.34,35 PDGF-BB-inducible PDGF-A mRNA expression was inhibited by Ets-1 siRNA and Sp1 siRNA (Figure 6D) but not the Irr siRNA (Figure 6D).
Ets-1 and Sp1 Stimulate Primary Rat Aortic SMC Proliferation: Mitogenesis Is Blocked by Neutralizing PDGF-A Antibodies
Flow cytometric analysis and Coulter quantitation demonstrate that Sp1 and Ets-1 each increase both S-phase entry (Figure 7A) and total cell counts (Figure 7B) compared with their backbone control. Proliferation stimulated by Ets-1 together with Sp1 was blocked when Ets-1 was cotransfected with mutant Sp1 or when Sp1 was cotransfected with mutant Ets-1 (Figure 7B). Ets-1-inducible SMC proliferation is inhibited by Sp1 siRNA and Ets-1 siRNA (Figure 7C) but not by the Irr siRNA (Figure 7C). Conversely, Sp1-inducible SMC proliferation is blocked by Ets-1 siRNA and Sp1 siRNA (Figure 7C). Ets-1-inducible SMC mitogenesis is blocked using neutralizing PDGF-A antibodies but not species-matched and isotype-matched IgG (Figure 7D).
|
The autocrine mitogenic effect of PDGF-A on Ets-1 overexpression was further supported by immunoprecipitation experiments in which PDGFR-
was pulled down from total cell lysates followed by Western blot analysis with phosphotyrosine antibodies. Although PDGFR-
was expressed in SMCs transfected with the empty vector, it was inactive (Figure 7E). In contrast, tyrosine-phosphorylated PDGFR-
was readily detectable in cells expressing Ets-1 without a change in total levels of PDGFR-
protein (Figure 7E).
Using a variety of approaches, including EMSA, ChIP, immunoprecipitation, and transient transfection analysis, this study provides the first demonstration that Ets-1 binds and activates the PDGF-A promoter. Confirmatory evidence was provided by dominant- negative siRNA and epitope-tagged approaches. Ets-1 binds to a distinct motif (TTCC) in the PDGF-A promoter located at bp 555/552, a core Ets element in reverse. The integrity of this site is critical for Ets-1 binding and induction of PDGF-A expression. It is also required for cooperative Ets-1 and Sp1 activation of the promoter. Ets-1 activation of the PDGF-A promoter also requires an intact Sp1 binding site in the core region. These in vitro studies, which provide key insights into the role of Ets-1/Sp1 cooperativity in PDGF-A transcription, would be complemented by whole animal analyses in transgenic mice bearing PDGF-A promoter mutations in the Ets and/or Sp1 elements.
Gene expression is controlled in part at the level of transcription by the complex interplay of positive and negative regulatory factors. We and others have demonstrated that multiple such nuclear factors interact with and regulate the PDGF-A promoter. These include Egr-1 and Sp3,1215 WT-1,16,17 GCF2,18,19 BTEB236 NF-1(X),18,19 Sp1,12 and, as reported here, Ets-1. Whether Ets-1 cooperates with these other factors, as we show here it does with Sp1, to control PDGF-A transcription remains to be seen. The 2 CArG elements (putative SRF-binding motifs) in the vicinity of the 524TTCC521 element (532CCTTTTATG524 and 551CAAAG547) suggest the possibility of SRF/Ets cooperativity.
We have demonstrated here that Ets-1 and Sp1 stimulate the proliferation of early passage primary rat aortic SMCs. We have shown previously that Ets-1 inhibits apoptosis in these cells.37 The influence of Sp1 overexpression on SMC phenotype may depend on the amount of plasmid used and previous growth-arrest because previous studies by our group have revealed that Sp1 inhibits SMC growth on transfection with 2- to 3-fold more of the Sp1 expression vector without previous growth-arrest. The present findings indicating cooperative Ets-1/Sp1 upregulation of PDGF-A expression in SMCs extend the scope of functional Ets-1/Sp1 interactions into cell growth. That Sp1, Ets-1, and PDGF-A are coexpressed in human atherosclerotic lesions and because Ets-124,28 but not Sp138 is inducibly expressed in SMCs after arterial injury suggests a role for Ets-1/Sp1 cooperativity in the process of neointimal thickening.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. LaRochelle WJ, Jeffers M, McDonald WF, Chillakuru RA, Giese NA, Lokker NA, Sullivan C, Boldog FL, Yang M, Vernet C, Burgess CE, Fernandes E, Deegler LL, Rittman B, Shimkets J, Shimkets RA, Rothberg JM, Lichenstein HS. PDGF-D, a new protease-activated growth factor. Nat Cell Biol. 2001; 3: 517521.[CrossRef][Medline] [Order article via Infotrieve]
3. Li X, Porten A, Aase K, Karlsson L, Abramsson A, Uutela M, Backstrom G, Hellstrom M, Bostrom H, Li H, Soriano P, Betsholtz C, Heldin C-H, Alitalo K, Ostman A, Eriksson U. PDGF-C is a new protease-activated ligand for the PDGF alpha receptor. Nat Cell Biol. 2000; 2: 302309.[CrossRef][Medline] [Order article via Infotrieve]
4. Betsholtz C, Karlsson L, Lindahl P. Developmental roles of platelet-derived growth factors. BioEssays. 2001; 23: 494507.[CrossRef][Medline] [Order article via Infotrieve]
5. Majesky MW, Benditt EP, Schwartz SM. Expression and developmental control of platelet-derived growth factor A-chain and B-chain/Sis genes in rat aortic smooth muscle cells. Proc Natl Acad Sci U S A. 1988; 85: 15241528.
6. Libby P, Warner SJ, Salomon RN, Birinyi LK. Production of platelet-derived growth factor-like mitogen by smooth-muscle cells from human atheroma. N Engl J Med. 1988; 318: 14931498.[Abstract]
7. Barrett TB, Benditt EP. Platelet-derived growth factor gene expression in human atherosclerotic plaques and normal artery wall. Proc Natl Acad Sci U S A. 1988; 85: 28102814.
8. Ueda M, Becker AE, Kasayuki N, Kojima, Morita Y, Tanaka S. In situ detection of platelet-derived growth factor-A and -B chain mRNA in human coronary arteries after percutaneous transluminal coronary angioplasty. Am J Pathol. 1996; 149: 831843.[Abstract]
9. Heldin C-H, Backstrom G, Ostman A, Hammacher A, Ronnstrand L, Rubin K, Nister M, Westermark B. Binding of different dimeric forms of PDGF to human fibroblasts: evidence for two separate receptor types. EMBO J. 1988; 7: 13871393.[Medline] [Order article via Infotrieve]
10. Betsholtz C, Johnsson A, Heldin C-H, Westermark B, Lind P, Urdea MS, Eddy R, Shows TB, Philpott K, Mellor AL, Knott TJ, Scott J. cDNA sequence and chromosomal localization of human platelet-derived growth factor A-chain and its expression in tumor cell lines. Nature. 1986; 320: 695699.[CrossRef][Medline] [Order article via Infotrieve]
11. Bonthron DT, Morton CC, Orkin SH, Collins T. Platelet-derived growth factor A chain: gene structure, chromosomal location, and basis for alternative mRNA splicing. Proc Natl Acad Sci U S A. 1988; 85: 14921496.
12. Khachigian LM, Williams AJ, Collins T. Interplay of Sp1 and Egr-1 in the proximal platelet-derived growth factor A-chain promoter in cultured vascular endothelial cells. J Biol Chem. 1995; 270: 2767927686.
13. Khachigian LM, Anderson KA, Halnon NJ, Resnick N, Gimbrone Ma, Collins T. Egr-1 is activated in endothelial cells exposed to fluid shear stress and interacts with a novel shear-stress response element in the PDGF A-chain promoter. Arterioscler Thromb Vasc Biol. 1997; 17: 22802286.
14. Delbridge GJ, Khachigian LM. FGF-1-induced platelet-derived growth factor-A chain gene expression in endothelial cells involves transcriptional activation by early growth response factor-1. Circ Res. 1997; 81: 282288.
15. Silverman ES, Khachigian, LM, Lindner V, Williams AJ, Collins T. Inducible PDGF-A chain transcription in smooth muscle cells is mediated by Egr-1 displacement of Sp1 and Sp3. Am J Physiol. 1997; 273: H1415H1426.[Medline] [Order article via Infotrieve]
16. Gashler AL, Bonthron DT, Madden SL, Rauscher FJ, Collins T, Sukhatme VP. Human platelet-derived growth factor A chain is transcriptionally repressed by the Wilms tumor suppressor WT1. Proc Natl Acad Sci U S A. 1992; 89: 1098410988.
17. Wang ZY, Madden SL, Deuel TF, Rauscher FJ. The Wilms tumor gene product, WT-1, represses transcription of the platelet-derived growth factor A-chain gene. J Biol Chem. 1992; 267: 2199922002.
18. Khachigian LM, Santiago FS, Rafty LA, Chan LW, Delbridge GJ, Bobik A, Collins T, Johnson AC. GC factor 2 represses platelet-derived growth factor A-chain gene transcription and is itself induced by arterial injury. Circ Res. 1999; 84: 12581267.
19. Rafty LA, Santiago FS, Khachigian LM. NF1/X represses PDGF A-chain transcription by interacting with Sp1 and antagonizing Sp1 occupancy of the promoter. EMBO J. 2002; 21: 334343.[CrossRef][Medline] [Order article via Infotrieve]
20. Karim FD, Urness LD, Thummel CS, Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki RA, Gunther CV, Nye JA. The ETS-domain: a new DNA-binding motif that recognizes a purine-rich core DNA sequence. Genes Dev. 1990; 4: 14511453.
21. Woods DB, Ghysdael J, Owen MJ. Identification of nucleotide preferences in DNA sequences recognized specifically by c-Ets-1 protein. Nucleic Acids Res. 1992; 20: 699704.
22. Iwasaka C, Tanaka K, Abe M, Sato Y. Ets-1 regulates angio-genesis by inducing the expression of urokinase-type plasminogen activator and matrix mettaloproteinase-1 and the migration of vascular endothelial cells. J Cell Physiol. 1996; 169: 522531.[CrossRef][Medline] [Order article via Infotrieve]
23. Naito S, Shimizu S, Maeda S, Wang J, Paul R, Fagin JA. Ets-1 is an early response gene activated by ET-1 and PDGF-BB in vascular smooth muscle cells. Am J Physiol. 1998; 274: C472C480.[Medline] [Order article via Infotrieve]
24. Tanaka K, Oda N, Iwasaka C, Abe M, Sato Y. Induction of Ets-1 in endothelial cells during reendothelialization after denuding injury. J Cell Physiol. 1998; 176: 235244.[CrossRef][Medline] [Order article via Infotrieve]
25. Watabe T, Yoshida K, Shindoh M, Kaya M, Fujikawa K, Sato H, Seiki M, Ishii S, Fujinaga K. The Ets-1 and Ets-2 transcription factors activate the promoters for invasion-associated urokinase and collagenase genes in response to epidermal growth factor. Int J Cancer. 1998; 77: 128137.[CrossRef][Medline] [Order article via Infotrieve]
26. Goetze S, Kintscher U, Kim S, Meehan WP, Kaneshiro K, Collins AR, Fleck E, Hsueh WA, Law RE. Peroxisome proliferator-activated receptor-gamma ligands inhibit nuclear but not cytosolic extracellular signal-regulated kinase/mitogen-activated protein kinase-regulated steps in vascular smooth muscle cell migration. J Cardiovasc Pharmacol. 2001; 38: 909921.[CrossRef][Medline] [Order article via Infotrieve]
27. Hultgardh-Nilsson A, Lovdahl C, Blomgren K, Kallin B, Thyberg J. Expression of phenotype- and proliferation-related genes in rat aortic smooth muscle cells in primary culture. Cardiovasc Res. 1997; 34: 418430.[CrossRef][Medline] [Order article via Infotrieve]
28. Hultgardh-Nilsson A, Cercek B, Wang S, Naito S, Lovdahl C, Sharifi B, Forrester JS, Fagin JA. Regulated expression of the ets-1 transcription factor in vascular smooth muscle cells in vivo and in vitro. Circ Res. 1996; 78: 589595.
29. Kavurma MM, Bobryshev Y, Khachigian LM. Ets-1 positively regulates Fas ligand transcription via cooperative interaction with Sp1. J Biol Chem. 2002; 277: 3624436252.
30. Day FL, Rafty LA, Chesterman CN, Khachigian LM. Angiotensin II (ATII)-inducible platelet-derived growth factor A-chain gene expression is p42/44 extracellular signal-regulated kinase-1/2 and egr-1-dependent and mediated via the ATii type 1 but not type 2 receptor. J Biol Chem. 1999; 274: 2372623733.
31. Santiago FS, Lowe HC, Bobryshev YV, Khachigian LM. Induction of the transcriptional repressor Yin Yang-1 by vascular cell injury: autocrine/paracrine role of endogenous fibroblast growth factor-2. J Biol Chem. 2001; 276: 4114341149.
32. Xia Y, Feng L, Tang WW, Wilson CB. Cloning and expression of rat platelet-derived growth factor A-chain. J Am Soc Nephrol. 1992; 3: 622.
33. Lindner V, Giachelli CM, Schwartz SM, Reidy MA. A subpopulation of smooth muscle cells in injured rat arteries expresses platelet-derived growth factor-B chain mRNA. Circ Res. 1995; 76: 951957.
34. Naito S, Shimizu S, Maeda S, Wang J, Paul R, Fagin JA. Ets-1 is an early response gene activated by ET-1 and PDGF-BB in vascular smooth muscle cells. Am J Physiol. 1998; 274: C472C480.[Medline] [Order article via Infotrieve]
35. Dandre F, Owens GK. Platelet-derived growth factor-BB and Ets-1 transcription factor negatively regulate transcription of multiple smooth muscle differentiation marker genes. Am J Physiol Heart Circ Physiol. 2004; 286: H2042H2051.
36. Aizawa K, Suzuki T, Kada N, Ishihara A, Kawai-Kowase K, Matsumura T, Sasaki K, Munemasa Y, Manabe I, Kurabayashi M, Collins T, Nagai R. Regulation of platelet-derived growth factor-A chain by Kruppel-like factor 5: new pathway of cooperative activation with nuclear factor-kappaB. J Biol Chem. 2004; 279: 7076.
37. Zhang C, Kavurma MM, Khachigian LM. Ets-1 protects vascular smooth muscle cells from undergoing apoptosis by activating p21WAF1/Cip1: Ets-1 regulates basal and inducible p21WAF1/Cip 1 transcription via distinct cis-acting elements in the p21WAF/Cip 1 promoter. J Biol Chem. 2003; 278: 2790327909.
38. Khachigian LM, Fahmy RG, Zhang G, Bobryshev YV, Kaniaros A. c-Jun regulates vascular smooth muscle cell growth and neointima formation after arterial injury: inhibition by a novel DNAzyme targeting c-Jun. J Biol Chem. 2002; 277: 2298522991.
This article has been cited by other articles:
![]() |
R. A. Deaton, Q. Gan, and G. K. Owens Sp1-dependent activation of KLF4 is required for PDGF-BB-induced phenotypic modulation of smooth muscle Am J Physiol Heart Circ Physiol, April 1, 2009; 296(4): H1027 - H1037. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.-C. Lo, T.-M. Lin, L.-H. Chou, S.-L. Liu, L.-W. Wu, G.-Y. Shi, H.-L. Wu, and M. J. Jiang Ets-1 mediates platelet-derived growth factor-BB-induced thrombomodulin expression in human vascular smooth muscle cells Cardiovasc Res, March 1, 2009; 81(4): 771 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, M. Q. Hassan, R.-L. Xie, J. R. Hawse, T. C. Spelsberg, M. Montecino, J. L. Stein, J. B. Lian, A. J. van Wijnen, and G. S. Stein Co-stimulation of the Bone-related Runx2 P1 Promoter in Mesenchymal Cells by SP1 and ETS Transcription Factors at Polymorphic Purine-rich DNA Sequences (Y-repeats) J. Biol. Chem., January 30, 2009; 284(5): 3125 - 3135. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Perez Sastre, S. Grossmann, H. P. Reusch, and M. Schaefer Requirement of an Intermediate Gene Expression for Biphasic ERK1/2 Activation in Thrombin-stimulated Vascular Smooth Muscle Cells J. Biol. Chem., September 19, 2008; 283(38): 25871 - 25878. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. Malabanan, P. Kanellakis, A. Bobik, and L. M. Khachigian Activation Transcription Factor-4 Induced by Fibroblast Growth Factor-2 Regulates Vascular Endothelial Growth Factor-A Transcription in Vascular Smooth Muscle Cells and Mediates Intimal Thickening in Rat Arteries Following Balloon Injury Circ. Res., August 15, 2008; 103(4): 378 - 387. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Pearse, R.-X. Tian, J. Nigro, J. B. Iorgulescu, L. Puzis, and E. A. Jaimes Angiotensin II increases the expression of the transcription factor ETS-1 in mesangial cells Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1094 - F1100. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sun, M. E. Diamond, A. J. Ottaviano, M. J. Joseph, V. Ananthanarayan, and H. G. Munshi Transforming Growth Factor-{beta}1 Promotes Matrix Metalloproteinase-9-Mediated Oral Cancer Invasion through Snail Expression Mol. Cancer Res., January 1, 2008; 6(1): 10 - 20. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Crook, M. Olive, H.-H. Xue, T. H. Langenickel, M. Boehm, W. J. Leonard, and E. G. Nabel GA-binding protein regulates KIS gene expression, cell migration, and cell cycle progression FASEB J, January 1, 2008; 22(1): 225 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jiang, Y. Wei, J. Shen, D. Liu, X. Chen, J. Zhou, H. Zong, X. Yun, X. Kong, S. Zhang, et al. Functional Interaction of E1AF and Sp1 in Glioma Invasion Mol. Cell. Biol., December 15, 2007; 27(24): 8770 - 8782. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sato and K. Furukawa Sequential Action of Ets-1 and Sp1 in the Activation of the Human beta-1,4-Galactosyltransferase V Gene Involved in Abnormal Glycosylation Characteristic of Cancer Cells J. Biol. Chem., September 21, 2007; 282(38): 27702 - 27712. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Oettgen Regulation of Vascular Inflammation and Remodeling by ETS Factors Circ. Res., November 24, 2006; 99(11): 1159 - 1166. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nakatsuka, T. Sokabe, K. Yamamoto, Y. Sato, K. Hatakeyama, A. Kamiya, and J. Ando Shear stress induces hepatocyte PAI-1 gene expression through cooperative Sp1/Ets-1 activation of transcription Am J Physiol Gastrointest Liver Physiol, July 1, 2006; 291(1): G26 - G34. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y. Liu, M. Eyries, C. Zhang, F. S. Santiago, and L. M. Khachigian Inducible platelet-derived growth factor D-chain expression by angiotensin II and hydrogen peroxide involves transcriptional regulation by Ets-1 and Sp1 Blood, March 15, 2006; 107(6): 2322 - 2329. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Bonello, Y. V. Bobryshev, and L. M. Khachigian Peroxide-Inducible Ets-1 Mediates Platelet-Derived Growth Factor Receptor-{alpha} Gene Transcription in Vascular Smooth Muscle Cells Am. J. Pathol., October 1, 2005; 167(4): 1149 - 1159. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |