Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2004;95:479-487
Published online before print August 5, 2004, doi: 10.1161/01.RES.0000141135.36279.67
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
95/5/479    most recent
01.RES.0000141135.36279.67v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Santiago, F. S.
Right arrow Articles by Khachigian, L. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Santiago, F. S.
Right arrow Articles by Khachigian, L. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Related Collections
Right arrow Gene expression
Right arrow Gene regulation
Right arrow Growth factors/cytokines
(Circulation Research. 2004;95:479.)
© 2004 American Heart Association, Inc.


Molecular Medicine

Ets-1 Stimulates Platelet-Derived Growth Factor A-Chain Gene Transcription and Vascular Smooth Muscle Cell Growth via Cooperative Interactions With Sp1

Fernando S. Santiago, Levon M. Khachigian

From the Centre for Vascular Research, The University of New South Wales, and the Department of Haematology, The Prince of Wales Hospital, Sydney, Australia.

Correspondence to Levon M. Khachigian, PhD, Centre for Vascular Research, Department of Pathology, The University of New South Wales, Sydney NSW 2052, Australia. E-mail L.Khachigian{at}unsw.edu.au


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults and Discussion
down arrowReferences
 
The platelet-derived growth factor (PDGF) family of ligands (composed of A-, B-, C-, and D-chains), potent mitogens, and chemoattractants for cells of mesenchymal origin has been implicated in numerous vascular pathologies involving smooth muscle cell (SMC) hyperplasia. Understanding the molecular mechanisms mediating PDGF transcription would provide new insights into strategies to control PDGF-dependent pathophysiologic processes. We demonstrated previously that PDGF-A expression is under the positive regulatory influence of Sp1, Sp3, and Egr-1 and is negatively controlled by GCF2, NF-1(X), and WT-1. In this article, we demonstrate that Ets-1 induces PDGF-A expression in primary rat aortic SMCs at the level of transcription and mRNA expression. Electrophoretic mobility shift, supershift, and mutational analyses revealed a functional role for the –555TTCC–552 motif in the PDGF-A promoter that binds endogenous Ets-1. Chromatin immunoprecipitation analysis showed the interaction of endogenous and exogenous Ets-1 or glutathione S-transferase-tagged Ets-1, bearing only the DNA-binding domain with the authentic PDGF-A promoter. Conversely, dominant-negative mutant of Ets-1 blocked the promoter interaction of endogenous Ets-1. Overexpression of Ets-1 but not the mutant form of Ets-1 activates the PDGF-A promoter cooperatively with Sp1. Sp1, which interacts with Ets-1, failed to induce PDGF-A promoter-dependent expression if the promoter contained a site-specific mutation in this novel Ets-binding site. Small interfering RNA to Ets-1 and Sp1 blocked PDGF-BB- and serum-inducible PDGF-A expression. SMC growth was stimulated by Ets-1 and Sp1 separately and further increased by both factors together. Ets-1-inducible mitogenesis is blocked by antibodies neutralizing PDGF-A and involves activation of the PDGF {alpha}-receptor, which binds PDGF-A. These findings identify a functional cis-acting element for Ets-1 in the PDGF-A promoter and demonstrate that Sp1 and Ets-1 cooperatively activate PDGF-A transcription in vascular SMCs.


Key Words: Ets-1 • smooth muscle cells • transcription • growth • Sp1 • autocrine


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults and Discussion
down arrowReferences
 
Platelet-derived growth factors (PDGFs), the family of which comprises A-, B-, C- and D-chains,1–3 are potent mitogens and chemoattractants implicated in various vascular pathologic settings.4 For example, PDGF-A is expressed by smooth muscle cells (SMCs) after balloon injury5,6 and in human atherosclerotic7 and restenotic lesions after percutaneous transluminal coronary angioplasty.8 Of the 2 high-affinity PDGF receptors (PDGFRs), PDGF-A binds to PDGFR-{alpha} but not receptor-ß.9 Somatic cell hybrid chromosome segregation analysis and in situ hybridization studies assigned PDGF-A to chromosome 7 (7p21–7p22).10,11 Previous studies by our group have revealed that PDGF-A gene expression in SMCs and endothelial cells is under the positive transcriptional control of the zinc finger transcription factors specificity protein 1 (Sp1), Sp3, and early growth response-1 (Egr-1).12–15 These transcription factors interact with overlapping nucleotide recognition elements located at bp –71/–55 in the proximal region of PDGF-A promoter. Conversely, PDGF-A is repressed by the Wilms’ tumor suppressor gene product WT-1,16,17 GCF2,18and NF-1(X).19

Ets-1 belongs to the ets gene family, which has been implicated in a variety of biological pathways regulating cell growth, differentiation, and apoptosis. It is defined by a highly conserved DNA-binding domain comprising {approx}85 amino acids recognizing the central core motif 5'GGAA/T3'.20,21 Ets-1, like PDGF-A, is upregulated at exposure to agonists such as serum in vitro22–25 and is expressed in injured vasculature.26–28 It is also expressed by SMCs in human carotid atherosclerotic lesions.29 However, whether PDGF-A transcription is influenced by Ets-1 is presently unknown.

Here we have identified a functional cis-acting element for Ets-1 in the PDGF A-chain promoter that mediates cooperative activation by Sp1. Gel shift, chromatin immunoprecipitation (ChIP), pull-down, and transient transfection analyses demonstrate that Ets-1 physically and functionally interacts with the PDGF-A promoter. We show that Ets-1 and Sp1 stimulate primary rat aortic SMC growth. This is attributable, at least in part, to Ets-1-dependent autocrine PDGF-A activation of PDGFR-{alpha}.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults and Discussion
down arrowReferences
 
Transfections and Luciferase Assays
Early-passage (used between passages 2 and 6) primary rat aortic SMCs were obtained from Cell Applications, Inc. and maintained in Waymouth’s medium (Life Technologies), pH 7.4, and supplemented with 1 mmol/L L-glutamine (Invitrogen), 10 U/mL penicillin, 10 µg/mL streptomycin, and 10% FBS at 37°C in a humidified atmosphere of 5% CO2. Transient transfections were performed with cells at 60% to 70% confluence with indicated constructs and 1 µg of the internal control plasmid pRL-TK (Renilla luciferase driven by the thymidine kinase promoter) using FuGENE6 transfection agent (Roche Molecular Biochemicals). Luciferase activity was measured 24 hours after transfection using the Dual Luciferase Assay System (Promega). Firefly luciferase activity was normalized with Renilla luciferase generated by pRL-TK to correct for transfection efficiency.

Plasmid Constructs
Cytomegalovirus (CMV)-Sp1 was obtained from Robert Tjian (Howard Hughes Medical Institute, University of California). p643A-luc, containing 643 bp of the human PDGF-A promoter upstream of Firefly luciferase, was generated in the our laboratory.30 mEts-1-643A-luc plasmid was generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene). Ets-1 cDNA was excised from pKCR3-Ets-1 (a gift from Ian Cassidy, Department of Biochemistry and Molecular Biology, University of Queensland, Australia) and cloned into pcDNA3 (Invitrogen). pKCR3-DN-Ets-1 was generated previously by us.29

Nuclear Extract Preparation and Electrophoretic Mobility Shift Assays
Cells, transfected as indicated, were washed and scraped in 10 mL of cold PBS, pH. 7.4, and transferred to precooled centrifuge tubes. Cells were pelleted by centrifugation at 1200 rpm for 10 minutes at 4°C and lysed by incubation in Solution A (10 mmol/L Hepes, pH 8.0, 1.5 mmol/L MgCl2, 10 mmol/L KCl, 0.5% Nonidet P-40, 1 mmol/L dithiothreitol [DTT], 0.5 mmol/L phenylmethylsulfonyl fluoride [PMSF], 4 µg/mL aprotinin, and 10 µg/mL leupeptin). Samples were spun at 14 000 rpm for 40 seconds. The pellet was resuspended in Solution C (29 mmol/L Hepes, pH 7.9, 1.5 mmol/L MgCl2, 420 mmol/L NaCl, 0.2 mmol/L EDTA, 1 mmol/L DTT, 0.5 mmol/L PMSF, 4 µg/mL aprotinin, and 10 µg/mL leupeptin) and incubated by gently shaking for 20 minutes at 4°C. Supernatants were transferred to precooled microfuge tubes containing an equal volume of Solution D (20 mmol/L Hepes, pH 7.9, 100 mmol/L KCl, 0.2 mmol/L EDTA, 20% glycerol, 1 mmol/L DTT, 0.5 mmol/L PMSF, 4 µg/mL aprotinin, and 10 µg/mL leupeptin) and stored immediately at –80°C until use. Nuclear extracts were incubated with the indicated 32P-labeled double-stranded oligonucleotides (150 000 cpm) in a total volume of 20 µL containing 10 mmol/L Tris-HCl, pH 8.0, 50 mmol/L MgCl2, 1 mmol/L EDTA, 1 mmol/L DTT, 5% glycerol, 1 µg salmon sperm DNA, 5% sucrose, 1 µg of poly(dI.dC), and 1 mmol/L PMSF. The mixture was incubated for 35 minutes at 22°C. In supershift experiments, nuclear extract was incubated with 2 µg of antibody before addition of the probe. Samples were loaded onto 6% nondenaturing polyacrylamide gel electrophoresis and visualized by autoradiography.

Western Blot Analysis
Total cell lysates were resolved by denaturing SDS-PAGE and then transferred into polyvinylidene difluoride membrane (Immobilon; Millipore). The membrane was blocked for 1 hour with 5% skim milk in PBS with 0.05% Tween 20. Ets-1 and Sp1 were detected with appropriate antibodies (1:1000; Santa Cruz Biotechnology) and by chemiluminescence. BSA-PBS-Tween 20 buffer was used for blocking and incubation purposes only when phosphotyrosine monoclonal antibodies (1:1000; BD Transduction Labs) were used.

Reverse Transcription-Polymerase Chain Reaction
Total RNA was extracted using TRIzol reagent (Invitrogen), and cDNA was generated using Superscript II reverse transcriptase (Invitrogen) with random primers according to the instructions of the manufacturer. Polymerase chain reaction (PCR) for PDGF-A was done in 20 µL reaction containing 1 mmol/L MgCl2, 50 µmol/L 2'-deoxynucleoside 5'-triphosphate (dNTP), 0.1 µmol/L primers, 1 µL cDNA, and 1 U of Platinum Taq Polymerase (Invitrogen) using an Applied Biosystem GeneAmp PCR system 2400 (Perkin Elmer). Amplification conditions are as follows: 94°C for 1 minute, 25 cycles of 94°C for 10 seconds, 57°C for 30 seconds, 72°C for 1 minute, and an extension at 72°C for 4 minutes. Sequences of the primers were as follows: forward ratPDGFAf97 5'CCTCCCTGCCGAGCTTC3', reverse ratPDGFAr710 5'CCGTCTCCT CCTCCCGATGGTC3', forward GAPDH 5'ACCACAGTCCATGCCATCAC3' and reverse GAPDH 5'TCCACCACCCTGTTGCTGTA3'. For GAPDH amplification, essentially the same conditions as those of PDGF-A amplification were used except 1.5 mmol/L MgCl2, 21 cycles with annealing temperature of 58°C. The reaction was loaded onto 1.2% agarose gel, and amplicons were visualized by ethidium bromide staining.

Immunohistochemistry
Paraffin-embedded sections of human atherosclerotic lesions were immunostained with rabbit polyclonal antibodies to Ets-1 and Sp1 (Santa Cruz Biotechnology) or PDGF-A (Genzyme) as described previously.31

ChIP Analysis
SMCs seeded into 100-mm Petri dishes were transfected overnight with 20 µg of indicated plasmids. Cells were washed with PBS, pH 7.4, before ChIP19 using the appropriate antibody. PCR was performed in 1 mmol/L MgCl2, 0.1 mmol/L dNTP, 0.1 µmol/L primers, and 1 U Platinum Taq Polymerase (Invitrogen). Cycling conditions were as follows: 94°C for 2 minutes; 40 cycles of 94°C for 30 seconds; 56°C for 10 seconds; and 72°C for 1 minute; and with another extension time of 4 minutes. Rat PDGF-A promoter was amplified using primers ratprom800-1000F 5'GCCAAGAGAGTAAGGGGAGAG3', ratprom800-1000R 5'CGATGTGAAAATCCAGGAAGA3', ratprom500-800F 5'GAGGGGTTAGGGGTCATTGT3', and ratprom500-700R 5'CGAGGGTGGTAAGAGCTTGT3'.

Small Interfering RNA
SMCs were seeded in Petri dishes and growth arrested with serum-free medium 6 hours before transfection with 0.2 µmol/L small interfering RNA (siRNA; Qiagen) targeting endogeneous rat Ets-1 and Sp1. PDGF-A was inducibly expressed by the addition of FBS (Invitrogen) to the final concentration of 10% for 1 hour. Total RNA was extracted using the TrIzol method; cDNA synthesis and RT-PCR were done as mentioned previously in this section. The sequence of siRNA Sp1 targeting nucleotides 418 to 438 (accession No. D12768) was 5'r(GGAACAGAGUGGCAACAGU)d(TT)3' and its corresponding complementary strand 5'r(ACUGUUGCCACUCUGUUCC)d(TT)3'. Nucleotides 1240 to 1260 of the rat Ets-1 (GenBank accession No. L20681.1) was targeted by siRNA with the sequence 5'r(GGACAAGCCUGUCAUUCCU)d(TT)3' and its corresponding complementary strand 5'r(AGGAAUGACAGGCUUGUCC)d(TT)3'. An irrelevant siRNA (Irr siRNA) molecule of identical size (5'r(GCGAGUAGCGCUAGGAAGU)d(TT)3'/5'r(ACUUCCUAGC GCUACUCGC)d(TT)3') was used as a negative control in experiments where indicated.

Immunoprecipitation
Cytoplasmic or nuclear extracts were precleared with Protein G-Sepharose 4 Fast Flow Beads (Amersham) for 2 hours at 4°C before addition of the indicated antibody and gentle shaking overnight at 4°C. Pull-downs were performed using fresh beads during 2 hours with shaking. After sequential washing, SDS loading buffer was added to the beads, boiled, and loaded onto SDS-PAGE.

Total Cell Count
SMCs were seeded into 96-well titer plates and rendered growth quiescent by incubation in serum-free medium for 24 hours. Plasmid transfections were performed using FuGENE6 in medium containing 5% serum 6 hours before addition of neutralizing antibodies to PDGF-A (Genzyme) or rabbit IgG control (Sigma). Cells were quantitated using the automated Coulter Z1 counter (Beckman).


*    Results and Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results and Discussion
down arrowReferences
 
Ets-1 Activates PDGF-A Transcription and mRNA Expression in Primary Rat Aortic SMCs
To determine the influence of Ets-1 on the expression of PDGF-A, primary rat vascular SMCs were transfected with the CMV-based expression vector pcDNA3-Ets-1, together with construct p643A-luc, a Firefly luciferase reporter construct driven by 643 bp of the PDGF-A promoter. Ets-1 increased luciferase activity from p643A-luc within 24 hours (Figure 1A). Ets-1 also increased PDGF-A mRNA (Figure 1B, top) expression without affecting GAPDH levels (Figure 1B, bottom). Basal Ets-1 protein expression was below the limit of detection by Western blot analysis (Figure 1C). pcDNA3-Ets-1, as opposed to its backbone counterpart (pcDNA3), produced immunoreactive Ets-1 (Figure 1C). In contrast, Sp1 levels did not change during Ets-1 overexpression (Figure 1C). Immunocytochemistry 12 hours after transfection with p-glutathione S-transferase (pGST)-Ets-1 revealed >50% efficiency (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Ets-1 induces PDGF-A transcription and mRNA expression. A, Cells were transfected with 10 µg of p643A-luc and 3 µg of pcDNA3-Ets-1 or pcDNA3. Luciferase activity was determined in the cell lysates after 24 hours. The y-axis indicates the ratio of Firefly luciferase activity over Renilla to normalize for transfection efficiency. The SEM from 4 observations is indicated. B, Cells were transfected with 20 µg of pcDNA3-Ets-1 or pcDNA3, and after 24 hours, levels of PDGF-A mRNA were assessed by RT-PCR. The expected amplification product of PDGF-A is 613 bp and GAPDH is 450 bp. C, Western blot analysis for Ets-1 and Sp1 in SMCs transfected with 20 or 40 µg of pcDNA3-Ets-1 or pcDNA3 after 8 hours. Molecular weight markers are indicated on the left.

Endogenous Ets-1 Interacts With the –555TTCC–552 Motif in the PDGF-A Promoter
Inspection of the PDGF-A promoter revealed a putative reverse Ets binding motif (TTCC) located at bp –555/–552 relative to the transcriptional start site.11 To determine whether this element could support an interaction with Ets-1, we performed an electrophoretic mobility shift assay (EMSA) in which we incubated nuclear extracts of SMCs with 32P-Oligo A–568/–540, a 32P-labeled double-stranded oligonucleotide spanning bp –568/–540 in the PDGF-A promoter. This produced several discreet nucleoprotein complexes (Figure 2A, lane 2). However, only 1 of these complexes failed to form when the putative Ets binding motif was mutated from –555TTCC–552 to –555TACA–552 in probe 32P-Oligo mA–568/–540 (Figure 2A, lane 4, arrow). Preincubation of the extracts with Ets-1 antibodies reduced formation of this specific complex (Figure 2A).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 2. Ets-1 interacts with the PDGF-A promoter, the –555TTCC–552 of which is critical to nucleoprotein complex formation. A, EMSA using nuclear extracts of SMCs and wild-type 32P-Oligo A–568/–540 (5'CCCGCCCCCCTCCTTCCCCAAAGACTGAC3') or 32P-mOligo A–568/–540 wherein –555TTCC–552 was changed to –555TACA–552. Arrow indicates the –555TTCC–552-specific complex. Supershift analysis was performed by preincubating nuclear extracts with 2 µg of antibody for 10 minutes before addition of the probe. B, ChIP analysis in SMCs transfected with pcDNA3 or Ets-1-pcDNA3. Cross-linked protein-DNA complexes were immunoprecipitated with Ets-1 antibodies before PCR amplification of the PDGF-A promoter. The intensities (in pixels) of the PDGF-A amplicon in the Ets-1 antibody group were expressed as a ratio of the total input. Error bars represent the SEM. C, ChIP analysis with Ets-1 antibodies and cells transfected with pKCR3-DN-Ets-1 or pKCR3. The top represents the 142-bp PDGF-A promoter amplicon, whereas the bottom shows the 110-bp PDGF-A promoter amplicon not containing 5'GGAA/T3' element in either direction. D, ChIP analysis with GST antibodies and cells transfected with pGST-Ets-1 or pcDNA3. DNA size in base pairs is indicated on the side of the figure. M denotes the 100-bp DNA ladder.

Ets-1 Binds to the Authentic PDGF-A Promoter
To provide confirmatory evidence for the physical interaction of Ets-1 with the endogenous PDGF-A promoter, we performed ChIP analysis using cells that had been transfected with pcDNA3-Ets-1 or pcDNA3, in combination with Ets-1 antibodies. Figure 2B demonstrates that Ets-1 binds to the endogenous PDGF-A promoter in SMCs transfected with pcDNA3. The intensity of the PDGF-A amplicon increased in cells transfected with pcDNA3-Ets-1. That the amplicon, the identity of which was confirmed by sequencing, could no longer be observed in the absence of the Ets-1 antibodies using extracts of cells transfected with either pcDNA3-Ets-1 or the empty expression vector demonstrates that Ets-1 interacts with the authentic PDGF-A promoter.

To provide additional evidence that Ets-1 interacts with the endogenous PDGF-A gene, we performed ChIP analysis with cells transfected with pKCR3-DN-Ets-1 or its backbone control, pKCR3. pKCR3-DN-Ets-1 generates a form of Ets-1 protein bearing only the DNA-binding domain and lacking the transactivation domain,29 thus functioning as a dominant-negative inhibitor of endogenous Ets-1. This mutant also lacks the C-terminal epitope of the Ets-1 antipeptide antibody and therefore should evade pull-down by the Ets-1 antibody. DN-Ets-1 decreased the interaction of endogenous Ets-1 with the PDGF-A promoter (Figure 2C, top). The nucleotide 500 to 700 region of the rat PDGF-A promoter (accession No. L06238)32 does not contain Ets consensus elements (5'GGAA/T3') and therefore should not be pulled down with Ets-1 antibodies and amplified. This region is detected in the input but is not associated with an Ets-1 immunoprecipitate (Figure 2C, bottom).

To ensure that these observations were not an artifact of the Ets-1 antibody, we performed ChIP analysis using epitope-tagged Ets-1 in combination with antibodies to the tag. We transfected SMCs with pGST-Ets-1, which produces the DNA-binding domain of Ets-1 fused to GST. GST antibodies pulled down the authentic PDGF-A promoter in pGST-Ets-1 transfectants (Figure 2D) but not in GST-negative pcDNA3 transfectants (Figure 2D). These findings provide further evidence, independently of Ets-1 antibodies, that Ets-1 physically binds the endogenous PDGF-A promoter.

Mutation of the –555TTCC–552 Motif Lowers Basal and Ets-1-Inducible PDGF-A Promoter Activity
To determine the functional importance of the –555TTCC–552 element in PDGF-A promoter, we cotransfected pcDNA3-Ets-1 with p643A-luc(–555TACA–552), in which –555TTCC–552 had been mutated to –555TACA–552. This mutation significantly reduced basal activity of the PDGF-A promoter (Figure 3A), consistent with observations that Ets-1 is required for basal expression of certain other target genes.33 Ets-1, as expected, activated the wild-type PDGF-A promoter (Figure 3A). However, the mutant PDGF-A promoter failed to respond to Ets-1 (Figure 3A). Thus, introduction of a mutation in the PDGF-A promoter that ablates Ets-1 nucleoprotein complex formation compromised Ets-1 induction of the promoter. To complement these findings, we cotransfected SMCs with p643A-luc together with pKCR3-DN-Ets-1 or its backbone control, pKCR3. Unlike activation of PDGF-A promoter-dependent expression by wild-type Ets-1, this mutant form of Ets-1 failed to stimulate the promoter and even reduced basal promoter activity (Figure 3B).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. Integrity of the –555TTCC–552 motif in the PDGF-A promoter and an intact Ets-1 transactivation domain are critical for Ets-1 activation of PDGF-A transcription. A, Cells were cotransfected with 10 µg of wild-type p643A-luc or mutant p643A-luc(–555TACA–552) and 3 µg of pcDNA3-Ets-1 or pcDNA3, and 1 µg of pRL-TK. Firefly luciferase activity was determined in cell lysates after 24 hours. The y-axis represents the ratio of the Firefly luciferase activity over the Renilla to normalize for transfection efficiency. Error bars denote the SEM from 4 observations. B, Cells were cotransfected with 10 µg of p643A-luc and 3 µg of pKCR3-Ets-1 or pKCR3-DN-Ets-1 and 1 µg of pRL-TK. The y-axis represents the ratio of the Firefly luciferase activity over the Renilla 24 hours after transfection to normalize for transfection efficiency. Error bars denote the SEM from 4 observations.

Ets-1 Activates PDGF-A Transcription Cooperatively With Sp1
We demonstrated previously that Ets-1 and Sp1 physically interact and cooperatively activate the FasL promoter in the spontaneously transformed WKY12-22 (pup rat-derived) SMC line.29 To our knowledge, Ets-1/Sp1 interaction and cooperativity has not been demonstrated in SMCs. We had also established the existence of a functional cis-acting element for Sp1 in the proximal region (located at –71/–55) of the PDGF-A promoter.12 We hypothesized that Ets-1 and Sp1 together may activate the PDGF-A promoter in a cooperative manner, a mechanism hitherto not demonstrated in the context of any PDGF gene. Immunoprecipitation of nuclear extracts with polyclonal Sp1 antibodies followed by Western blot analysis with Ets-1 antibodies revealed that endogenous Ets-1 and Sp1 physically interact (Figure 4A). Conversely, precipitation with polyclonal Ets-1 antibodies followed by Western analysis with Sp1 antibodies further confirmed the interaction (Figure 4B). Immunohistochemical analyses using these antibodies indicate that Ets-1 and Sp1 are expressed together with PDGF-A in human atherosclerotic lesions (Figure 4C).



View larger version (85K):
[in this window]
[in a new window]
 
Figure 4. Ets-1 and Sp1 physically interact in primary rat aortic SMCs and are expressed together with PDGF-A in human atherosclerotic lesions. Immunoprecipitation with Sp1 antibodies followed by Western blot analysis with Ets-1 antibodies (A) or Ets-1 antibodies followed by Western blot analysis with Sp1 antibodies after resolution on 10% denaturing SDS polyacrylamide gels (B). NE denotes nuclear extract, whereas CE denotes cytoplasmic extract. The molecular weight marker is indicated on the left. C, Ets-1, Sp1, and PDGF-A are expressed in human atherosclerotic lesions. No 1° denotes no primary antibody.

Overexpression of Sp1 alone increased PDGF-A promoter-dependent expression by almost 3-fold (Figure 5). However, Sp1 failed to activate the promoter when the Ets binding site had been mutated (Figure 5). The promoter was induced 6-fold when Ets-1 and Sp1 were coexpressed with the wild-type PDGF-A promoter-reporter construct (Figure 6A). Ets-1 activation of PDGF-A transcription was blocked by construct pEBG-DN-Sp1 (Figure 6B), which generates a mutant form of Sp1 containing only the DNA-binding domain. This dominant-negative form of Sp1 reduced cooperative activation of PDGF-A promoter-dependent expression with Ets-1 (Figure 6B, compare bars 6 and 7). That Ets-1-inducible PDGF-A transcription is blocked by siRNA targeting Sp1 and Ets-1 (Figure 6C) but not by an Irr siRNA molecule of identical size and concentration (Figure 6C) strengthens the evidence for cooperative Ets-1/Sp1 transactivation of the PDGF-A promoter.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Sp1 activates the wild-type PDGF-A promoter but not the promoter bearing a mutation in the Ets-1 binding motif. The cells were cotransfected with 10 µg of either wild-type p643A-luc or mutant p643A-luc(–555TACA–552) and 1 µg of pRL-TK. The y-axis represents the ratio of the Firefly luciferase activity over the Renilla 24 hours after transfection to normalize for transfection efficiency. Error bars denote the SEM from 4 observations.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 6. Cooperative activation of the PDGF-A promoter by Sp1 and Ets-1. A, Cells were transfected with 10 µg of p643A-luc and 1 µg of either pcDNA3-Ets-1 or CMV-Sp1 together with 1 µg of pRL-TK. The total amount of expression vector was kept constant throughout at 2 µg (with pcDNA3). The y-axis represents the ratio of Firefly luciferase activity over the Renilla to normalize for transfection efficiency. Error bars denote the SEM from 4 observations. B, Dominant-negative Sp1 abrogates Ets-1-inducible PDGF-A promoter activity. A total of 10 µg of p643A-luc and the indicated amount of plasmid were transfected into SMCs, together with 1 µg of pRL-TK. Luciferase activity was determined in the cell lysates after 24 hours. The y-axis represents the ratio of the Firefly luciferase activity over the Renilla to normalize for transfection efficiency. Error bars denote the SEM from 4 observations. C, Ets-1-inducible PDGF-A transcription is blocked by Sp1 siRNA or Ets-1 siRNA. A total of 10 µg of p643A-luc, 3 µg of the indicated plasmid, and 1 µg of the indicated siRNA were transfected into SMCs, together with 1 µg of pRL-TK. Luciferase activity was determined in the cell lysates after 24 hours. The y-axis represents the ratio of the Firefly luciferase activity over the Renilla to normalize for transfection efficiency. Error bars denote the SEM from 4 observations. D, PDGF-BB-inducible PDGF-A mRNA expression is blocked by Ets-1 siRNA and Sp1 siRNA. Growth-quiescent SMCs were transfected with 0.2 µmol/L of the indicated siRNA. After transfection, PDGF-BB (25 ng/mL) was incubated with the cells for 5 hours before isolation of total RNA and RT-PCR analysis.

We used siRNA to Ets-1 to provide further evidence for the positive regulatory role of endogenous Ets-1 in the regulation of PDGF-A gene expression. Ets-1 siRNA inhibited serum-inducible PDGF-A mRNA levels within 6 hours of transfection (data not shown). siRNA targeting Sp1, which we demonstrated previously, plays a critical role in PDGF-A transcription-12 abrogated serum-inducible PDGF-A expression. To demonstrate that a defined agonist can induce PDGF-A transcription via an Ets-1/Sp1-dependent mechanism, we used PDGF-BB, which stimulates Ets-1 expression in SMCs.34,35 PDGF-BB-inducible PDGF-A mRNA expression was inhibited by Ets-1 siRNA and Sp1 siRNA (Figure 6D) but not the Irr siRNA (Figure 6D).

Ets-1 and Sp1 Stimulate Primary Rat Aortic SMC Proliferation: Mitogenesis Is Blocked by Neutralizing PDGF-A Antibodies
Flow cytometric analysis and Coulter quantitation demonstrate that Sp1 and Ets-1 each increase both S-phase entry (Figure 7A) and total cell counts (Figure 7B) compared with their backbone control. Proliferation stimulated by Ets-1 together with Sp1 was blocked when Ets-1 was cotransfected with mutant Sp1 or when Sp1 was cotransfected with mutant Ets-1 (Figure 7B). Ets-1-inducible SMC proliferation is inhibited by Sp1 siRNA and Ets-1 siRNA (Figure 7C) but not by the Irr siRNA (Figure 7C). Conversely, Sp1-inducible SMC proliferation is blocked by Ets-1 siRNA and Sp1 siRNA (Figure 7C). Ets-1-inducible SMC mitogenesis is blocked using neutralizing PDGF-A antibodies but not species-matched and isotype-matched IgG (Figure 7D).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 7. Ets-1 stimulates SMC growth in an Sp1- and PDGF-A dependent manner. A, Cells grown in 6-well titer plates were transfected with 20 µg of pcDNA3, pcDNA3-Ets-1, or CMV-Sp1 and left for 24 hours in medium containing 5% serum before determination of S-phase distribution by flow cytometry. Square root transformation of the raw data were performed before ANOVA. The asterisk denotes significant difference at P<0.05. B, Cells grown in 96-well titer plates were transfected with 0.3 µg of the indicated plasmids or plasmid combinations (0.15 µg/0.15 µg) and left for 3 days in medium containing 5% serum before cell quantitation using a Coulter counter. The asterisk denotes significant difference at P<0.05 by ANOVA. C, Ets-1- and Sp1-inducible SMC proliferation is blocked by Sp1 siRNA and Ets-1 siRNA. Cells in 96-well titer plates were transfected with 0.3 µg of the indicated plasmids together with 25 nM of the indicated siRNA and left for 3 days in medium containing 5% serum before cell quantitation using a Coulter counter. The asterisk denotes significant difference at P<0.05 by ANOVA. D, Cells in 96-well titer plates were transfected with 0.3 µg of the indicated plasmid and left for 6 hours before incubation with neutralizing PDGF-A antibodies (Genzyme) or rabbit IgG (Sigma; 10 µg per well containing 200 µL of medium). The cells were quantitated after 4 days using a Coulter counter. The asterisk denotes significant difference at P<0.05. E, Cells in 100-mm Petri dishes were transfected with 40 µg of either pcDNA3 or pcDNA3-Ets-1. Cells were lysed and precleared with Protein G Sepharose Fast Flow Beads. The supernatant was incubated with PDGFR-{alpha} antibodies (Santa Cruz Biotechnology) before the addition of fresh beads. After sequential washes, beads were boiled, and the supernatant was loaded onto 14% SDS-PAGE before immunodetection by chemiluminescence. The Western blot shows total PDGFR-{alpha} levels. P-Tyr denotes phosphotyrosine. The molecular weight markers are shown at the left.

The autocrine mitogenic effect of PDGF-A on Ets-1 overexpression was further supported by immunoprecipitation experiments in which PDGFR-{alpha} was pulled down from total cell lysates followed by Western blot analysis with phosphotyrosine antibodies. Although PDGFR-{alpha} was expressed in SMCs transfected with the empty vector, it was inactive (Figure 7E). In contrast, tyrosine-phosphorylated PDGFR-{alpha} was readily detectable in cells expressing Ets-1 without a change in total levels of PDGFR-{alpha} protein (Figure 7E).

Using a variety of approaches, including EMSA, ChIP, immunoprecipitation, and transient transfection analysis, this study provides the first demonstration that Ets-1 binds and activates the PDGF-A promoter. Confirmatory evidence was provided by dominant- negative siRNA and epitope-tagged approaches. Ets-1 binds to a distinct motif (TTCC) in the PDGF-A promoter located at bp –555/–552, a core Ets element in reverse. The integrity of this site is critical for Ets-1 binding and induction of PDGF-A expression. It is also required for cooperative Ets-1 and Sp1 activation of the promoter. Ets-1 activation of the PDGF-A promoter also requires an intact Sp1 binding site in the core region. These in vitro studies, which provide key insights into the role of Ets-1/Sp1 cooperativity in PDGF-A transcription, would be complemented by whole animal analyses in transgenic mice bearing PDGF-A promoter mutations in the Ets and/or Sp1 elements.

Gene expression is controlled in part at the level of transcription by the complex interplay of positive and negative regulatory factors. We and others have demonstrated that multiple such nuclear factors interact with and regulate the PDGF-A promoter. These include Egr-1 and Sp3,12–15 WT-1,16,17 GCF2,18,19 BTEB236 NF-1(X),18,19 Sp1,12 and, as reported here, Ets-1. Whether Ets-1 cooperates with these other factors, as we show here it does with Sp1, to control PDGF-A transcription remains to be seen. The 2 CArG elements (putative SRF-binding motifs) in the vicinity of the –524TTCC–521 element (–532CCTTTTATG–524 and –551CAAAG–547) suggest the possibility of SRF/Ets cooperativity.

We have demonstrated here that Ets-1 and Sp1 stimulate the proliferation of early passage primary rat aortic SMCs. We have shown previously that Ets-1 inhibits apoptosis in these cells.37 The influence of Sp1 overexpression on SMC phenotype may depend on the amount of plasmid used and previous growth-arrest because previous studies by our group have revealed that Sp1 inhibits SMC growth on transfection with 2- to 3-fold more of the Sp1 expression vector without previous growth-arrest. The present findings indicating cooperative Ets-1/Sp1 upregulation of PDGF-A expression in SMCs extend the scope of functional Ets-1/Sp1 interactions into cell growth. That Sp1, Ets-1, and PDGF-A are coexpressed in human atherosclerotic lesions and because Ets-124,28 but not Sp138 is inducibly expressed in SMCs after arterial injury suggests a role for Ets-1/Sp1 cooperativity in the process of neointimal thickening.


*    Acknowledgments
 
This work was supported by grants from the National Health and Medical Research Council, Australian Research Council, and National Heart Foundation and an infrastructure grant from NSW Department of Health. L.M.K. is a principal research fellow of NHMRC. We thank Drs Yuri Bobryshev, Mary Zhang, and Andrew Jessup for excellent technical assistance.


*    Footnotes
 
Original received November 12, 2003; resubmission received February 5, 2004; revised resubmission received July 20, 2004; accepted July 22, 2004.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults and Discussion
*References
 
1. Bergsten E, Uutela M, Li X, Pietras K, Heldin C-H, Ostman A, Alitalo K, Eriksson U. PDGF-D is a specific and protease-activated ligand for the PDGF beta receptor. Nat Cell Biol. 2000; 3: 512–516.

2. LaRochelle WJ, Jeffers M, McDonald WF, Chillakuru RA, Giese NA, Lokker NA, Sullivan C, Boldog FL, Yang M, Vernet C, Burgess CE, Fernandes E, Deegler LL, Rittman B, Shimkets J, Shimkets RA, Rothberg JM, Lichenstein HS. PDGF-D, a new protease-activated growth factor. Nat Cell Biol. 2001; 3: 517–521.[CrossRef][Medline] [Order article via Infotrieve]

3. Li X, Porten A, Aase K, Karlsson L, Abramsson A, Uutela M, Backstrom G, Hellstrom M, Bostrom H, Li H, Soriano P, Betsholtz C, Heldin C-H, Alitalo K, Ostman A, Eriksson U. PDGF-C is a new protease-activated ligand for the PDGF alpha receptor. Nat Cell Biol. 2000; 2: 302–309.[CrossRef][Medline] [Order article via Infotrieve]

4. Betsholtz C, Karlsson L, Lindahl P. Developmental roles of platelet-derived growth factors. BioEssays. 2001; 23: 494–507.[CrossRef][Medline] [Order article via Infotrieve]

5. Majesky MW, Benditt EP, Schwartz SM. Expression and developmental control of platelet-derived growth factor A-chain and B-chain/Sis genes in rat aortic smooth muscle cells. Proc Natl Acad Sci U S A. 1988; 85: 1524–1528.[Abstract/Free Full Text]

6. Libby P, Warner SJ, Salomon RN, Birinyi LK. Production of platelet-derived growth factor-like mitogen by smooth-muscle cells from human atheroma. N Engl J Med. 1988; 318: 1493–1498.[Abstract]

7. Barrett TB, Benditt EP. Platelet-derived growth factor gene expression in human atherosclerotic plaques and normal artery wall. Proc Natl Acad Sci U S A. 1988; 85: 2810–2814.[Abstract/Free Full Text]

8. Ueda M, Becker AE, Kasayuki N, Kojima, Morita Y, Tanaka S. In situ detection of platelet-derived growth factor-A and -B chain mRNA in human coronary arteries after percutaneous transluminal coronary angioplasty. Am J Pathol. 1996; 149: 831–843.[Abstract]

9. Heldin C-H, Backstrom G, Ostman A, Hammacher A, Ronnstrand L, Rubin K, Nister M, Westermark B. Binding of different dimeric forms of PDGF to human fibroblasts: evidence for two separate receptor types. EMBO J. 1988; 7: 1387–1393.[Medline] [Order article via Infotrieve]

10. Betsholtz C, Johnsson A, Heldin C-H, Westermark B, Lind P, Urdea MS, Eddy R, Shows TB, Philpott K, Mellor AL, Knott TJ, Scott J. cDNA sequence and chromosomal localization of human platelet-derived growth factor A-chain and its expression in tumor cell lines. Nature. 1986; 320: 695–699.[CrossRef][Medline] [Order article via Infotrieve]

11. Bonthron DT, Morton CC, Orkin SH, Collins T. Platelet-derived growth factor A chain: gene structure, chromosomal location, and basis for alternative mRNA splicing. Proc Natl Acad Sci U S A. 1988; 85: 1492–1496.[Abstract/Free Full Text]

12. Khachigian LM, Williams AJ, Collins T. Interplay of Sp1 and Egr-1 in the proximal platelet-derived growth factor A-chain promoter in cultured vascular endothelial cells. J Biol Chem. 1995; 270: 27679–27686.[Abstract/Free Full Text]

13. Khachigian LM, Anderson KA, Halnon NJ, Resnick N, Gimbrone Ma, Collins T. Egr-1 is activated in endothelial cells exposed to fluid shear stress and interacts with a novel shear-stress response element in the PDGF A-chain promoter. Arterioscler Thromb Vasc Biol. 1997; 17: 2280–2286.[Abstract/Free Full Text]

14. Delbridge GJ, Khachigian LM. FGF-1-induced platelet-derived growth factor-A chain gene expression in endothelial cells involves transcriptional activation by early growth response factor-1. Circ Res. 1997; 81: 282–288.[Abstract/Free Full Text]

15. Silverman ES, Khachigian, LM, Lindner V, Williams AJ, Collins T. Inducible PDGF-A chain transcription in smooth muscle cells is mediated by Egr-1 displacement of Sp1 and Sp3. Am J Physiol. 1997; 273: H1415–H1426.[Medline] [Order article via Infotrieve]

16. Gashler AL, Bonthron DT, Madden SL, Rauscher FJ, Collins T, Sukhatme VP. Human platelet-derived growth factor A chain is transcriptionally repressed by the Wilms tumor suppressor WT1. Proc Natl Acad Sci U S A. 1992; 89: 10984–10988.[Abstract/Free Full Text]

17. Wang ZY, Madden SL, Deuel TF, Rauscher FJ. The Wilms’ tumor gene product, WT-1, represses transcription of the platelet-derived growth factor A-chain gene. J Biol Chem. 1992; 267: 21999–22002.[Abstract/Free Full Text]

18. Khachigian LM, Santiago FS, Rafty LA, Chan LW, Delbridge GJ, Bobik A, Collins T, Johnson AC. GC factor 2 represses platelet-derived growth factor A-chain gene transcription and is itself induced by arterial injury. Circ Res. 1999; 84: 1258–1267.[Abstract/Free Full Text]

19. Rafty LA, Santiago FS, Khachigian LM. NF1/X represses PDGF A-chain transcription by interacting with Sp1 and antagonizing Sp1 occupancy of the promoter. EMBO J. 2002; 21: 334–343.[CrossRef][Medline] [Order article via Infotrieve]

20. Karim FD, Urness LD, Thummel CS, Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki RA, Gunther CV, Nye JA. The ETS-domain: a new DNA-binding motif that recognizes a purine-rich core DNA sequence. Genes Dev. 1990; 4: 1451–1453.[Free Full Text]

21. Woods DB, Ghysdael J, Owen MJ. Identification of nucleotide preferences in DNA sequences recognized specifically by c-Ets-1 protein. Nucleic Acids Res. 1992; 20: 699–704.[Abstract/Free Full Text]

22. Iwasaka C, Tanaka K, Abe M, Sato Y. Ets-1 regulates angio-genesis by inducing the expression of urokinase-type plasminogen activator and matrix mettaloproteinase-1 and the migration of vascular endothelial cells. J Cell Physiol. 1996; 169: 522–531.[CrossRef][Medline] [Order article via Infotrieve]

23. Naito S, Shimizu S, Maeda S, Wang J, Paul R, Fagin JA. Ets-1 is an early response gene activated by ET-1 and PDGF-BB in vascular smooth muscle cells. Am J Physiol. 1998; 274: C472–C480.[Medline] [Order article via Infotrieve]

24. Tanaka K, Oda N, Iwasaka C, Abe M, Sato Y. Induction of Ets-1 in endothelial cells during reendothelialization after denuding injury. J Cell Physiol. 1998; 176: 235–244.[CrossRef][Medline] [Order article via Infotrieve]

25. Watabe T, Yoshida K, Shindoh M, Kaya M, Fujikawa K, Sato H, Seiki M, Ishii S, Fujinaga K. The Ets-1 and Ets-2 transcription factors activate the promoters for invasion-associated urokinase and collagenase genes in response to epidermal growth factor. Int J Cancer. 1998; 77: 128–137.[CrossRef][Medline] [Order article via Infotrieve]

26. Goetze S, Kintscher U, Kim S, Meehan WP, Kaneshiro K, Collins AR, Fleck E, Hsueh WA, Law RE. Peroxisome proliferator-activated receptor-gamma ligands inhibit nuclear but not cytosolic extracellular signal-regulated kinase/mitogen-activated protein kinase-regulated steps in vascular smooth muscle cell migration. J Cardiovasc Pharmacol. 2001; 38: 909–921.[CrossRef][Medline] [Order article via Infotrieve]

27. Hultgardh-Nilsson A, Lovdahl C, Blomgren K, Kallin B, Thyberg J. Expression of phenotype- and proliferation-related genes in rat aortic smooth muscle cells in primary culture. Cardiovasc Res. 1997; 34: 418–430.[CrossRef][Medline] [Order article via Infotrieve]

28. Hultgardh-Nilsson A, Cercek B, Wang S, Naito S, Lovdahl C, Sharifi B, Forrester JS, Fagin JA. Regulated expression of the ets-1 transcription factor in vascular smooth muscle cells in vivo and in vitro. Circ Res. 1996; 78: 589–595.[Abstract/Free Full Text]

29. Kavurma MM, Bobryshev Y, Khachigian LM. Ets-1 positively regulates Fas ligand transcription via cooperative interaction with Sp1. J Biol Chem. 2002; 277: 36244–36252.[Abstract/Free Full Text]

30. Day FL, Rafty LA, Chesterman CN, Khachigian LM. Angiotensin II (ATII)-inducible platelet-derived growth factor A-chain gene expression is p42/44 extracellular signal-regulated kinase-1/2 and egr-1-dependent and mediated via the ATii type 1 but not type 2 receptor. J Biol Chem. 1999; 274: 23726–23733.[Abstract/Free Full Text]

31. Santiago FS, Lowe HC, Bobryshev YV, Khachigian LM. Induction of the transcriptional repressor Yin Yang-1 by vascular cell injury: autocrine/paracrine role of endogenous fibroblast growth factor-2. J Biol Chem. 2001; 276: 41143–41149.[Abstract/Free Full Text]

32. Xia Y, Feng L, Tang WW, Wilson CB. Cloning and expression of rat platelet-derived growth factor A-chain. J Am Soc Nephrol. 1992; 3: 622.

33. Lindner V, Giachelli CM, Schwartz SM, Reidy MA. A subpopulation of smooth muscle cells in injured rat arteries expresses platelet-derived growth factor-B chain mRNA. Circ Res. 1995; 76: 951–957.[Abstract/Free Full Text]

34. Naito S, Shimizu S, Maeda S, Wang J, Paul R, Fagin JA. Ets-1 is an early response gene activated by ET-1 and PDGF-BB in vascular smooth muscle cells. Am J Physiol. 1998; 274: C472–C480.[Medline] [Order article via Infotrieve]

35. Dandre F, Owens GK. Platelet-derived growth factor-BB and Ets-1 transcription factor negatively regulate transcription of multiple smooth muscle differentiation marker genes. Am J Physiol Heart Circ Physiol. 2004; 286: H2042–H2051.[Abstract/Free Full Text]

36. Aizawa K, Suzuki T, Kada N, Ishihara A, Kawai-Kowase K, Matsumura T, Sasaki K, Munemasa Y, Manabe I, Kurabayashi M, Collins T, Nagai R. Regulation of platelet-derived growth factor-A chain by Kruppel-like factor 5: new pathway of cooperative activation with nuclear factor-kappaB. J Biol Chem. 2004; 279: 70–76.[Abstract/Free Full Text]

37. Zhang C, Kavurma MM, Khachigian LM. Ets-1 protects vascular smooth muscle cells from undergoing apoptosis by activating p21WAF1/Cip1: Ets-1 regulates basal and inducible p21WAF1/Cip 1 transcription via distinct cis-acting elements in the p21WAF/Cip 1 promoter. J Biol Chem. 2003; 278: 27903–27909.[Abstract/Free Full Text]

38. Khachigian LM, Fahmy RG, Zhang G, Bobryshev YV, Kaniaros A. c-Jun regulates vascular smooth muscle cell growth and neointima formation after arterial injury: inhibition by a novel DNAzyme targeting c-Jun. J Biol Chem. 2002; 277: 22985–22991.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. A. Deaton, Q. Gan, and G. K. Owens
Sp1-dependent activation of KLF4 is required for PDGF-BB-induced phenotypic modulation of smooth muscle
Am J Physiol Heart Circ Physiol, April 1, 2009; 296(4): H1027 - H1037.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
I.-C. Lo, T.-M. Lin, L.-H. Chou, S.-L. Liu, L.-W. Wu, G.-Y. Shi, H.-L. Wu, and M. J. Jiang
Ets-1 mediates platelet-derived growth factor-BB-induced thrombomodulin expression in human vascular smooth muscle cells
Cardiovasc Res, March 1, 2009; 81(4): 771 - 779.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang, M. Q. Hassan, R.-L. Xie, J. R. Hawse, T. C. Spelsberg, M. Montecino, J. L. Stein, J. B. Lian, A. J. van Wijnen, and G. S. Stein
Co-stimulation of the Bone-related Runx2 P1 Promoter in Mesenchymal Cells by SP1 and ETS Transcription Factors at Polymorphic Purine-rich DNA Sequences (Y-repeats)
J. Biol. Chem., January 30, 2009; 284(5): 3125 - 3135.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Perez Sastre, S. Grossmann, H. P. Reusch, and M. Schaefer
Requirement of an Intermediate Gene Expression for Biphasic ERK1/2 Activation in Thrombin-stimulated Vascular Smooth Muscle Cells
J. Biol. Chem., September 19, 2008; 283(38): 25871 - 25878.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
K. P. Malabanan, P. Kanellakis, A. Bobik, and L. M. Khachigian
Activation Transcription Factor-4 Induced by Fibroblast Growth Factor-2 Regulates Vascular Endothelial Growth Factor-A Transcription in Vascular Smooth Muscle Cells and Mediates Intimal Thickening in Rat Arteries Following Balloon Injury
Circ. Res., August 15, 2008; 103(4): 378 - 387.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. D. Pearse, R.-X. Tian, J. Nigro, J. B. Iorgulescu, L. Puzis, and E. A. Jaimes
Angiotensin II increases the expression of the transcription factor ETS-1 in mesangial cells
Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1094 - F1100.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
L. Sun, M. E. Diamond, A. J. Ottaviano, M. J. Joseph, V. Ananthanarayan, and H. G. Munshi
Transforming Growth Factor-{beta}1 Promotes Matrix Metalloproteinase-9-Mediated Oral Cancer Invasion through Snail Expression
Mol. Cancer Res., January 1, 2008; 6(1): 10 - 20.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. F. Crook, M. Olive, H.-H. Xue, T. H. Langenickel, M. Boehm, W. J. Leonard, and E. G. Nabel
GA-binding protein regulates KIS gene expression, cell migration, and cell cycle progression
FASEB J, January 1, 2008; 22(1): 225 - 235.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Jiang, Y. Wei, J. Shen, D. Liu, X. Chen, J. Zhou, H. Zong, X. Yun, X. Kong, S. Zhang, et al.
Functional Interaction of E1AF and Sp1 in Glioma Invasion
Mol. Cell. Biol., December 15, 2007; 27(24): 8770 - 8782.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Sato and K. Furukawa
Sequential Action of Ets-1 and Sp1 in the Activation of the Human beta-1,4-Galactosyltransferase V Gene Involved in Abnormal Glycosylation Characteristic of Cancer Cells
J. Biol. Chem., September 21, 2007; 282(38): 27702 - 27712.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Oettgen
Regulation of Vascular Inflammation and Remodeling by ETS Factors
Circ. Res., November 24, 2006; 99(11): 1159 - 1166.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. Nakatsuka, T. Sokabe, K. Yamamoto, Y. Sato, K. Hatakeyama, A. Kamiya, and J. Ando
Shear stress induces hepatocyte PAI-1 gene expression through cooperative Sp1/Ets-1 activation of transcription
Am J Physiol Gastrointest Liver Physiol, July 1, 2006; 291(1): G26 - G34.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Y. Liu, M. Eyries, C. Zhang, F. S. Santiago, and L. M. Khachigian
Inducible platelet-derived growth factor D-chain expression by angiotensin II and hydrogen peroxide involves transcriptional regulation by Ets-1 and Sp1
Blood, March 15, 2006; 107(6): 2322 - 2329.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. R. Bonello, Y. V. Bobryshev, and L. M. Khachigian
Peroxide-Inducible Ets-1 Mediates Platelet-Derived Growth Factor Receptor-{alpha} Gene Transcription in Vascular Smooth Muscle Cells
Am. J. Pathol., October 1, 2005; 167(4): 1149 - 1159.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
95/5/479    most recent
01.RES.0000141135.36279.67v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Santiago, F. S.
Right arrow Articles by Khachigian, L. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Santiago, F. S.
Right arrow Articles by Khachigian, L. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Related Collections
Right arrow Gene expression
Right arrow Gene regulation
Right arrow Growth factors/cytokines