Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2004;95:e98-e109
Published online before print November 11, 2004, doi: 10.1161/01.RES.0000150592.88464.ad
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
95/12/e98    most recent
01.RES.0000150592.88464.adv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Labrador, V.
Right arrow Articles by Baertschi, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Labrador, V.
Right arrow Articles by Baertschi, A. J.
Related Collections
Right arrow Structure
Right arrow Other myocardial biology
Right arrow Physiological and pathological control of gene expression
(Circulation Research. 2004;95:e98.)
© 2004 American Heart Association, Inc.


UltraRapid Communications

Peptidyl-Glycine {alpha}-Amidating Monooxygenase Targeting and Shaping of Atrial Secretory Vesicles

Inhibition by Mutated N-Terminal ProANP and PBA

Vénus Labrador, Cécile Brun, Stéphane König, Angela Roatti, Alex J. Baertschi

From the Department of Neuroscience, Centre Médical Universitaire, University of Geneva, Switzerland.

Correspondence Dr Alex J. Baertschi, Neuroscience, CMU, 1 Rue Michel-Servet, 1211 Geneva 4, Switzerland. E-mail alex.baertschi{at}medecine.unige.ch


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowConclusion
down arrowReferences
 
ANP (atrial natriuretic peptide) is widely recognized as an important vasorelaxant, diuretic, and cardioprotective hormone. Little is known, however, about how ANP-secretory vesicles form within the atrial myocytes. Secretory vesicles were visualized by fluorescence microscope imaging in live rat atrial myocytes expressing proANP–enhanced green fluorescent protein (EGFP), or N-terminal–mutated fusion proteins thought to suppress the calcium-dependent aggregation of proANP. Results showed the following: (1) aggregates of proANP and coexpressed proANP-EGFP recruited peptidylglycine {alpha}-amidating monooxygenase (PAM)-1, an abundant atrial integral vesicle membrane protein; (2) coexpressed N-terminal–mutated (Glu23,24->Gln23,24) and N-terminal–deleted proANP-EGFP inhibited recruitment of PAM-1 by up to 60%; (3) 4-phenyl-3-butenoic acid (PBA) (10 µmol/L), a pharmacological inhibitor of the lumenal peptidylglycine {alpha}-hydroxylating monooxygenase domain of PAM proteins, inhibited recruitment of endogenous PAM-1 and of coexpressed pro-EGFP–PAM-1; (4) PBA had no effect on exocytosis of the potassium inward rectifier KIR2.1; (5) PBA induced a deformation of the secretory vesicles but did not inhibit docking. These findings suggest that recruitment of PAM-1 to secretory vesicles depends on intact N-terminal proANP and on the lumenal domain of PAM-1. Conversely, PAM-1 participates in shaping the proANP-secretory vesicles. The full text of this article is available online at http://circres.ahajournals.org.


Key Words: atrium • EGFP • in vivo imaging • PAM • proANP • secretory vesicles


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowConclusion
down arrowReferences
 
Atrial natriuretic peptide (ANP), originally discovered by de Bold,1 is an endogenous hypotensive hormone involved in the regulation of blood pressure and fluid homeostasis.2,3 ANP is secreted from the cardiac atria in response to cardiac stress such as oxygen deficiency and mechanical overload (see Jiao and Baertschi4 for citations). Appropriately, ANP relieves the heart from hypoxic vasoconstriction of the pulmonary circulation and also helps protect the heart from mechanical overload.2–4 ANP and brain natriuretic peptide have become important clinical markers of cardiac hypertrophy and failure. Accordingly, there are thousands of studies on ANP release and action, in both animal and man.

In contrast to this wealth of knowledge, the cell biology of ANP-containing secretory vesicles is far less understood. ANP is synthesized as an inactive precursor, preproANP. A 24-aa signal sequence directs the nascent amino acid chain into the lumen of the endoplasmic reticulum, wherefrom it is processed through the Golgi stacks to the trans-Golgi network (TGN). The prohormone proANP is not cleaved but remains intact during its journey from the TGN to the plasma membrane.3 Sorting of proANP to secretory vesicles may be accomplished by calcium-dependent aggregation of proANP5,6 within electron-dense granules in the TGN.7 By analogy with other secretory systems,8–12 integral membrane proteins of the TGN may recognize the surface layer of the proANP core and enwrap it with TGN membrane to form the secretory vesicle. Our previous study indicates that mutations of the N-terminal calcium-binding domain of proANP results in deformed vesicles that no longer dock at the plasma membrane.13 This raises the question about the identity of the proteins that are recruited to shape and dock the secretory vesicles.

Although proteins involved in secretory vesicle budding and fusion are now well characterized in yeast,14 those of the cardiac ANP-secretory pathway are still largely unknown. Those known to play important roles in other mammalian secretory systems, such as vesicle associated protein and SCAMP secretory carrier–associated protein,14,15 could not be detected, by our preliminary studies, in significant amounts on atrial proANP vesicles. We found that peptidylglycine {alpha}-amidating monooxygenase (PAM), an abundant protein family in the cardiac atrium,16–19 is localized on atrial proANP–enhanced green fluorescent protein (EGFP)–expressing vesicles and could thus be a viable candidate. PAM posttranslationally activates approximately half of all mammalian neuropeptides by converting their COOH-terminal glycine into an essential {alpha}-amide moiety (see Prigge et al16 for review). PAM catalyzes this reaction in two consecutive steps via peptidylglycine {alpha}-hydroxylating monooxygenase (PHM) and peptidyl-{alpha}-hydroxyglycine {alpha}-amidating lyase. Several forms of PAM mRNA result from alternative splicing of the single copy rat PAM gene. PAM-1, the longest form, is composed of the PHM catalytic domain, a noncatalytic domain (exon A), the peptidyl-{alpha}-hydroxyglycine {alpha}-amidating lyase catalytic domain (all within the vesicle lumen), a transmembrane domain (TM), and a C-terminal domain (CD) that extends into the cytoplasm. Deletion of exon A yields PAM-2, and further deletion of TM gives rise to soluble PAM-3 within the vesicle lumen (Figure 1C). In the heart atrium, most of the PAM-1 does not seem to be cleaved into smaller protein products.17–20



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. Constructs and antisera used in this study. A, Wild-type proANP-EGFP and mutant fusion proteins expressed in atrial myocytes. SP indicates signal peptide for proANP; 10aa, 10-aa spacer.13,27 Numbering refers to wild-type proANP; {Delta}N, deletion of calcium binding N-terminal of proANP13; 23,24(Glu->Gln), mutations in N-terminal proANP13 of glutamic acids involved in calcium binding. B, pro-EGFP–PAM-1 fusion protein encoded by a new construct described in Materials and Methods. Numbering starts with first amino acid of prosequence. SP indicates signal peptide for PAM-1; pro, 10-aa (FRSPLSVFKR) prosequence of PAM-1, which is followed by 4 aa (FGPG) including the first ApaI site of the cDNA (first arrow); EGFP is followed by a 10-aa spacer (GGPSINPPVA) including the second ApaI site (second arrow). A indicates exon A domain. From Prigge et al,16, there is no potential cleavage site between EGFP and PHM. C, main proteins of the PAM family in atrium. Antisera (as) used in this study included as475 (anti-PHM); as629 (anti–PAM-1; anti–exon A); and as571 (anti–C-terminal domain, CD-as).33 In black, TM domain.

So far, there is no known substrate for PAM in atrial vesicles; thus other functions of PAM have been explored. Because the lumenal catalytic domain of PAM is pH sensitive, PAM might play a role in signaling lumenal conditions to the cytosolic proteins.21 Mutation of the PAM-CD at juxtamembrane sites eliminates the ability of PAM to bind to the PAM C-terminal interacting protein and to modify regulated secretion.22–24 The pH-dependent aggregation of PAM25 could play a role in its segregation to secretory granules. If PAM interacted with lumenal proteins of the TGN, such as proANP, PAM could be involved in forming the atrial secretory vesicles.

The purpose of this study was to determine whether PAM proteins were implicated in shaping and docking the atrial proANP vesicles. We answered the following questions. Are PAM proteins recruited to proANP-EGFP–expressing secretory vesicles? Do mutations of the N-terminal calcium-binding sequence of proANP suppress recruitment of PAM? Does a pharmacological inhibitor of PAM inhibit recruitment of PAM, deform the secretory vesicles, or suppress docking? The imaging of single atrial vesicles13 in live atrial myocytes was crucial for answering some of these questions.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowConclusion
down arrowReferences
 
Primary Culture of Atrial Myocytes
Atrial appendage cells from neonatal rats (2- to 4-days old; Sprague-Dawley) were cultured as described previously13,26 on 22-mm glass slides in F10 medium. Late pregnant rats were obtained from Charles River Laboratories (L’Arbresle, France) or from the University of Geneva. Experiments were conducted according to the Guide for Care and Use of Laboratory Animals (with approval of the University Ethics Committee and the State of Geneva Veterinary Office).

Plasmid Constructs
Three pcDNA3-EGFP expression vectors were used for encoding preproANP-10aa-EGFP27 (a gift of Edwin Levitan, University of Pittsburgh, Pa), preproANP (Glu23,24->Gln23,24)-10aa-EGFP, and preproANP(45–127)-10aa-EGFP13 (Figure 1A). The 10-aa sequence forms the spacer. Electroporation of these plasmids was successfully performed with a Gene Pulser II (Bio-Rad).13 The amount of fusion protein expressed in atrial secretory vesicles appears sufficiently high to explain their effect on vesicle shape and docking.13 From calibrations with EGFP protein, and the number of prohormone molecules contained in a dense core secretory vesicle,28 the mutated fusion proteins are estimated to be coexpressed in a ratio of at least 1:2 with endogenous proANP.

A new construct, encoding EGFP-PAM-1 preceded by the PAM-1 prosequence (Figure 1B), was made in several steps from the pCIneo plasmid (Promega Corporation, Madison, Wis) containing PAM-1 cDNA (a gift of R. Mains, University of Connecticut, Farmington). First, an ApaI restriction site was inserted by PCR between the prosequence and the PHM domain of full-length PAM-1 cDNA. Two primer pairs: BglII sense (tcgacagatcttcaat), prosequence antisense (atatgggcccaaacctcttaaagacaga); and PHM sense (atatgggcccagtttt-aaagaaactacc), EcoRV antisense (aagcactgatatcgcc; Microsynth, Balgach, CH) were designed to amplify two fragments, BglII/ApaI, including the signal peptide and the prosequence, and ApaI/EcoRV, containing part of the PHM domain. These two fragments were ligated using the engineered ApaI restriction site (shown in italics). The resulting fragment was subcloned in the pCIneoPAM-1 plasmid, replacing the BglII/EcoRV cassette (pCIneoPAM-1/ApaI). Second, to create a 10-aa spacer upstream of the PHM domain, the mutagenesis primer ApaI 10-aa sense (tatagggcccagtatcaaccctccagtagcatttaaagaaact) was designed to overlap the ApaI restriction site on the pCIneoPAM-1/ApaI plasmid and insert 21 new nucleotides overlapping the 5'-PHM domain. Together with the EcoRV primer, a new ApaI-10aa/EcoRV fragment was amplified by mutagenesis PCR. This fragment was subcloned in the pCIneoPAM-1/ApaI plasmid to generate the pCIneoPAM-1/ApaI10aa plasmid. Third, EGFP cDNA was amplified from the pEGFP-N1 plasmid sequence (Clontech, Palo Alto, Calif) by PCR with a primer pair, allowing to create ApaI restriction sites at the 5' and 3' ends of the cDNA and to mutate the ATG and TAA codons. This fragment was subcloned in the pCIneoPAM-1/ApaI and pCIneoPAM-1/ApaI10aa plasmids. The two plasmids, pCIneoPAM-1/ApaI EGFP and pCIneoPAM-1ApaI 10aa EGFP, were electroporated in atrial myocytes and HL-1 cells. Only the construct containing the 10-aa spacer gave rise to EGFP expression; the green fluorescence being localized to ANP-secretory vesicles (Figure 2C).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. Expression of EGFP in secretory vesicles of neonate rat atrial myocytes electroporated with plasmids described in Figure 1A and 1B. A, Serial horizontal optical sections cut through secretory vesicles (A1, A2, and A3) in an atrial myocyte expressing wild-type proANP-EGFP and immunostained for PAM-1 (one optical section of myocyte shown in A4). Note that most vesicles and TGN are double-stained (yellow; example A3), whereas some vesicles show only green fluorescence (A1) or only PAM-1 (red, A2). B, Central portion of atrial myocyte expressing wild-type proANP-EGFP and immunostained for ANP (wide-field image). Nucleus is stained in blue (DAPI), and surrounding TGN and most vesicles are stained yellow-orange (fusion of EGFP, green; and ANP-immunostaining, red). C, Optical section through an atrial myocyte expressing pro-EGFP–PAM-1 and immunostained for ANP. Nucleus is stained in blue (DAPI), and surrounding TGN and most vesicles are stained yellow-orange (fusion of EGFP, green; and ANP-immunostaining, red). D, Staining in Western blots for neonate atrial myocyte cultures (A1 to A6) by anti–PAM-1 as629 (D1), anti–CD-PAM antiserum as571 (D2), and anti-PHM antiserum as475 (D3). Note band at an apparent molecular mass of 125 kDa corresponding to PAM-1 in D1 and two bands ({approx}125 to 130 kDa and 110 kDa) corresponding to PAM-1 and PAM-2 in D2 and D3. A third very faint band (just <90 kDa) represents PAM-3 in D3. Note lack of specific staining for ventricular cultures (V1 and V2). Cultures A4 and A6 were treated for 72 hours by 10 µmol/L PBA (for rationale, see Figure 4C and corresponding text). Control electroporation with EGFP-N1 plasmid yields green fluorescence in cytoplasm and nucleus as expected (not shown). The optical sections were obtained after Huygens deconvolution of wide-field images or directly acquired using a spinning wheel confocal head (see Materials and Methods).

Treatment of Atrial Myocytes With 4-Phenyl-3-Butenoic Acid
Vehicle or 4-phenyl-3-butenoic acid (PBA) (10 µmol/L), the most potent irreversible, mechanism-based PHM inactivator known,29 was added to new culture medium each day. As a control experiment, the effects of PBA were tested on another regulated secretory system, the inwardly rectifying potassium channel KIR2.1,30,31 unrelated to proANP and without interactions with PAM-1.32 The exocytosis of EGFP-KIR2.1 was compared in 27 atrial myocytes treated with PBA or vehicle, as described in the legend to Figure 6.

Imaging
Protocols
Between 16 and 50 hours after electroporation, the cultures were placed in HEPES-containing buffer (mmol/L: KCl, 5; CaCl2, 1; MgCl2, 1; NaCl, 118; glucose, 2.5; HEPES, 10; NaOH to pH 7.3; sucrose to290 milliosmol/kgH2O) on a temperature-controlled (30°C to 35°C) stage of a wide-field Nikon-DV200 Diaphot microscope.13 After imaging, the cells were fixed for 15 minutes in 2% paraformaldehyde and stored in PBS and darkness at 4°C until immunolabeling.

Acquisition
Image acquisition was performed with Metamorph software (Universal Imaging) at a monochromatic excitation of 480 nm (EGFP) or 575 nm (Texas Red) (±6-nm bandwidth),13 with illumination times of usually 500 ms (range 300 to 1000 ms). Forty to 80 optical sections were obtained at 150-nm vertical steps. The z-scan image stacks were deconvoluted using Huygens software (Bitplane) by the iterative constrained Tikhonov–Miller procedure and superposed by Metamorph software.13 Confocal optical sections were also acquired directly using laser excitations at 488 nm and 568 nm, a Nikon Diaphot 300 inverted microscope with a NA 1.3 x100 oil objective, a QLC100 spinning wheel confocal head (VisiTech International), and a Coolsnap HQ cooled charge-coupled device (CCD) camera (Visitron Systems). The pixel size (at 2x2 binning) in the x-y plane was 129 nm.

Measurement of Shape and Docking
The shape of live, peripherally located vesicles in time lapses or z scans was analyzed by zooming first at 150% and then at 800% (using edit-duplicate-stack-with-zoom function; MetaMorph). For each vesicle, gamma and contrast were adjusted from 1 to 5.43 and from 50 to 70, respectively, before automatic contour fitting. Each vesicle was coded by a number and classified twice by two observers as round when more than 50% of all contours were round. In controls, between 50% and 60% of vesicles were classified as round. Vesicles were classified as docked when the vesicles remained immobile in the periphery of the cell and over the total recording period; otherwise, they were classified as moving. A peripheral location was chosen so that secretory vesicles would not be confused with vesicles bulging from the TGN; the vesicles were close to the cell membrane, thus increasing the likelihood that they were docked. It was unavoidable that some vesicles that were close to the membrane but not docked could not be distinguished from truly docked vesicles.

Immunostaining
To study colocalization of green fluorescence with ANP, PAM-1, or CD-PAM, the fixed cultures were pretreated with 1% normal serum and one of the following primary antibodies was applied (4 days at 4°C): rabbit anti-rat ANP antiserum (IHC9103; Peninsula Europe) (dilution 1:1000); rabbit polyclonal antiserum to exon A of PAM-1 (No. 629; 1:5000)33; or C-terminal domain of PAMs (No. 571; 1:1500).33 The primary antibodies were visualized with Texas Red-X–labeled or Alexa594-labeled goat anti-rabbit {gamma}-globulin (Santa Cruz or Molecular Probes; 1:200 to 1:400). Separation of green and red fluorescence was achieved using Nikon filters as described previously.13 Controls included application of nonimmune serum. Nuclei were stained with 4',6-diamidino-2-phenylindole dihydrochloride (DAPI) (D-1306; Molecular Probes). For example, an atrial myocyte expressing proANP-EGFP and stained for PAM-1 is shown in Figure 2A; another expressing proANP-EGFP and stained for ANP and DAPI, in Figure 2B; and a third expressing pro-EGFP–PAM-1 and stained for ANP and DAPI, in Figure 2C.

Western Blots
Western blots were performed similarly as described previously,13 using anti–PAM-1 antiserum 629 (1:2000 to 1:4000), anti–CD-PAM antiserum 571 (1:1000), and anti-PHM antiserum 475 (1:1000) (Figure 1C). For comparison purposes, each lane was loaded with the same amount of total protein (20 µg). All Western blots shown are from originally stained, nonstripped membranes.

Statistics
The analysis of colocalization and of vesicle shape was performed on a total of 2992 vesicles in 335 atrial myocytes. The analysis of vesicle docking was performed on a total of 4813 vesicles in an overlapping population of 170 myocytes. The analysis was divided into two parts: (1) colocalization of proANP-EGFP or pro-EGFP–PAM-1 fusion proteins with PAM or ANP immunostaining; and (2) tests with the PHM inhibitor PBA. Results were displayed as histograms of weighted averages. Differences were analyzed for statistically significant differences by ANOVA tests on ranked data using SAS software from the SAS Institute (Carey, NC), the nonparametric Mann–Whitney U test, or {chi}2 test.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowConclusion
down arrowReferences
 
Characterization of Experimental System
We used a cDNA construct encoding a fusion protein of proANP-EGFP27 that was localized by immunoelectron microscopy in dense core vesicles of atrial myocytes.13 A potential protease site at the C terminus of the proANP was replaced with a 10-aa spacer (GPGINPPVAT) to prevent cleavage of proANP-EGFP.27 As control, we electroporated myocytes with the proANP-EGFP expression vector and labeled the cells with an antibody directed against ANP. The great majority of cells, 88.8±2.3%, were labeled by EGFP as well as by anti-ANP antibody. An example is shown in Figure 2B, where the superposition of EGFP with ANP (red) yields yellow-orange vesicles and TGN surrounding the DAPI-stained (blue) nucleus. To further address the question of cleavage, the proANP-EGFP was expressed in HL-1 atrial myocytes. Western blots for EGFP showed a band corresponding to the intact proANP-EGFP fusion protein, confirming our previous study13 (not shown). Analogous results were obtained with the pro-EGFP–PAM-1 expression vector (eg, Figure 2C; Western blot not shown). Furthermore, Western blots for endogenous PAM-1 for atrial but not ventricular culture extracts showed a major band {approx}125 kDa (Figure 2D1). Blots for CD-PAM displayed two major bands for atrial but not ventricular culture extracts {approx}125 kDa and 110 kDa (Figure 2D2). A nonspecific band of lower molecular mass appeared for all extracts. Blots for PHM showed, in four atrial extracts, a weak band {approx}125 to 130 kDa, a strong band {approx}110 kDa, and a very faint band {approx}90 kDa (Figure 2D3). Previous reports19,33 indicate that these bands correspond to PAM-1 (Figure 2D1), PAM-1 and PAM-2 (Figure 2D2), and PAM-1, PAM-2, and PAM-3 (Figure 2D3). Small amounts of PAM-3 in atrium (Figure 2D3) have been reported previously.19 Thus neither proANP-EGFP, nor pro-EGFP–PAM-1, nor endogenous PAM proteins are cleaved to a major degree in our culture system, as anticipated from previous reports.3,13,18,20

Effects of ProANP Mutations on Colocalization With PAM Proteins
We tested the hypothesis that point mutations or total deletion of the calcium-binding sequence of proANP would disrupt the aggregation of proANP and thus inhibit recruitment of PAM proteins. In 47 myocytes (435 vesicles), we examined whether these mutations suppressed the colocalization with PAM-1 (Figure 3A) and in 46 myocytes (469 vesicles), the colocalization with CD-PAM (Figure 3B). A wild-type proANP-EGFP–expressing myocyte is shown in Figure 2A, indicating a high degree of colocalization with PAM-1. Overall, there was a majority of vesicles (83.9%) where proANP-EGFP was colocalized with PAM-1 and a minority (16.1%) where proANP-EGFP was expressed alone (Figure 3A1). Point mutations (Glu23,24->Gln23,24) or deletion of the calcium-binding N-terminal 44 aa reduced the proportion of PAM-1 colabeled vesicles to 58.7% ({chi}2=10.3; DF=1; P<0.01) and 33.2% ({chi}2=38.1; DF=1; P<0.001), respectively (Figure 3A2 and 3A3). Examples for such vesicles are shown in the top panels of Figure 3A. A slight decrease in anti–CD-PAM labeling was observed with the proANP mutations; a majority of vesicles being double-labeled: 92.2% for intact proANP; 89% for Glu23,24-mutated proANP (Figure 3B2); and 84.7% for N-terminal–deleted proANP (Figure 3B3; {chi}2=4.3; DF=1; P<0.05). Because the CD-PAM antiserum labels PAM-1 and PAM-2, an estimate was made whether this decrease in colocalization could also have been attributable to PAM-2. In Western blots, PAM-1 accounts for 27.5±9.6% (mean±SEM, n=3) of PAM-1 plus PAM-2. If recruitment of PAM-1 alone was affected by deletion of N-terminal proANP, it is calculated that CD-PAM should colabel 76.9% of the green fluorescent vesicles, close to the 84.7% observed. The difference is within the margin of error of the measurements.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 3. Mutation or deletion of N-terminal proANP disrupts recruitment of PAM-1 to secretory vesicles. Atrial myocytes were electroporated before plating with one of the constructs coding for green fluorescent fusion proteins (see top of panels and Figure 1A), fixed 2 to 3 days later, and stained with anti–PAM-1 antiserum (A1, A2, and A3) or anti–CD-PAM antiserum (B1, B2, and B3). Stacks of confocal optical sections were obtained for green and red fluorescence and superposed to check for double-labeling of the vesicles. Top panels each show 20 different vesicles (one section per vesicle), randomly selected from proportional pools of green and double-labeled (yellow) fluorescent vesicles. Lower panels each show mean percent per cell±SEM of green and yellow fluorescent vesicles. A, Labeling by anti–PAM-1 as629 of 435 secretory vesicles containing intact (wild-type) proANP-EGFP (A1), mutated proANP-EGFP (A2), and N-terminal–deleted proANP-EGFP (A3). Total numbers of vesicles analyzed were 62 (A1), 75 (A2), and 298 (A3). Percentage of colabeled vesicles decreases significantly in A2 and A3 relative to wild type (*P<0.01, **P<0.001, {chi}2 test; P<0.015 for N-terminal deletion, ANOVA). B, labeling by anti–CD-PAM as571 of 469 secretory vesicles containing wild-type, mutated, and N-terminal–deleted proANP-EGFP (see above). Total numbers of vesicles analyzed were 153 (B1), 146 (B2), and 170 (B3). Percentage of colabeled vesicles decreases slightly from B1 to B3 (*P<0.05, {chi}2 test).

Effect of PHM Inhibitor PBA on Recruitment of PAM-1
We next tested whether PBA29,34 would modify recruitment of PAM-1 to secretory vesicles, in a total of 26 atrial myocytes (834 vesicles) expressing proANP-EGFP and treated for 72 hours with 10 µmol/L PBA or vehicle. Figure 4A1 shows that PBA strongly increased the mean percentage of PAM-1 negative green fluorescent vesicles per cell ({chi}2=12.3; DF=1; P<0.01). Figure 4A2 illustrates for individual myocytes that PBA produced a major shift toward PAM-1 negative vesicles, indicating a loss of recruitment of PAM-1. Microphotographs of Figure 4A3 illustrate that in a vehicle-treated myocytes (control), all EGFP-positive vesicles were labeled by anti–PAM-1 antiserum. In the PBA-treated myocyte, a few EGFP-positive vesicles were also labeled by anti–PAM-1 antiserum, but even strongly EGFP-positive vesicles were not stained at all. As a control, Figure 4B shows that PBA did not decrease the maximal immunofluorescence intensity for PAM-1 in TGN and vesicles; thus the difference in PAM-1 immunostaining of the vesicles in Figure 4A was not attributable to major changes in staining procedures. In another control, Western blots show that PBA did not produce a major change in the content of PAM-1 (Figure 4C) nor PHM (Figure 2D3) in atrial culture extracts. PBA had little effect on CD-PAM staining of secretory vesicles. Following PBA treatment, 83.2±7.3% of proANP-EGFP–expressing vesicles per cell were colabeled by CD-PAM antiserum (n=7 myocytes, 276 vesicles), similar to the percentage shown for vesicles expressing N-terminal truncated proANP-EGFP (Figure 3B3).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. Inhibitor (PBA) of PHM disrupts recruitment of PAM-1 to secretory vesicles. Atrial myocytes expressing wild-type proANP-EGFP were treated for 72 hours with 10 µmol/L PBA or vehicle (control), fixed, and stained for PAM-1; stacks of confocal optical sections were obtained for green and red fluorescence and superposed to check for double-labeling of the vesicles. A1, PBA treatment increases the mean percentage of PAM-1–negative green fluorescent vesicles per cell relative to control (**P<0.001; {chi}2 test). A2, Circles, each representing one cell, show the number of PAM-1–positive EGFP-labeled vesicles vs the number of PAM-1–negative EGFP-labeled vesicles (26 atrial myocytes, 834 vesicles). Note mostly double-labeled vesicles for controls and large numbers of PAM-1–negative green fluorescent vesicles for PBA-treated myocytes. Large circles show widely separated sample means (±SEM). A3, Microphotographs of part of a control cell (left) show that all EGFP vesicles were costained by PAM-1 antiserum; only half are costained in a PBA-treated myocyte (right). Image widths are 6.32 µm; heights, 8.64 µm. B, PAM-1 immunostaining for the 26 cells shown in A2 indicate similar relationships between vesicle and TGN-staining intensity for controls and PBA-treated cells. Mean fluorescence for four maximally stained vesicles was plotted as a function of the mean fluorescence of four maximally stained locations of TGN. Sample means are not statistically different. Numbers on scales refer to background-corrected CCD units of the camera normalized per 1000-ms exposure time. These results show that large differences in double-labeling (A2) could not have been attributable to technical differences in PAM-1 immunostaining. C, Western blot of PAM-1 (as629) for four separate atrial cell cultures: two controls (C) and two cultures treated with PBA for 72 hours (P); E are empty lanes. PBA had little effect on PAM-1 protein content, as suggested by B.

Effect of PBA on Recruitment of Pro-EGFP–PAM-1
In another experimental approach, we tested whether recruitment of pro-EGFP–PAM-1 to proANP vesicles was also affected by PBA. Pro-EGFP–PAM-1 was expressed in atrial myocytes, and these were treated for 3 days with PBA or vehicle (Figure 5). Most, if not all, green fluorescent vesicles were double-labeled for ANP, in both the controls and PBA-treated myocytes, presumably because of the extremely strong signal for ANP immunostaining. An example for a control is shown in Figure 2C; and for a PBA treated myocyte, in Figure 5A. However, PBA significantly changed the distribution of 180 secretory vesicles analyzed in 18 atrial myocytes (Figure 5B1), where the fluorescence intensity of EGFP was plotted as a function of ANP immunostaining. PBA thus reduced by approximately half the green fluorescence intensity relative to ANP (Figure 5B2).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. Inhibitor (PBA) of PHM decreases recruitment of pro-EGFP–PAM-1 to ANP-containing vesicles. Atrial myocytes expressing pro-EGFP–PAM-1 were treated for 72 hours with 10 µmol/L PBA or vehicle (control), fixed, and immunostained for ANP; stacks of confocal optical sections were obtained for green and red fluorescence and superposed to check for double-labeling of the vesicles. For each of 18 myocytes (9 controls, 9 PBA-treated), 10 vesicles that displayed the highest green fluorescence intensity were analyzed for coexpressed red fluorescence intensity. The background-corrected fluorescence intensities (in CCD units) were normalized to the exposure time used in the image acquisition. The intensity of laser excitation was the same throughout. A, Confocal optical section through a PBA-treated myocyte acquired at 488-nm excitation (top, pro-EGFP–PAM-1) and at 568 nm (bottom, ANP). Note that practically all vesicles are double-labeled, even though the cell was treated with PBA. Because this was true for all PBA-treated myocytes and the controls, green and red fluorescence intensities were quantified in B. B1, Plot of green fluorescence intensity of pro-EGFP–PAM-1 as a function of red fluorescence intensity (ANP) for each of 180 vesicles. Note significantly different distribution for controls and PBA treatment (P<0.01; {chi}2=12.1; DF=3). Distributions remained significantly different (P<0.001; {chi}2=29.3; DF=3) when the ANP values ranged from 250 to 780 CCD units/sec. Thus, for a similar ANP content, the vesicles recruited significantly less pro-EGFP–PAM-1. B2, Mean pro-EGFP–PAM-1/ANP ratio for 90 control vesicles and 90 vesicles from PBA-treated myocytes. Note significant decrease with PBA (*P<0.05, Mann–Whitney U test).

Control Experiment Testing the Effect of PBA on Another Secretory System: Exocytosis of KIR2.1
Would PBA indiscriminately affect other secretory systems? As is the case for many transporters and channels, the exocytosis of the potassium inward rectifiers KIR2.x can be regulated (see Zitron et al30 and Malinowska et al31 for citations). The choice of KIR2.1 has the advantage that none of its numerous interacting partners includes PAM, as recently shown.32 Constructs encoding fusion proteins of KIR2.1 with EGFP were electroporated into atrial myocytes (Figure 6). After 3 days, green fluorescence was equally detectable in the plasma membrane of vehicle- or PBA-treated myocytes (examples in Figure 6A1 and 6A2). Quantification with line scans (Figure 6B1 and 6B2) showed there was no significant difference in membrane relative to intracellular green fluorescence intensity between 13 controls and 14 PBA-treated myocytes (Figure 6C1 and 6C2).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 6. Control experiment showing that PHM inhibitor PBA has no effect on exocytosis of KIR2.1 potassium channel. Atrial myocytes were electroporated with cDNA encoding EGFP-dnKIR2.1, a construct made from pCMV-Script-KCNJ2-R67W41 (a gift from Dr Alfred L. George [Vanderbilt University, Nashville, Tenn]) or electroporated with cDNA encoding EGFP-KIR2.142 (a gift from Dr Eduardo Marbán, Johns Hopkins University, Baltimore, Md) and treated with PBA or vehicle until image acquisition (72 hours). Confocal image stacks were acquired on live green fluorescent myocytes, and fluorescence intensity of the plasma membrane and cell interior was analyzed with Metamorph software. A1, Confocal optical section through a control myocyte, showing strong labeling of plasma membrane. A2, Confocal optical section through a PBA-treated myocyte, showing equally strong labeling of plasma membrane; staining of perinuclear region was variable and not related to PBA. B1 and B2, Corresponding line scans showing peak green fluorescence levels at plasma membrane (PM); scans shown here were taken in lower third of pictures. Scans were obtained at five different z levels of each cell, and average background corrected intensities, normalized to the illumination time, were obtained for each cell at the plasma membrane and within the cell interior (C). C1, Mean ratio (PM/C) of green fluorescence at plasma membrane relative to cell interior for 13 controls and 14 PBA-treated myocytes. There was no difference in fluorescence intensities of EGFP-dnKIR2.1 and EGFP-KIR2.1 cells; both were included in the averages and labeled EGFP-(dn)KIR2.1. C2, Mean levels of green fluorescence within cells. There was no difference (ns) in ratio (C1) or PAM-1 cell content (C2) between controls and PBA-treated cells.

Effect of PBA on Shape and Docking of ProANP Vesicles in Live Myocytes
We tested in 136 myocytes, on 798 proANP-EGFP vesicles, whether 10 µmol/L PBA would change vesicle shape or docking. The proportion of deformed vesicles in vehicle-treated cells remained stable: 42.2% at 48 hours; 51.4% at 72 hours; and 52.2% at 96 hours (Figure 7A; examples in top panels). After 3 days of treatment, PBA produced a major change in vesicle shape, in a majority of spherical vesicles, to irregular (deformed) vesicles. The proportion of deformed vesicles increased from 52.1% at 48 hours to 82.4% at 72 hours ({chi}2=25.5; DF=1; P<0.001) and 73.7% at 96 hours ({chi}2=9.1; DF=1; P<0.01). We then tracked the movements of 4813 secretory vesicles in a total of 170 live myocytes (Figure 7B). There was no difference in the proportion of mobile vesicles of controls versus PBA-treated cells during the experiment: 79.9% versus 82.5% at 48 hours; 81.9% versus 84.8% at 72 hours; 85.2% versus 83.5% at 96 hours.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 7. Inhibitor (PBA) of PHM induces a deformation of secretory vesicles in live cells. Atrial myocytes expressing wild-type proANP-EGFP were treated daily with 10 µmol/L PBA or vehicle, starting on day 1. Serial optical sections (z stacks) and time-lapse sequences (2- to 5-second intervals) were acquired on live green fluorescent myocytes at times indicated on top. Vesicles were analyzed for shape and mobility as described in Materials and Methods. A, Mean percentage of round (white columns) and deformed vesicles (black columns) per cell in controls and PBA-treated myocytes after 2 days (A1), 3 days (A2), and 4 days (A3) of treatment (*P<0.01, **P<0.001, {chi}2 test) relative to time control. ANOVA shows significant effect of PBA relative to control in A1 (P<0.02) and A2 (P<0.01). Top panels each show 20 vesicles (one section per vesicle) selected randomly from proportional pools of round and deformed vesicles of PBA-treated cells. Total numbers of vesicles analyzed were 367 (A1), 232 (A2), and 199 (A3). Note large proportion of deformed vesicles after 72 hours of PBA treatment. B, Mean percentage of docked (white columns) and mobile vesicles (hatched columns) per cell in controls and PBA-treated live atrial myocytes after 2 days (B1), 3 days (B2), and 4 days (B3) of treatment. Total numbers of vesicles analyzed were 1933 (B1), 1275 (B2), and 1605 (B3). For both A and B, only peripheral vesicles were analyzed, avoiding the centrally located tubular structures of the TGN. Note lack of effect of PBA on mobility.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowConclusion
down arrowReferences
 
ProANP, PAM-1, and PAM-2 are highly abundant proteins of the cardiac atrium,3,17–19 contained in the lumen and membrane, respectively, of the same secretory vesicles.35 The reasons for this intriguing, intimate relationship between proANP and PAM have remained unclear. The aims of this work were to test in living myocytes whether the calcium-dependent aggregation of proANP5,6 and the lumenal domain of PAM were required to recruit PAM-1 and PAM-2 to the vesicle membrane and, conversely, whether PAM proteins contributed to the genesis and docking of proANP vesicles. We show that recruitment of PAM-1, but not PAM-2, depends on an intact calcium-binding N-terminal sequence of proANP. We go on to show that PBA, a pharmacological inhibitor of PAM, inhibits recruitment of PAM-1 but not PAM-2, induces a deformation of the secretory vesicles, and has no effect on docking. These novel findings, summarized in Figure 8, were obtained on neonate atrial myocytes in culture, a favorable model for studying the cardiac secretory pathway.13,17–19,36



View larger version (20K):
[in this window]
[in a new window]
 
Figure 8. Summary of current and previous data: simple interpretation how PAM proteins target proANP containing secretory vesicles and contribute to the shaping process. The cartoons are representative for the majority of vesicles and show changes in shape and docking for various experimental conditions. A, Wild-type proANP has aggregated via interaction with calcium5,6; PAM-1, recruited by surface motifs of the proANP core, has wrapped TGN membrane around the aggregate to form the vesicle; hypothetical docking receptors (DR), also recruited by proANP core, recognize docking protein (DP) on the plasma membrane (PM) and allow vesicle to dock. B, Wild-type proANP forms proANP aggregate, but coexpressed mutated or N-terminal–deleted proANP cannot aggregate and is diluted in proANP core and surrounding fluid13; far less PAM-1 and fewer docking receptors are recruited because of the surrounding fluid; thus the vesicle is deformed and does not dock.13 C, Wild-type proANP has aggregated, thus recruiting docking receptors; effect of PBA inhibits recruitment of PAM-1 (PAM-1* refers to PBA-altered PAM-1); thus vesicles can dock but are deformed.

Recruitment of PAM-1 to Secretory Vesicles Is Inhibited by Mutations of the Calcium-Binding Domain of ProANP and by PBA
How do PAM-1 and PAM-2 target the atrial secretory vesicle membrane? At least two possibilities exist, or may coexist. First, the protein kinase PAM C-terminal interacting protein24 can bind tightly to the C-terminal cytosolic juxtamembrane domain of PAM-1 and PAM-2, and phosphorylate PAM-1 on Ser949.37 This may facilitate the aggregation of PAM-1 (see below) and recruitment of PAM-1 to secretory vesicles in AtT-20 cells. Ser949 phosphorylation also favors retrieval of PAM-1 from the plasma membrane onto endocytotic vesicles and/or retention of PAM-1 in the TGN. Second, it is reported that PAM-3, the soluble form of PAM-1 and PAM-2, precipitates either by itself or with lumenal cargo proteins at ionic conditions prevailing in the TGN,25 suggesting that the lumenal domain of PAM-1 could do likewise. From our data and these previous studies,24,25,37 we propose that PAM-1 is recruited to the proANP aggregate, either by coprecipitating with proANP on the surface of the aggregate or by recognizing surface motifs of the aggregate (Figure 8A). We base this suggestion on the following findings. When aggregation of proANP is perturbed by deletion or mutation of its calcium-binding domain,5,6 recruitment of PAM-1 to secretory vesicles is strongly diminished (Figure 3A), as illustrated in Figure 8B. The recruitment of PAM-1 is also diminished by PBA, as shown by two different experimental approaches. First, PBA reduces the colocalization of proANP-EGFP and PAM-1 on secretory vesicles (Figure 4A); and second, PBA reduces the colocalization of pro-EGFP–PAM-1 and ANP on secretory vesicles (Figure 5B). Interestingly, PBA has no effect on the exocytosis of KIR2.1 (Figure 6), suggesting that the actions of PBA may be confined to PAM. The mechanism of action of PBA in our experiments is not yet known. It is not established whether PAM-1 is functionally active within the TGN or the secretory vesicles, the more so because a substrate has not yet been identified. Changes in enzymatic activity of PHM in extracts were not measured here, because we would not have been able to distinguish between any changes occurring in TGN or secretory vesicles; the purification of secretory vesicles from atrial cell cultures has remained elusive so far. As an alternative possibility, the action of PBA on PHM may alter the conformation of PAM-1 (illustrated in Figure 8C) and thus inhibit the interaction between PHM and N-terminal proANP.

The recruitment of PAM-2 apparently does not depend on the aggregation of proANP. This is based on the finding that the staining of secretory vesicles with CD-PAM antiserum decreases only slightly with deletion or mutation of the N-terminal sequence of proANP (Figure 3B). The CD-PAM antiserum recognizes both PAM-1 and PAM-2. This report shows that PAM-1 accounts for 27.5% of the total amount of PAM-1 and PAM-2 in atrial myocytes, confirming previous studies.19,35,38 The slight decrease in staining can thus be attributed entirely to the loss of recruitment of PAM-1. The cytosolic routing motifs of PAM-2 (citations in24) may be sufficient for targeting PAM-2 to secretory vesicles, irrespective of potential interactions with proANP. The difference between PAM-1 and PAM-2 is the exon A sequence in PAM-1, located downstream of the PHM domain. It is speculated that the presence of exon A facilitates the interaction between PAM-1 and proANP. A potential influence of exon A on the conformation of PHM would explain why PBA inhibits recruitment of PAM-1 but not PAM-2 to secretory vesicles, even though PBA has the same site of action (PHM) in PAM-1 and PAM-2. Alternatively, exon A might interact with proANP; the effect of PBA would then be explained by a PBA-induced change in conformation of exon A. Further experiments are needed to clearly define the protein-protein interactions between proANP and PAM.

Role of PAM in Shaping Atrial Secretory Vesicles
Mutation or deletion of the calcium-binding N-terminal proANP results in deformation of atrial secretory vesicles.13 One explanation is that coexpressed N-terminal–mutated or N-terminal–deleted proANP would be unable to precipitate with endogenous proANP, thus strongly diminishing the interaction between proANP and a hypothetical integral vesicle membrane protein.13 As a consequence, packaging of the vesicle core by TGN membrane would be deranged, and the vesicle would be deformed. The new results support this hypothesis. Figure 7A shows that a 3-day treatment with PBA causes a striking increase in deformed secretory vesicles, suggesting that PBA, by perturbing the interaction between PAM-1 and proANP (see above) and diminishing the recruitment of PAM-1 (Figure 4A), deranges the ordered packaging of the vesicle core (illustrated in Figure 8C). Alternatively, PBA may inhibit the conversion of an unknown substrate to a product that participates in shaping the secretory vesicle. Recently, proteins have been identified, endowed with a so-called BAR domain, that impose curvature on biological membranes and thus shape the nascent vesicle.39 A tyrosine phosphatase, protein tyrosine phosphatase-MEG2, has been found whose overexpression causes a striking enlargement of secretory vesicles in rat basophilic mast cells and Jurkat T leukemia cells.40 To what degree integral vesicle transmembrane proteins may interact with PHM products, BAR (Bin/Amphiphysin/Rvs) domain proteins, or tyrosine phosphatases to shape the secretory vesicles remains open to investigation.

Is PAM Involved in Vesicle Docking?
Our previous study13 showed that deletion or mutation of N-terminal proANP not only deformed the secretory vesicles but also strongly diminished docking (illustrated in Figure 8B). Vesicle docking was thought to result from an interaction of docking receptors with plasma membrane docking proteins, and the lack of docking was attributed to suppression of recruitment of docking receptors. To test whether PAM could represent this docking receptor, vesicles were analyzed after 2 to 4 days of PBA treatment. This clearly reduced recruitment of PAM-1 and deformed a majority of secretory vesicles but had no effect on vesicle docking (Figure 7B), suggesting that PAM-1 is not likely to be involved in vesicle docking. So far, PAM-2 also is an unlikely candidate, because recruitment of PAM-2 is not affected by mutations of N-terminal proANP that are associated with decreased docking.13 A recent study on atrial secretory vesicle associated proteins38 should open the way to exploring several new candidates.


*    Conclusion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*Conclusion
down arrowReferences
 
PAM proteins have long been suspected to play a role in the secretory pathway of the heart atrium and to be recruited to secretory vesicles via their C-terminal domain19,23,35 (also see the introduction). In this study, we show that PAM-1 is recruited to the atrial vesicles via an additional mechanism, most likely via interactions of its lumenal domain with the calcium-binding domain of proANP. PAM-1 is involved in shaping the ANP-secretory vesicles, because the lack of recruitment of PAM-1 is associated with a high proportion of deformed ANP-secretory vesicles. The results further suggest that proteins distinct from PAM are involved in docking.


*    Acknowledgments
 
This study was supported by Swiss National Science Foundation grant 31-066838.01, the Swiss University Conference project "Heart Remodeling in Health and Disease," the Carlos and Elsie de Reuter Foundation, the Geneva Academy of Sciences, the Novartis Research Foundation, the Swiss Heart Foundation, and the Gustave Prevot Foundation. Dr Robert Mains (University of Connecticut, Farmington) is gratefully acknowledged as the source of anti-PAM antisera and of the PAM-1 cDNA used in this study. We thank the Institute of Molecular Cardiobiology, Johns Hopkins Medical School (Baltimore, Md), for the EGFP-KIR2.1 construct and Dr Alfred L. George (Vanderbilt University, Nashville, Tenn) for the pCMV-Script-KCNJ2-R67W construct.


*    Footnotes
 
Original received March 22, 2004; resubmission received July 2, 2004; revised resubmission received October 21, 2004; accepted November 2, 2004.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
up arrowConclusion
*References
 
1. de Bold AJ, Flynn TG. Cardionatrin I—a novel heart peptide with potent diuretic and natriuretic properties. Life Sci. 1983; 33: 297–302.[CrossRef][Medline] [Order article via Infotrieve]

2. Wilkins MR, Redondo J, and Brown LA. The natriuretic-peptide family. Lancet. 1997; 349: 1307–1310.[CrossRef][Medline] [Order article via Infotrieve]

3. Levin ER, Gardner DG, Samson WK. Natriuretic peptides. N Engl J Med. 1998; 339: 321–328.[Free Full Text]

4. Jiao JH, Baertschi AJ. Neural control of the endocrine rat heart. Proc Natl Acad Sci U S A. 1993; 90: 7799–7803.[Abstract/Free Full Text]

5. Thibault G, Doubell AF. Binding and aggregation of pro-atrial natriuretic factor by calcium. Am J Physiol. 1992; 2: C907–C915.

6. Canaff L, Brechler V, Reudelhuber TL, Thibault G. Secretory granule targeting of atrial natriuretic peptide correlates with its calcium-mediated aggregation. Proc Natl Acad Sci U S A. 1996; 93: 9483–9487.[Abstract/Free Full Text]

7. Jamieson JD, Palade GE. Specific granules in atrial muscle cells. J Cell Biol. 1964; 23: 151–172.[Abstract/Free Full Text]

8. Gerdes H-H, Glombik MM. Signal-mediated sorting to the regulated pathway of protein secretion. Anat Anz. 1999; 181: 447–453.[Medline] [Order article via Infotrieve]

9. Arvan P, Castle D. Sorting and storage during secretory granule biogenesis: looking backward and looking forward. Biochem J. 1998; 332: 593–610.[Medline] [Order article via Infotrieve]

10. Thiele C, Huttner WB. Protein and lipid sorting from the trans-Golgi network to secretory granules: recent developments. Semin Cell Dev Biol. 1998; 9: 511–516.[CrossRef][Medline] [Order article via Infotrieve]

11. Tooze SA. Biogenesis of secretory granules in the trans-Golgi network of neuroendocrine and endocrine cells. Biochim Biophys Acta. 1998; 1404: 231–244.[Medline] [Order article via Infotrieve]

12. Kuiper RP, Martens GJM. Prohormone transport through the secretory pathway of neuroendocrine cells. Biochem Cell Biol. 2000; 78: 289–298.[CrossRef][Medline] [Order article via Infotrieve]

13. Baertschi AJ, Monnier D, Schmidt U, Levitan ES, Fakan S, Roatti A. Acid prohormone sequence determines size, shape, and docking of secretory vesicles in atrial myocytes. Circ Res. 2001; 89: E23–E29.[CrossRef][Medline] [Order article via Infotrieve]

14. Bonifacino JS, Glick BS. The mechanisms of vesicle budding and fusion. Cell. 2004; 116: 153–166.[CrossRef][Medline] [Order article via Infotrieve]

15. Bennett MK, Scheller RH. The molecular machinery for secretion is conserved from yeast to neurons. Proc Natl Acad Sci U S A. 1993; 90: 2559–2563.[Abstract/Free Full Text]

16. Prigge ST, Mains RE, Eipper BA, Amzel LM. New insights into copper monooxygenases and peptide amidation: structure, mechanism and function. Cell Mol Life Sci. 2000; 57: 1236–1259.[CrossRef][Medline] [Order article via Infotrieve]

17. Eipper BA, May V, Braas KM. Membrane-associated peptidylglycine alpha-amidating monooxygenase in the heart. J Biol Chem. 1988; 263: 8371–8379.[Abstract/Free Full Text]

18. Stoffers DA, Green CB, Eipper BA. Alternative mRNA splicing generates multiple forms of peptidyl-glycine alpha-amidating monooxygenase in rat atrium. Proc Natl Acad Sci U S A. 1989; 86: 735–739.[Abstract/Free Full Text]

19. Maltese JY, Eipper BA. Developmental expression of peptidylglycine alpha-amidating monooxygenase (PAM) in primary cultures of neonatal rat cardiocytes: a model for studying regulation of PAM expression in the rat heart. Mol Endocrinol. 1992; 6: 1998–2008.[Abstract/Free Full Text]

20. Braas KM, Stoffers DA, Eipper BA, May V. Tissue specific expression of rat peptidylglycine alpha-amidating monooxygenase activity and mRNA. Mol Endocrinol. 1989; 3: 1387–1398.[Abstract/Free Full Text]

21. Bell-Parikh LC, Eipper BA, Mains RE. Response of an integral granule membrane protein to changes in pH. J Biol Chem. 2001; 276: 29854–29863.[Abstract/Free Full Text]

22. Alam MR, Steveson TC, Johnson RC, Back N, Abraham B, Mains RE, Eipper BA. Signaling mediated by the cytosolic domain of peptidylglycine alpha-amidating monooxygenase. Mol Biol Cell. 2001; 12: 629–644.[Abstract/Free Full Text]

23. Steveson TC, Keutmann HT, Mains RE, Eipper BA. Phosphorylation of cytosolic domain Ser(937) affects both biosynthetic and endocytic trafficking of peptidylglycine alpha-amidating monooxygenase. J Biol Chem. 1999; 274: 21128–21138.[Abstract/Free Full Text]

24. Alam MR, Caldwell BD, Johnson RC, Darlington DN, Mains RE, Eipper BA. Novel proteins that interact with the COOH-terminal cytosolic routing determinants of an integral membrane peptide-processing enzyme. J Biol Chem. 1996; 271: 28636–28640.[Abstract/Free Full Text]

25. Colomer V, Kicska GA, Rindler MJ. Secretory granule content proteins and the luminal domains of granule membrane proteins aggregate in vitro at mildly acidic pH. J Biol Chem. 1996; 271: 48–55.[Abstract/Free Full Text]

26. Jiao JH, Baumann P, Baron A, Roatti A, Pence RA, Baertschi AJ. Sulfonylurea receptor ligands modulate stretch-induced ANF secretion in rat atrial myocyte culture. Am J Physiol. 2000; 278: H2028–H2038.

27. Burke NV, Han W, Li D, Takimoto K, Watkins SC, Levitan ES. Neuronal peptide release is limited by secretory granule mobility. Neuron. 1997; 19: 1095–1102.[CrossRef][Medline] [Order article via Infotrieve]

28. Howell SL. The mechanism of insulin secretion. Diabetologia. 1984; 26: 319–327.[Medline] [Order article via Infotrieve]

29. Driscoll WJ, Konig S, Fales HM, Pannell LK, Eipper BA, Mueller GP. Peptidylglycine-alpha-hydroxylating monooxygenase generates two hydroxylated products from its mechanism-based suicide substrate, 4-phenyl-3-butenoic acid. Biochemistry. 2000; 39: 8007–8016.[CrossRef][Medline] [Order article via Infotrieve]

30. Zitron E, Kiesecker C, Lück S, Kathöfer S, Thomas D, Kreye VAW, Kiehn J, Katus HA, Schoels W, Karle CA. Human cardiac inwardly rectifying current IKIR2.2 is upregulated by activation of protein kinase A. Cardiovasc Res. 2004; 63: 520–527.[Abstract/Free Full Text]

31. Malinowska DH, Sherry AM, Tewari KP, Cuppoletti J. Gastric parietal cell secretory membrane contains PKA- and acid-activated KIR2.1 K+ channels. Am J Physiol Cell Physiol. 2004; 286: C495–C506.[Abstract/Free Full Text]

32. Leonoudakis D, Conti LR, Radeke CM, McGuire LM, Vandenberg CA. A multiprotein trafficking complex composed of SAP97, CASK, Veli, and Mint1 is associated with inward rectifier Kir2 potassium channels. J Biol Chem. 2004; 279: 19051–19063.[Abstract/Free Full Text]

33. Maltese JY, Eipper BA. Maturation, internalization, and turnover of soluble and membrane proteins associated with atrial myocyte secretory granules. Endocrinology. 1993; 133: 2579–2587.[Abstract/Free Full Text]

34. Mueller GP, Driscoll WJ, Eipper BA. In vivo inhibition of peptidylglycine-alpha-hydroxylating monooxygenase by 4-phenyl-3-butenoic acid. J Pharmacol Exp Ther. 1999; 290: 1331–1336.[Abstract/Free Full Text]

35. O’Donnell PJ, Driscoll WJ, Back N, Muth E, Mueller GP. Peptidylglycine-alpha-amidating monooxygenase and pro-atrial natriuretic peptide constitute the major membrane-associated proteins of rat atrial secretory granules. J Mol Cell Cardiol. 2003; 35: 915–932.[CrossRef][Medline] [Order article via Infotrieve]

36. Slot JW, Garruti G, Martin S, Oorschot V, Posthuma G, Kraegen EW, Laybutt R, Thibault G, James DE. Glucose transporter (GLUT-4) is targeted to secretory granules in rat atrial cardiomyocytes. J Cell Biol. 1997; 137: 1243–1254.[Abstract/Free Full Text]

37. Steveson TC, Zhao GC, Keutmann HT, Mains RE, Eipper BA. Access of a membrane protein to secretory granules is facilitated by phosphorylation. J Biol Chem. 2001; 276: 40326–40337.[Abstract/Free Full Text]

38. Muth E, Driscoll WJ, Smalstig A, Goping G, Mueller GP. Proteomic analysis of rat atrial secretory granules: a platform for testable hypotheses. Biochim Biophys Acta. 2004; 1699: 263–275.[Medline] [Order article via Infotrieve]

39. Peter BJ, Kent HM, Mills IG, Vallis Y, Butler PJ, Evans PR, McMahon HT. BAR domains as sensors of membrane curvature: the amphiphysin BAR structure. Science. 2004; 303: 495–499.[Abstract/Free Full Text]

40. Wang X, Huynh H, Gjorloff-Wingren A, Monosov E, Stridsberg M, Fukuda M, Mustelin T. Enlargement of secretory vesicles by protein tyrosine phosphatase PTP-MEG2 in rat basophilic leukemia mast cells and Jurkat T cells. J Immunol. 2002; 168: 4612–4619.[Abstract/Free Full Text]

41. Andelfinger G, Tapper AR, Welch RC, Vanoye CG, George AL Jr, Benson DW. KCNJ2 mutation results in Andersen syndrome with sex-specific cardiac and skeletal muscle phenotypes. Am J Hum Genet. 2002; 71: 663–668.[CrossRef][Medline] [Order article via Infotrieve]

42. Holt JR, Johns DC, Wang S, Chen ZY, Dunn RJ, Marban E, Corey DP. Functional expression of exogenous proteins in mammalian sensory hair cells infected with adenoviral vectors. J Neurophysiol. 1999; 81: 1881–1888.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Circ. Res.Home page
P. Philip-Couderc, N. I. Tavares, A. Roatti, R. Lerch, C. Montessuit, and A. J. Baertschi
Forkhead Transcription Factors Coordinate Expression of Myocardial KATP Channel Subunits and Energy Metabolism
Circ. Res., February 1, 2008; 102(2): e20 - e35.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Beauchamp, K. A. Yamada, A. J. Baertschi, K. Green, E. M. Kanter, J. E. Saffitz, and A. G. Kleber
Relative Contributions of Connexins 40 and 43 to Atrial Impulse Propagation in Synthetic Strands of Neonatal and Fetal Murine Cardiomyocytes
Circ. Res., November 24, 2006; 99(11): 1216 - 1224.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
95/12/e98    most recent
01.RES.0000150592.88464.adv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Labrador, V.
Right arrow Articles by Baertschi, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Labrador, V.
Right arrow Articles by Baertschi, A. J.
Related Collections
Right arrow Structure
Right arrow Other myocardial biology
Right arrow Physiological and pathological control of gene expression