| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Departments of Medicine (K.C., J.L.M., D.L.), Physiology and Biophysics (J.L.M.), University of Arkansas for Medical Sciences and Central Arkansas Veterans Healthcare System, Little Rock; and Departments of Medicine (J.J.) and Pathology (L.J.), VA Boston Healthcare System and Boston University School of Medicine, Boston, Mass.
Correspondence to Jacob Joseph, MD, Cardiology Section (111), VA Boston Healthcare System, 1400 VFW Pkwy, West Roxbury, MA 02132. E-mail jacob.joseph{at}med.va.gov
| Abstract |
|---|
|
|
|---|
Key Words: angiotensin II collagen endoglin fibroblasts remodeling
| Introduction |
|---|
|
|
|---|
Transforming growth factor ß (TGF-ß1) modulates tissue fibrosis by direct effects on fibroblast function.12 This powerful fibrogenic cytokine has been demonstrated to mediate myocardial fibrotic response in various models of progressive cardiac remodeling.13 TGF-ß1 directly increases cardiac fibroblast collagen production in vitro, possibly by converting cardiac fibroblasts to the more synthetic myofibroblast phenotype.14,15 Interestingly, Ang II increases TGF-ß1 production by adult cardiac fibroblasts, indicating that its effects on cardiac fibrosis may be mediated by autocrine production of TGF-ß1.16 Animal models of progressive cardiac fibrosis have indicated that Ang II acts by upregulating expression of TGF-ß1 to produce myocardial fibrosis.17 However, increased expression of TGF-ß1 alone does not explain the cardiac effects of Ang II, and recent data suggests that other factors in addition to TGF-ß1 expression may be involved, such as receptor expression.18
Endoglin (CD 105) is a homodimeric membrane glycoprotein that is a type III TGF-ß1 receptor.19 This receptor is highly expressed in vascular endothelial cells, and is critical for angiogenesis in vivo.20,21 Studies have shown that endoglin modulates the function of TGF-ß1 by binding to and modulating signal transduction by the major TGF-ß1 receptors, type I and II.22,23 Recent reports have shown that endoglin is expressed in stromal tissues, and may modulate fibrosis in progressive renal disease, scleroderma, and postradiotherapy breast fibrosis.2428 This study was designed to identify the expression of the TGF-ß1 receptors, specifically endoglin, in cardiac fibroblasts, and to study the interaction between Ang II and endoglin in modulating collagen metabolism. Our results demonstrate that endoglin is expressed in cardiac fibroblasts, and that it is upregulated by Ang II via the AT1 receptor. In addition, our data demonstrate that endoglin is a potent mediator of profibrotic effects of Ang II on cardiac fibroblasts.
| Materials and Methods |
|---|
|
|
|---|
-actin (VSMCs), and von Willebrand factor (endothelial cells). All animals received humane care according to the guidelines stated in the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 86-23, revised 1985).
Study Design
First, we identified the basal expression of endoglin (mRNA and protein) in cardiac fibroblasts (CF). Next, the CF were incubated with Ang II (1010 to 106 mol/L) for 3 to 24 hours to determine the regulation of endoglin (mRNA and protein). The concentration and time point for maximal effect of Ang II were used in subsequent experiments.
To examine the receptor specificity of Ang II action, CF were pretreated with or without 3 different Ang II type1 receptor blockers (losartan, candesartan, or valsartan, each 106 mol/L) or the AT2 receptor blocker PD123319 (106 mol/L) and then exposed to Ang II. The harvested cells were used to measure the expression of endoglin, and of TGF-ß1 receptors I and II (time course only).
To explore the molecular basis of the action of Ang II, we studied mitogen-activated protein kinase (MAPKp42/44) signaling pathway. For this purpose, CF were pretreated with the MAPKp42/44 inhibitor PD98059 (106 mol/L) for 30 minutes and then the cells were exposed to Ang II. The harvested cells were used to measure endoglin expression and MAPKp42/44 activity.
To examine the specific role of upregulation of endoglin, the expression of type I collagen and matrix metalloproteinases-1 (MMP-1) were examined in parallel experiments. Fibroblasts were pretreated with a monoclonal rat endoglin-blocking antibody (DAKO; 10 µg/mL) and then the cells were exposed to Ang II. The harvested cells were used to measure expression of type I collagen and MMP-1.
Concentrations of all reagents and the duration of incubation were chosen based on our previous studies3033 on endothelial cells.
Total RNA (5 µg) extracted from cultured CF was reverse-transcribed with Oligo dT (Promega) and M-MLV reverse transcriptase (Promega) at 42°C for 1 hour, and 1.5 µL of the reverse-transcribed material was amplified with Taq DNA polymerase (Promega) using a primer pair specific to rat endoglin (upper primer, ATCCAACACCATAGAGCTAG; lower primer, TGGCTGAGGGGACAAGTTC).28 The RT-PCR product was 614 base pairs (position from 7 to 569). For PCR, 28 cycles were used at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute. Rat ß-actin was amplified as a reference for semiquantitation of endoglin mRNA.
Western Blot Analysis
Fibroblast lysates from each experiment were separated by 10% SDS-PAGE, and transferred to nitrocellulose membranes. After incubation in blocking solution (4% nonfat milk, Sigma), membranes were incubated with 1:1000 dilution primary antibody to endoglin (DAKO), TGF-ß1 type I or II receptor (Santa Cruz Biotechnology), MMP-1 (Oncogene Science), or type I collagen (Santa Cruz Biotechnology) overnight at 4°C. Membranes were washed and then incubated with 1:2000 dilution second antibody (Amersham) for 1 hour, the membranes were detected with the ECL system, and relative intensities of protein bands were analyzed by MSF-300G Scanner. For assessing MAPK phosphorylation, the membranes were incubated overnight with rabbit polyclonal phosphospecific MAPK antibodies (Calbiochem Co) that detect MAPKp42/44 only when catalytically activated by phosphorylation at Tyr-204. Membranes were detected with the ECL system, subsequently stripped and reprobed with MAPK antibody (Calbiochem Co.), and relative intensities of protein bands were analyzed.33
Data Analysis
All data (mean±SD) represent mean of at least five independent experiments. Data were evaluated by ANOVA with a Student-Newman-Keuls post hoc test using Sigmastat (SPSS Inc). A value of P<0.05 was considered significant.
| Results |
|---|
|
|
|---|
|
|
Ang II Type 1 Receptor Mediates Ang IIInduced Endoglin Expression
Figure 3 shows the results of experiments examining the role of Ang II types 1 (AT1) and 2 (AT2) receptors in inducing endoglin expression. CF were pretreated for 30 minutes with AT1 receptor blockers (ARBs) Losartan, Candesartan, or Valsartan (106 mol/L), or the Ang II type 2 receptor blocker PD 123319, and then exposed to Ang II (106 mol/L) for 12 hours. All three ARBs abrogated Ang IIinduced expression of both endoglin mRNA and protein, whereas the type 2 receptor blocker had no effect. There were no significant differences between the three ARBs in terms of blocking endoglin expression, although valsartan seemed to have a slightly greater effect. Because the MAP kinase pathway is a known signal transduction mechanism of Ang II effects on endoglin expression in endothelial cells,33 we also examined the role of this pathway in Ang IIinduced endoglin expression in cardiac fibroblasts. As shown in Figure 4, the MAPK inhibitor PD 98059 inhibited expression of endoglin protein, concomitant with a decrease in expression of the active phosphorylated p42/44 MAPK.
|
|
Endoglin Modulates Ang II Effects on Collagen Metabolism
We used a monoclonal antibody to endoglin to examine the role of endoglin in modulating Ang II effects on CF. Cardiac fibroblasts were pretreated with endoglin antibody (10 µg/mL) for 30 minutes and then exposed to Ang II (106 mol/L) for 12 hours (time of peak Ang II effect on endoglin expression). As shown in Figure 5, Ang II increased expression of type I collagen protein, whereas it decreased the expression of the collagen degrading enzyme matrix metalloproteinase (MMP)-1. Both of these effects were antagonized by the endoglin antibody, indicating that endoglin may play an important role in the autocrine loop of Ang II induced TGF-ß1 secretion and modulation of CF function.
|
Ang II Effect on TGF-ß Type I and II Receptor Expression in Cardiac Fibroblasts
We examined the effect of Ang II on TGF-ß1 type I and II receptor protein expression. Both receptor proteins were expressed at baseline in CF. Ang II at 106 mol/L (concentration producing peak effect on endoglin expression) did not alter expression of either receptor at all time points tested up to 48 hours (Figure 6).
|
| Discussion |
|---|
|
|
|---|
Cardiac remodeling in response to hemodynamic stress and/or injury includes changes in the cardiomyocyte compartment, which accounts for one third of cells in the myocardium,34,35 as well as the nonmyocyte compartment (endothelial cells, vascular smooth muscle cells, macrophages, and cardiac fibroblasts), which accounts for two thirds of cardiac cells. Pathological changes in cardiac remodeling (reviewed in detail36) includes myocyte hypertrophy, myocyte death, and dynamic changes in the interstitium. Interstitial changes involve qualitative and quantitative alterations in the fibrillar collagen network (composed mainly of types I and III fibrillar collagen), including changes in collagen cross linking.2,6,36 A phenotypic change of the cardiac fibroblast to the more synthetic myofibroblast phenotype has been proposed to occur under the influence of cytokines such as TGF-ß and to promote deposition of collagen.37,38 Myocardial collagen content is tightly regulated by a balance between collagen production and degradation. Extracellular degradation of collagen is the major rate limiting step in collagen metabolism and is effected by matrix metalloproteinases (MMPs).39 Collagenases (MMP types 1, 8, and 13) initiate degradation of collagen, whereas gelatinases (MMP-2 and MMP-9) effect digestion of collagen breakdown products (gelatins). Among the collagenases, MMP-13 is predominantly expressed in rodents, although MMP-1 is also expressed in rat hearts and its expression is altered in pathological states.4042 The intramyocardial coronary arterioles also undergo changes in cardiac remodeling resulting in medial thickening and perivascular fibrosis. Collectively these changes progressively impair cardiac function.
Mammalian TGF-ß exists in three isoforms, TGF-ß1, -ß2, and -ß3, and TGF-ß1 has an important role in cardiac development and in adverse cardiac remodeling in response to injury such as myocardial infarction.12 TGF-ß1 induces cardiac fibrosis possibly by direct effects on cardiac fibroblast function, especially the phenotypic transformation of CF to the more synthetic myofibroblast.14,15 TGF-ß1 antagonism has been shown to ameliorate cardiac remodeling and fibrosis.13 The effects of the TGF-ß family are mediated through several receptors, principally the types I, II, and III receptors.43 Types I and II receptors have been studied in detail; binding of TGF-ß1 to these receptors promote signal transduction and cellular effects. Endoglin or the type III receptor was initially described as crucial for vasculogenesis, and its defect to be responsible for hereditary hemorrhagic telangiectasia.44 The function of this receptor has not been fully elucidated; however, it interacts with TGF-ß1 receptors I and II to modulate signal transduction.1922 Hence, endoglin may play a major role in the response of tissues to TGF-ß1. Recent reports indicate that endoglin is overexpressed in renal tissues during progressive renal disease, and may modulate the remodeling process.24,25 Interestingly, studies in renal disease, scleroderma, and postradiation breast fibrosis indicate that endoglin may downregulate fibrotic mechanisms.2628 Hence, endoglin may play an important role in the tissue remodeling process; however, specific mechanisms need to be elucidated.
Angiotensin II is a powerful stimulus to progressive cardiac remodeling and heart failure.14 Myocardial fibrosis is a prominent feature of cardiac remodeling secondary to Ang II. Even though Ang II has direct effects on cardiac fibroblast function, paracrine mechanisms, including those involving the myocyte, have been invoked to explain the pathogenesis of Ang IIinduced cardiac fibrosis. Pathak and coworkers11 examined adult CF in culture and demonstrated that paracrine factors produced by myocytes are necessary for collagen production by CF in response to Ang II. Lee and coworkers21 have shown that Ang II increases TGF-ß1 production by CF, and this autocrine mechanism has been proposed to promote Ang II induced myocardial fibrosis in vivo. For example, Kupfahl and coworkers45 have shown that Ang II increases TGF-ß1 expression in human atrial myocardium. Tomita and coworkers46 studied the relationship of Ang II, TGF-ß1 and cardiac fibrosis in an in vivo rat model of cardiac remodeling induced by inhibition of nitric oxide synthesis. In this study, an AT1 receptor antagonist prevented the early induction of TGF-ß1 and later development of cardiac fibrosis, indicating that Ang II was acting indirectly through expression of TGF-ß1 to induce cardiac fibrosis. Our premise for these experiments was based on the postulate that in addition to the autocrine production of TGF-ß1, Ang II may modulate cardiac fibroblast function by upregulating endoglin expression in CFs.
Our results demonstrate that CFs express endoglin, and that Ang II stimulates this expression. All three angiotensin receptor blocking agents tested abrogated Ang II induced endoglin expression, indicating that the Ang II type 1 receptor mediated this effect. The Ang II type 2 receptor blocker had no effect on Ang II induced endoglin expression. These results are in accordance with current literature indicating that most of the adverse effects on cardiac structure and function attributable to Ang II are mediated through its type 1 receptor.14
Various signal transduction pathways have been implicated in Ang II effects on cardiac fibroblast function including activation of protein kinase C, activation of MAP-kinases, Raf-1 hyperphosphorylation, and expression of early (c-fos and c-jun) and intermediate response (c-myc and c-myb) genes (reviewed in detail47). Tharaux and coworkers,48 in their study of molecular pathways involved in Ang IIinduced collagen I gene activation, showed that the MAPK/ERK cascade and TGF-ß1 were involved in the activation of type I collagen gene. In contrast, P38 kinase pathway or NF-
B did not play a role in Ang IIinduced collagen gene activation. A prior study from our laboratory demonstrating Ang IIinduced upregulation of endoglin in endothelial cells also showed that the MAPK pathway was involved in this AT1 receptor dependent process.33 Our results in cardiac fibroblasts also show that MAPK p42/44 inhibition decreased Ang II induced endoglin expression, indicating that the MAPK pathway may modulate this process in CF. Ang II did not alter the expression of TGF-ß1 receptors I and II in cardiac fibroblasts, unlike in vascular smooth muscle cells,49 where it has been shown to upregulate TGF-ß1 type I receptor expression. Our prior study in endothelial cells also demonstrated that Ang II upregulated the expression of TGF-ß1 receptors types I and II, mechanisms which do not seem to operate in cardiac fibroblasts.
We also analyzed the functional role of Ang IIinduced endoglin expression in CF. Ang II increased type I collagen protein expression, whereas it decreased MMP-1 protein expression, changes which could promote collagen deposition in vivo. These effects are consistent with in vitro studies done by several investigators demonstrating that Ang II increased type I collagen production by cultured CF.710 Both endoglin blockade and ARBs decreased Ang II induced type I collagen protein expression, whereas they prevented Ang IImediated decrease in MMP-1 expression. Because we studied only MMP-1 expression as opposed to expression and activity of the major rat collagenase MMP-13, and gelatinases MMP-2 and -9, it is possible that our in vitro results may not correlate with a significant effect of endoglin on collagen degradation in vivo. Overall these results indicate that expression of the endoglin receptor may be an important mediator of Ang II effects on CF, although in vivo relevance needs to be proven by further experiments in various models of cardiac remodeling.
Conclusions
Our studies demonstrate that endoglin, the type III TGF-ß1 receptor, modulates the profibrogenic effects of Ang II in cardiac fibroblasts. This effect of Ang II is mediated by the Ang II type 1 receptor and is blocked by ARBs. The net effect of Ang II induced endoglin expression is to alter collagen metabolism in the direction of collagen deposition. These findings indicate a novel link between Ang II and myocardial fibrosis. Further studies will delineate the specific mechanisms of interaction between Ang II and TGF-ß1 signaling in cardiac fibroblasts, the role of endoglin in this process, and the in vivo relevance of this interaction.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Weber KT, Brilla CG. Pathological hypertrophy and cardiac interstitium: fibrosis and the renin-angiotensin-aldosterone system. Circulation. 1991; 83: 18491865.
3. Oishi Y, Ozono R, Yano Y, Teranishi Y, Akishita M, Horiuchi M, Oshima T, Kambe M. Cardioprotective role of AT2 receptor in postinfarction left ventricular remodeling. Hypertension. 2003; 41: 814818.
4. Wu L, Iwai M, Nakagami H, et al. Effect of angiotensin type 1 receptor blockade on cardiac remodeling in angiotensin II type 2 receptor null mice. Arterioscler Thromb Vasc Biol. 2002; 22: 4954.
5. Tsotetsi OJ, Woodiwiss AJ, Netjhardt M, Qubu D, Brooksbank R, Norton GR. Attenuation of cardiac failure, dilatation, damage, and detrimental interstitial remodeling without regression of hypertrophy in hypertensive rats. Hypertension. 2001; 38: 846851.
6. Woodiwiss AJ, Tsotetsi OJ, Sprott S, Lancaster EJ, Mela T, Chung ES, Meyer TE, Norton GR. Reduction in myocardial collagen cross-linking parallels left ventricular dilatation in rat models of systolic chamber dysfunction. Circulation. 2001; 103: 155160.
7. Crabos M, Roth M, Hahn AWA, Erne P. Characterization of angiotensin II receptors in cultured rat fibroblasts: coupling to signaling systems and gene expression. J Clin Invest. 1994; 93: 23722378.[Medline] [Order article via Infotrieve]
8. Brilla CG, Zhou G, Matsubara L, Weber KT. Collagen metabolism in cultured adult rat cardiac fibroblasts: response to angiotensin II and aldosterone. J Mol Cell Cardiol. 1994; 26: 809820.[CrossRef][Medline] [Order article via Infotrieve]
9. Villareal FJ, Kim NN, Ungab GD, Printz MP, Dillman WH. Identification of functional angiotensin II receptors on rat cardiac fibroblasts. Circulation. 1993; 88: 28492861.
10. Zhou G, Kandala JC, Tyagi SC, Katwa LC, Weber KT. Effects of angiotensin II and aldosterone on collagen gene expression and protein turnover in cardiac fibroblasts. Mol Cell Biochem. 1996; 154: 171178.[CrossRef][Medline] [Order article via Infotrieve]
11. Pathak M, Sarkar S, Vellaichamy E, Sen S. Role of myocytes in myocardial collagen production. Hypertension. 2001; 37: 833840.
12. Lijnen PJ, Petrov VV, Fagard RH. Induction of cardiac fibrosis by transforming growth factor-beta(1). Mol Genet Metab. 2000; 71: 418435.[CrossRef][Medline] [Order article via Infotrieve]
13. Kuwahara F, Kai H, Tokuda K, Kai M, Takeshita A, Egashira K, Imaizumi T. Transforming growth factor-beta function blocking prevents myocardial fibrosis and diastolic dysfunction in pressure-overloaded rats. Circulation. 2002; 106: 130135.
14. Lijnen P, Petrov V, Rumilla K, Fagard R. Transforming growth factor-beta 1 promotes contraction of collagen gel by cardiac fibroblasts through their differentiation into Myofibroblasts. Methods Find Exp Clin Pharmacol. 2003; 25: 7986.[CrossRef][Medline] [Order article via Infotrieve]
15. Lijnen P, Petrov V. Transforming growth factor-beta 1-induced collagen production in cultures of cardiac fibroblasts is the result of the appearance of myofibroblasts. Methods Find Exp Clin Pharmacol. 2002; 24: 333344.[CrossRef][Medline] [Order article via Infotrieve]
16. Lee AA, Dillmann WH, McCulloch AD, Villarreal FJ. Angiotensin II stimulates the autocrine production of transforming growth factor-beta 1 in adult rat cardiac fibroblasts. J Mol Cell Cardiol. 1995; 27: 23472357.[CrossRef][Medline] [Order article via Infotrieve]
17. Sun Y, Zhang JQ, Zhang J, Ramires FJ. Angiotensin II, transforming growth factor-beta1 and repair in the infarcted heart. J Mol Cell Cardiol. 1998; 30: 15591569.[CrossRef][Medline] [Order article via Infotrieve]
18. Nakajima H, Nakajima HO, Salcher O, Dittie AS, Dembowsky K, Jing S, Field LJ. Atrial but not ventricular fibrosis in mice expressing a mutant transforming growth factor-beta(1) transgene in the heart. Circ Res. 2000; 86: 571579.
19. Fonsatti E, Altomonte M, Arslan P, Maio M. Endoglin (CD105): a target for anti-angiogenetic cancer therapy. Curr Drug Targets. 2003; 4: 291296.[CrossRef][Medline] [Order article via Infotrieve]
20. van den Driesche S, Mummery CL, Westermann CJ. Hereditary hemorrhagic telangiectasia: an update on transforming growth factor beta signaling in vasculogenesis and angiogenesis. Cardiovasc Res. 2003; 58: 2031.
21. Duff SE, Li C, Garland JM, Kumar S. CD105 is important for angiogenesis: evidence and potential applications. FASEB J. 2003; 17: 984992.
22. Guerrero-Esteo M, Sanchez-Elsner T, Letamendia A, Bernabeu C. Extracellular and cytoplasmic domains of endoglin interact with the transforming growth factor-beta receptors I and II. J Biol Chem. 2002; 277: 2919729209.
23. Diez-Marques L, Ortega-Velazquez R, Langa C, Rodriguez-Barbero A, Lopez-Novoa JM, Lamas S, Bernabeu C. Expression of endoglin in human mesangial cells: modulation of extracellular matrix synthesis. Biochim Biophys Acta. 2002;1587:3644, 2002 May 21.
24. Rodriguez-Pena A, Eleno N, Duwell A, Arevalo M, Perez-Barriocanal F, Flores O, Docherty N, Bernabeu C, Letarte M, Lopez-Novoa JM. Endoglin upregulation during experimental renal interstitial fibrosis in mice. Hypertension. 2002; 40: 713720.
25. Rodriguez-Pena A, Prieto M, Duwel A, Rivas JV, Eleno N, Perez-Barriocanal F, Arevalo M, Smith JD, Vary CP, Bernabeu C, Lopez-Novoa JM. Up-regulation of endoglin, a TGF-beta-binding protein, in rats with experimental renal fibrosis induced by renal mass reduction. Nephrol Dial Transplant. 2001; 16 Suppl 1: 3439.
26. Leask A, Abraham DJ, Finlay DR, Holmes A, Pennington D, Shi-Wen X, Chen Y, Venstrom K, Dou X, Ponticos M, Black C, Bernabeu C, Jackman JK, Findell PR, Connolly MK. Dysregulation of transforming growth factor beta signaling in scleroderma: overexpression of endoglin in cutaneous scleroderma fibroblasts. Arthritis Rheum. 2002; 46: 18571865.[CrossRef][Medline] [Order article via Infotrieve]
27. Dharmapatni AA, Smith MD, Ahern MJ, Simpson A, Li C, Kumar S, Roberts-Thomson PJ. The TGF beta receptor endoglin in systemic sclerosis. Asian Pac J Allergy Immunol. 2001; 19: 275282.[Medline] [Order article via Infotrieve]
28. Li C, Wilson PB, Levine E, Stewart AL, Kumar S. TGF-beta1 levels in pre-treatment plasma identify breast cancer patients at risk of developing post-radiotherapy fibrosis. Int J Cancer. 1999; 84: 155159.[CrossRef][Medline] [Order article via Infotrieve]
29. Meszaros JG, Gonzalez AM, Endo-Mochizuki Y, Villegas S, Villarreal F, Brunton LL. Identification of G protein-coupled signaling pathways in cardiac fibroblasts: cross talk between Gq and Gs. Am J Physiol. 2000; 278: C154C162.
30. Li DY, Zhang YC, Philips MI, Sawamura T, Mehta JL. Upregulation of endothelial receptor for oxidized low- density lipoprotein (LOX-1) in cultured human coronary artery endothelial cells by angiotensin II type 1 receptor activation. Circ Res. 1999; 84: 10431049.
31. Li D, Mehta JL. Antisense to LOX-1 inhibits oxidized LDL-mediated upregulation of monocyte chemoattractant protein-1 and monocyte adhesion to human coronary artery endothelial cells. Circulation. 2000; 101: 28892895.
32. Li D, Liu L, Chen H, Ranganathan S, Mehta JL. LOX-1 mediates oxidized low-density lipoprotein-induced expression of matrix metalloproteinases in human coronary artery endothelial cells. Circulation. 2003; 107: 612617.
33. Li D, Chen H, Mehta JL. Angiotensin II via activation of type 1 receptor upregulates expression of endoglin in human coronary artery endothelial cells. Hypertension. 2001 Nov; 38: 10621067.
34. Zak R. Cell proliferation during cardiac growth. Am J Cardiol. 1973; 31: 211219.[CrossRef][Medline] [Order article via Infotrieve]
35. Frank JS, Langer JA. The myocardial interstitium: its structure and its role in ionic exchange. J Cell Biol. 1974; 60: 586601.
36. Swynghedauw B. Molecular mechanisms of myocardial remodeling. Physiol Rev. 1999; 79: 215262.
37. Eghbali M, Tomek R, Woods C, Bhambi B. Cardiac fibroblasts are predisposed to convert into myocyte phenotype: specific effect of transforming growth factor ß. Proc Natl Acad Sci U S A. 1991; 88: 795799.
38. Petrov VV, Fagard RH, Lijnen PJ. Stimulation of collagen production by transforming growth factor-ß1 during differentiation of cardiac fibroblasts to myofibroblasts. Hypertension. 2002; 39: 258263.
39. Woessner JF Jr. Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J. 1991; 131: 21452154.
40. Fraccarollo D, Galuppo P, Bauersachs J, Ertl G. Collagen accumulation after myocardial infarction: effects of ETA receptor blockade and implications for early remodeling. Cardiovasc Res. 2002; 54: 559567.
41. Cleutjens JPM, Kandala JC, Guarda E, Guntaka RV, Weber KT. Regulation of collagen degradation in the rat myocardium after infarction. J Mol Cell Cardiol. 1995; 27: 12811292.[CrossRef][Medline] [Order article via Infotrieve]
42. Robert V, Besse S, Sabri A, Silvestre JS, Assayag P, Nguyen VT, Swynghedauw B, Delaycre C. Differential regulation of matrix metalloproteinases associated with aging anf hypertension in the rat heart. Lab Invest. 1997; 76: 729738.[Medline] [Order article via Infotrieve]
43. Brand T, Schneider M. Transforming growth factor-ß signal transduction. Circ Res. 1996; 78: 173179.
44. Arthur HM, Ure J, Smith AJ, Renforth G, Wilson DI, Torsney E, Charlton R, Parums DV, Jowett T, Marchuk DA, Burn J, Diamond AG. Endoglin, an ancillary TGFbeta receptor, is required for extraembryonic angiogenesis and plays a key role in heart development. Dev Biol. 2000 Jan 1; 217: 4253.[CrossRef][Medline] [Order article via Infotrieve]
45. Kupfahl C, Pink D, Friedrich K, Zurbrugg HR, Neuss M, Warnecke C, Fielitz J, Graf K, Fleck E, Regitz-Zagrosek V. Angiotensin II directly increases transforming growth factor ß1 and osteopontin and indirectly affects collagen mRNA expression in the human heart. Cardiovasc Res. 2000; 46: 463475.
46. Tomita H, Egashira K, Ohara Y, Takemoto M, Koyanagi M, Katoh M, Yamamoto H, Tamaki K, Shimokawa H, Takeshita A. Early induction of transforming growth factor-ß via angiotensin II type I receptors contributes to cardiac fibrosis induced by long term blockade of nitric oxide synthesis in rats. Hypertension. 1998; 32: 273279.
47. Dostal DE, Booz GW, Baker KM. Angiotensin II signaling pathways in cardiac fibroblasts: conventional versus novel mechanisms in mediating cardiac growth and function. Mol Cell Biochem. 1996; 157: 1521.[Medline] [Order article via Infotrieve]
48. Tharaux P-L, Chatziantoniou C, Fakhouri F, Dussaule J-C. Angiotensin II activates collagen I gene through a mechanism involving the MAP/ER kinase pathway. Hypertension. 2000; 36: 330336.
49. Fukuda N, Hu W-Y, Kubo A, Kishioka H, Satoh C, Soma M, Izumi Y, Kanmatsuse K. Angiotensin II upregulates transforming growth factor-ß type I receptor on rat vascular smooth muscle cells. Am J Hypertens. 2000; 13: 191198.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
C. Hu, A. Dandapat, L. Sun, M. R. Marwali, N. Inoue, F. Sugawara, K. Inoue, Y. Kawase, K.-i. Jishage, H. Suzuki, et al. Modulation of Angiotensin II-Mediated Hypertension and Cardiac Remodeling by Lectin-Like Oxidized Low-Density Lipoprotein Receptor-1 Deletion Hypertension, September 1, 2008; 52(3): 556 - 562. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Frohlich Excitement of Clinical Investigation: New Basic Mechanisms of Action After Drug Introduction Hypertension, September 1, 2008; 52(3): 465 - 466. [Full Text] [PDF] |
||||
![]() |
M. E. De Paepe, C. Patel, A. Tsai, S. Gundavarapu, and Q. Mao Endoglin (CD105) Up-regulation in Pulmonary Microvasculature of Ventilated Preterm Infants Am. J. Respir. Crit. Care Med., July 15, 2008; 178(2): 180 - 187. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bonaros, R. Rauf, E. Werner, B. Schlechta, E. Rohde, A. Kocher, J. Bonatti, and G. Laufer Neoangiogenesis after combined transplantation of skeletal myoblasts and angiopoietic progenitors leads to increased cell engraftment and lower apoptosis rates in ischemic heart failure Interactive CardioVascular and Thoracic Surgery, April 1, 2008; 7(2): 249 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Burstein and S. Nattel Atrial Fibrosis: Mechanisms and Clinical Relevance in Atrial Fibrillation J. Am. Coll. Cardiol., February 26, 2008; 51(8): 802 - 809. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. B. Ferreira, A. V. Bacurau, F. S. Evangelista, M. A. Coelho, E. M. Oliveira, D. E. Casarini, J. E. Krieger, and P. C. Brum The role of local and systemic renin angiotensin system activation in a genetic model of sympathetic hyperactivity-induced heart failure in mice Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2008; 294(1): R26 - R32. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hu, A. Dandapat, J. Chen, Y. Fujita, N. Inoue, Y. Kawase, K.-i. Jishage, H. Suzuki, T. Sawamura, and J. L. Mehta LOX-1 deletion alters signals of myocardial remodeling immediately after ischemia-reperfusion Cardiovasc Res, November 1, 2007; 76(2): 292 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. G. Spinale Myocardial Matrix Remodeling and the Matrix Metalloproteinases: Influence on Cardiac Form and Function Physiol Rev, October 1, 2007; 87(4): 1285 - 1342. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bujak and N. G. Frangogiannis The role of TGF-{beta} signaling in myocardial infarction and cardiac remodeling Cardiovasc Res, May 1, 2007; 74(2): 184 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Leask TGF{beta}, cardiac fibroblasts, and the fibrotic response Cardiovasc Res, May 1, 2007; 74(2): 207 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. W. van Laake, S. van den Driesche, S. Post, A. Feijen, M. A. Jansen, M. H. Driessens, J. J. Mager, R. J. Snijder, C. J. J. Westermann, P. A. Doevendans, et al. Endoglin Has a Crucial Role in Blood Cell-Mediated Vascular Repair Circulation, November 21, 2006; 114(21): 2288 - 2297. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen and J. L. Mehta Angiotensin II-mediated oxidative stress and procollagen-1 expression in cardiac fibroblasts: blockade by pravastatin and pioglitazone Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1738 - H1745. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Johar, A. C. Cave, A. Narayanapanicker, D. J. Grieve, and A. M. Shah Aldosterone mediates angiotensin II-induced interstitial cardiac fibrosis via a Nox2-containing NADPH oxidase FASEB J, July 1, 2006; 20(9): 1546 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sorescu Smad3 Mediates Angiotensin II- and TGF-{beta}1-Induced Vascular Fibrosis: Smad3 Thickens the Plot Circ. Res., April 28, 2006; 98(8): 988 - 989. [Full Text] [PDF] |
||||
![]() |
Y. Ma, L. Zhang, T. Peng, J. Cheng, S. Taneja, J. Zhang, P. Delafontaine, and J. Du Angiotensin II Stimulates Transcription of Insulin-Like Growth Factor I Receptor in Vascular Smooth Muscle Cells: Role of Nuclear Factor-{kappa}B Endocrinology, March 1, 2006; 147(3): 1256 - 1263. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |