| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
-Actin
From the Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville, Va.
Correspondence to Gary K. Owens, PhD, Department of Molecular Physiology and Biological Physics, University of Virginia, MR5 Room 1220, 415 Lane Road, PO Box 801394, Charlottesville, VA 22908. E-mail gko{at}virginia.edu
| Abstract |
|---|
|
|
|---|
-actin gene. The aim of the present study was to determine whether myocardin, a SMC-selective cofactor of serum response factor (SRF), contributed to Ang II-induced increases in SM
-actin transcription. Results showed that Ang II increased myocardin mRNA expression as well as SM
-actin mRNA expression via the Ang II type 1 receptor in cultured rat aortic SMCs. Cotransfection studies revealed that CArG elements were required for Ang II-induced transcription of SM
-actin gene, and a dominant-negative form of myocardin or a short interfering RNA (siRNA) specific for myocardin decreased Ang II-induced SM
-actin transcription. Prx1, a homeodomain protein whose expression was increased by Ang II, also increased SM
-actin gene transcription in part via CArG elements, and siRNA specific for Prx1 markedly decreased basal and Ang II-induced SM
-actin transcription. Electrophoretic mobility shift assay showed that myocardin and Ang II, respectively, increased formation of a SMC-specific CArG-SRF-myocardin higher order complex. However, Ang II had no effect on binding between myocardin and SRF as determined by a mammalian two-hybrid assay, suggesting that Ang II-induced increases in formation of CArG-SRF-myocardin complex was the result of increased SRF binding to CArG elements and increased myocardin expression. Taken together, these results support a model in which Ang II-induced increases in expression of SM
-actin are mediated through Prx1-dependent increases in SRF binding to CArG elements and subsequent recruitment of myocardin.
Key Words: smooth muscle cells transcriptional coactivator serum response factor CArG element angiotensin II
| Introduction |
|---|
|
|
|---|
The molecular mechanisms whereby Ang II stimulates SMC hypertrophy remain largely unknown. Several studies suggested that Ang II induced the generalized increases in protein synthesis by alterations in translation-initiation of preexisting mRNAs.69 In addition, Ang II was also shown to stimulate selective increases in the expression of several contractile proteins including smooth muscle (SM)
-actin and SM-myosin heavy chain (MHC) in cultured SMCs.10 In fact, expression of SM
-actin protein was increased 3.6- to 7.5-fold by Ang II and was accompanied by a significant increase in SM
-actin mRNA expression. In addition, our previous studies11 showed that the effect of Ang II on SM
-actin expression was mediated, at least in part, by increased transcription as determined by nuclear run-on analysis and promoter-reporter assays.
The promoter-enhancer of the SM
-actin gene contains a number of cis-acting elements including CArG elements that are required for expression of a 2600 bp to +2784 bp SM
-actin Lac Z transgene in vivo.12 The CArG elements have a general sequence motif, CC(A/T-rich)6GG, and bind the ubiquitously expressed transcription factor, serum response factor (SRF).13 Based on analysis of a truncated promoter of the SM
-actin gene consisting of the region from 155 bp to +21 bp, our previous studies demonstrated that CArG B (112), CArG A (62), and a putative homeodomain binding site (145) were required for Ang II responsiveness.11 Additional studies showed that Ang II markedly increased formation of a unique SMC-selective CArG-SRF higher order complex in electrophoretic mobility shift assay (EMSA).11 Moreover, we found that Ang II also increased expression of the paired-related homeobox gene-1, (Prx1, formerly known as MHox or Phox), and that Prx1 markedly enhanced SRF binding to CArG B in the SM
-actin gene in EMSA.11 Whereas these studies significantly advanced our understanding of mechanisms whereby Ang II could increase expression of multiple CArG-dependent SMC genes, there were several unresolved questions from these studies. First, studies showing that Ang II-induced increases in SM
-actin transcription were CArG-dependent were conducted with a truncated promoter that we subsequently showed was insufficient to drive expression in vivo.11 Second, studies provided no direct evidence that Prx1 was required for Ang II-induced increases in SM
-actin expression. Third, whereas Prx1 enhanced SRF binding to SM
-actin CArG B, it did not form a stable higher order complex with SRF in either our studies or studies by Grueneberg et al,14 and nor did it appear to be responsible for the SMC-selective CArG-SRF higher order complex observed in EMSA.
Recently, Wang et al15 reported the cloning of myocardin that acts as a transcriptional coactivator for SRF. We and others showed that expression of myocardin is restricted to SM tissues including the aorta, as well as the heart.1618 Moreover, there is extensive evidence that myocardin plays a key role in regulating the expression of CArG-dependent SMC marker genes in SMCs.1619 For example, overexpression of myocardin markedly increased expression of multiple SMC marker genes including SM
-actin, SM-MHC, SM22
, and calponin, whereas dominant-negative forms of myocardin or short interfering RNA (siRNA) specific for myocardin decreased expression of these genes. In addition, we showed that myocardin formed a unique CArG-SRF higher order complex in SMC nuclear extracts.16 Finally, Li et al20 showed that knockout of myocardin was associated with embryonic lethality at day 10.5 due to the lack of SMC investment of blood vessels. Taken together, the preceding findings provide compelling evidence that myocardin is an extremely important regulator of SMC gene expression and is required for SMC differentiation in vivo. However, as yet, there have been no reports investigating factors that control its expression within SMCs or its role in mediating changes in expression of SMC marker genes by factors such as Ang II that have been implicated in control of SMC differentiation and hypertrophy.
The goal of the present study was to test the hypothesis that Ang II-induced increases in SM
-actin gene expression are dependent on myocardin and mediated at least in part by Prx1-dependent increases in SRF binding to the SM
-actin 5' CArG elements and subsequent binding of myocardin.
| Materials and Methods |
|---|
|
|
|---|
RNA Extraction and Reverse Transcription (RT)-PCR
To quantify the expression of mRNA in Ang II-stimulated SMCs, total RNA was extracted by TRIzol (Invitrogen Corp), and semiquantitative or real-time RT-PCR was performed. Primer and probe sequences are shown in the online Table (available in the online data supplement at http://circres.ahajournals.org).
Construction of Plasmids
Myocardin expression plasmid and its carboxy-terminal truncation mutant, MyoC
381, and siRNA expression plasmids specific for myocardin (pMighty-
Myo) or scramble sequence (pMighty-
Scr) were described previously.16 Prx1 expression vector was reported previously.11 An siRNA expression plasmid for Prx1 (pMighty-
Prx1) was constructed by inserting an oligonucleotide (TTAAAGAGCCAAGTTCCGCAGGAATTCAAGA-GATTCCTGCGGAACTTGGCTCTTTTTGGAAAG; italic means specific sequence to Prx1) into pMighty-Empty.16 The fragment of rat SM
-actin (155 to +21 bp) was subcloned into a pGL3-basic vector (Promega Corp), and it was named as p
A155Luc. Several kinds of mutation were introduced into p
A155Luc by site-directed mutagenesis, and their sequences were confirmed. Wild-type p
A125Luc (125/+23) and p
A(2.6/+2.8) and their mutants were described previously.16 Efficacy of pMighty-
Myo and pMighty-
Prx1 was confirmed in COS cells by knockdown of exogenously expressed flag-tagged myocardin or c-myc-tagged Prx1, respectively.
Transient Transfection and Luciferase Assay
Growth-arrested SMCs were transiently transfected with plasmids using FuGENE 6 (Roche Diagnostics Corp). The total amount of DNA per well was kept constant by adding the corresponding amount of expression vector without a cDNA insert. Luciferase activity was measured and normalized by cellular protein concentrations. Each sample was examined in duplicate, and at least three independent experiments were performed.
EMSA
Rat aortic SMCs were infected with Ad/Myo or empty adenovirus (Ad/Emp) at 50 multiplicity of infection as described previously.16 After the infection, SMCs were incubated for 44 hours, treated with 1 µmol/L Ang II or vehicle for 4 hours, and nuclear extracts were prepared. EMSA were performed as previously described.16,21
Mammalian Two-Hybrid Assay
Mammalian two-hybrid assay was performed according to the manufacturers instructions (Promega). Expression plasmids of fusion proteins for GAL4-SRF (pBIND-SRF), VP16-myocardin (pACT-myocardin), and VP16-Prx1 (pACT-Prx1) were constructed, and expression was confirmed by Western immunoblotting. Expression plasmids for GAL4 fusion protein and VP16 fusion protein were cotransfected into growth-arrested SMCs with pG5Luc reporter plasmid, and luciferase activity was measured.
Statistical Analyses
Statistical analyses were performed by one-way ANOVA with a post hoc Fisher protected least significant difference test. A value of P<0.05 were considered significant.
| Results |
|---|
|
|
|---|
-actin mRNA expression in part via an SRF-dependent mechanism.11 To examine whether myocardin was involved in Ang II-induced SM
-actin mRNA expression, levels of myocardin mRNA were measured by real-time RT-PCR in Ang II-treated SMCs (Figure 1). Treatment with Ang II for 3 hours had no effect on myocardin and SM
-actin mRNA expression. However, treatment with Ang II for 8 hours increased myocardin mRNA expression by 2.5-fold in cultured aortic SMCs. In these cells, Ang II also induced SM
-actin mRNA expression at 8 hours. To determine which Ang II receptor subtype mediated increased myocardin expression, studies were done ascertaining Ang II type 1 receptor (AT1R) and type 2 receptor (AT2R) mRNA expression by RT-PCR. Only AT1R mRNA expression was detected in the cultured SMCs used (Figure 2A). Detection of the band for AT2R from genomic DNA in Figure 2A meant that PCR conditions were appropriate. In addition, Ang II-induced increases in myocardin expression were inhibited by the AT1R antagonist, losartan (Figure 2B). These results indicate that Ang II-induced increases in myocardin expression in cultured aortic SMCs were mediated via the AT1R.
|
|
CArG Elements Were Required for Ang II-Induced SM
-Actin Gene Transcription
To determine which promoter region of the SM
-actin gene was required for Ang II response, various length SM
-actin promoter-enhancer luciferase constructs were transfected into rat aortic SMCs. First, p
A(2.6/+2.8) construct was tested, because it contains sufficient regions of the promoter-enhancer to drive expression in SMCs in vivo in transgenic mice in a manner that recapitulates that of the endogenous gene.12 Ang II increased transcriptional activity of p
A(2.6/+2.8) construct by 2.1-fold (Figure 3). Mutations of either a single or combinations of each of three CArG elements within the 2.6/+2.8-kb SM
-actin promoter-enhancer significantly reduced the responsiveness to Ang II. Moreover, Ang II had no effect on p
A(2.6/+2.8) CArG B+A+int mut construct in which all of the three CArG elements were mutated.
|
Effects of CArG mutations on Ang II responsiveness were also tested using truncated mutants of the SM
-actin promoter. Ang II increased the activity of p
A155Luc and p
A125Luc constructs to the same extent as p
A(2.6/+2.8) construct (Figure 4), indicating that these promoter regions are sufficient to mediate Ang II responsiveness. Mutation of CArG B, CArG A, or both within the context of p
A155Luc and p
A125Luc constructs decreased basal transcriptional activity, and completely abolished the response to Ang II. Mutation of the ATTA homeodomain binding site did not decrease basal transcriptional activity, but this construct showed an attenuated response to Ang II as compared with the wild-type promoter. These results demonstrate that CArG elements are required for SM
-actin transcription by Ang II, and that the effect is also partially dependent on the ATTA site.
|
Dominant-Negative Form of Myocardin, MyoC
381, or an siRNA Specific for Myocardin Inhibited Ang II-Induced Transcription of SM
-Actin Gene in Aortic SMCs
To directly test whether endogenous myocardin, which is expressed in our cultured SMCs (Figure 1), contributed to Ang II-induced SM
-actin gene expression, effects of a dominant-negative form of myocardin, MyoC
381, and an siRNA specific for myocardin were examined by cotransfection studies. Consistent with results of our previous studies,16 MyoC
381 and pMighty-
Myo, an siRNA expression plasmid for myocardin, reduced basal transcriptional activity of the SM
-actin gene by
20% and 45%, respectively (Figure 5). The fact the activity was not completely abolished suggests either that suppression of endogenous myocardin expression was not complete and/or that there are also myocardin-independent pathways that contribute to SM
-actin expression.22,23 Interestingly, the responsiveness of SM
-actin gene to Ang II was markedly decreased by blocking endogenous myocardin either using MyoC
381 or pMighty-
Myo. These results provide direct evidence indicating that endogenous myocardin plays an important role in mediating Ang II-induced increases in SM
-actin expression in SMCs.
|
Prx1 Was Required for Ang II-Induced Increases in SM
-Actin Expression, and Prx1-Induced SM
-Actin Expression Was Attenuated by MyoC
381
Our previous studies showed that Ang II increased Prx1 mRNA expression in SMCs and that Prx1 increased the SRF binding to SM
-actin CArG B by EMSA.11 To clarify the relationship between myocardin and Prx1, several cotransfection experiments were performed. Overexpression of Prx1 increased SM
-actin transcription within the context of either p
A(2.6/+2.8), p
A155Luc, or p
A125Luc construct (Figures 6A through 6C), and the effect of Prx1 was decreased by the mutation of ATTA homeodomain binding site and was completely abolished by the mutation of CArG elements (Figure 6A). Of major significance, cotransfection experiment using pMighty-
Prx1 and p
A(2.6/+2.8) construct revealed that knockdown of Prx1 dramatically reduced basal activity of SM
-actin transcription and completely abolished its Ang II responsiveness (Figure 6B). Cotransfection of pMighty-
Prx1b, which has different target sequences for Prx1, with p
A(2.6/+2/8) construct showed similar results, and endogenous Prx1 expression was confirmed in our cultured SMCs by RT-PCR (data not shown). Moreover, in both p
A(2.6/+2.8) and p
A125Luc reporter constructs, coexpression of MyoC
381 with Prx1 decreased Prx1-induced SM
-actin gene transcription from 4.6- to 3.5-fold [p
A(2.6/+2.8)], and from 3.4- to 2.4-fold (p
A125Luc), respectively (Figure 6C). These results provided direct evidence indicating that Prx1 is required for Ang II-induced SM
-actin expression, but also raise the possibility that activation of SM
-actin gene by Prx1 may be mediated in part by induction of myocardin expression. To address this possibility, the effect of overexpression of Prx1 on myocardin mRNA expression was examined by real-time RT-PCR. However, Prx1 had no effect on myocardin mRNA expression in cultured SMCs (data not shown). These results suggest that the mechanism whereby Prx1 induces SM
-actin gene transcription is to enhance SRF binding activity to CArG B, rather than to increase myocardin expression. Moreover, the fact that MyoC
381 modestly reduced Prx1-induced activation of SM
-actin suggests that Prx1 may activate this gene in part through myocardin-independent pathways.
|
Ang II and Myocardin, Respectively, Increased the Formation of CArG-SRF-Myocardin Complex by EMSA
Results of our previous studies provided evidence for the formation of a unique SMC-selective CArG-SRF-myocardin higher order complex using Ad/Myo-infected SMC nuclear extracts and 95-bp oligonucleotide probe containing CArGs B and A of the SM
-actin promoter.16 Moreover, we previously demonstrated that Ang II increased formation of a CArG-SRF higher order complex in cultured SMCs.11 However, at the time of those studies,11 the identity of the SRF-associated proteins was not known. To determine whether myocardin was part of the Ang II-induced CArG-SRF higher order complex, EMSA was performed using extracts from cultured SMCs infected with an adenovirus overexpressing flag-tagged myocardin or empty adenovirus and treated with Ang II or vehicle. Results showed that overexpression of myocardin (Figure 7, compare lane 2 versus 4) or Ang II treatment (compare lane 2 or 3 versus lane 8 or 9), respectively, increased the formation of a SMC-selective CArG-SRF higher order complex, whereas treatment with both Ang II and Ad/Myo showed no synergistic effect (compare lane 4 versus lane 10). The mobility of both bands was identical, and both bands were supershifted with anti-SRF (lanes 5 and 11) or anti-flag antibody (lanes 6 and 12), suggesting that myocardin was a component of both complexes. In this EMSA, a nonsupershifted band was undetectable in Ad/Myo-infected and Ang II-treated SMC samples that were incubated with anti-flag antibody, in spite of the existence of endogenous myocardin. One possible explanation for this is that there may be much more flag-tagged myocardin than endogenous myocardin, such that most of CArG-SRF-myocardin higher order complex was supershifted.
|
Ang II Had no Effect on the Binding Affinity Between Myocardin and SRF
To further clarify the mechanism whereby Ang II increased the formation of CArG-SRF-myocardin complex, a mammalian two-hybrid assay was used to assess whether the interaction between SRF and myocardin was enhanced by Ang II. SMCs were cotransfected with pBIND-SRF, pACT-myocardin, and pG5Luc reporter plasmid. As shown in Figure 8, the reporter activity was significantly increased in the cells expressing GAL4-SRF and VP16-myocardin after 48-hour incubation. However, Ang II had no effect on the reporter activity in these cells, indicating that Ang II did not increase the binding affinity between SRF and myocardin. Reporter activity was also measured at 24 and 36 hours after transfection, and similar results were obtained. SMCs were also cotransfected with pBIND-SRF, pACT-Prx1, and pG5Luc reporter plasmid, but reporter activity was not increased. Our interpretation of this finding is that the formation of SRF-Prx1 complex was very transient and unstable as suggested previously,14 and thus may not be detected in this assay system.
|
| Discussion |
|---|
|
|
|---|
-actin, myocardin has been shown to activate virtually all CArG-dependent SMC marker genes,1619 suggesting that it may play a role in coordinate induction of these genes in response to Ang II stimulation.10 Indeed, given evidence that a variety of factors that influence expression of SMC marker genes including arginine vasopressin, transforming growth factor-ß1, and platelet-derived growth factor-BB22,23 act in part via CArG-SRF-dependent mechanisms, it is interesting to speculate that myocardin may serve as a point of convergence for regulation of SMC marker genes in response to a number of positive and negative regulators of SMC differentiation.
In this study, we showed that myocardin mRNA expression was increased by Ang II, and that overexpression of myocardin or treatment with Ang II increased the formation of a SMC-selective CArG-SRF-myocardin higher order complex. These results suggest that one mechanism whereby Ang II induces formation of the higher order complex is due to increased expression of myocardin. In contrast, increased formation of the higher order complex does not appear to be due to increased expression SRF protein,11 nor did we find evidence that Ang II increased binding affinity between SRF and myocardin in a mammalian two-hybrid assay. However, of major significance, our results showed that siRNA-induced suppression of Prx1 virtually abolished both basal and Ang II-induced SM
-actin transcription. Results of our previous studies showed that Ang II increased expression of Prx1, and that recombinant Prx1 dramatically increased SRF binding to degenerate SM
-actin 5' CArG elements through mechanisms that involved transient interaction of Prx1 and SRF rather than formation of a stable Prx1-containing shift complex.11 Results thus support a model wherein Ang II-induced increases SM
-actin expression are mediated through Prx1-mediated increases in SRF binding to degenerate CArG elements and subsequent recruitment of myocardin and/or other SRF coactivators. Moreover, because the promoters of many SMC marker genes including SM-MHC, calponin, and desmin also contain conserved degenerate CArG elements that exhibit reduced SRF binding affinity,24 it is interesting to postulate that regulation of SRF binding to degenerate CArG elements through Prx1 may play a key role in overall regulation of SMC differentiation. Consistent with this idea, we previously demonstrated that mutation of the SM
-actin CArG elements to a consensus c-fos CArG resulted in relaxed SMC specificity at least in cultured cell systems.25 Of interest, Prx1 knockout mice have been shown to exhibit major defects in skeletogenesis and to die soon after birth.26 Moreover, mice null for both Prx1 and its homologue, Prx2, showed a vascular abnormality with an abnormal positioning and awkward curvature of the aortic arch and a misdirected and elongated ductus arteriosus.27 However, as yet, no direct studies have been done to directly assess defects in induction of SMC marker genes in these mice, and further studies are warranted.
There is evidence suggesting that Ang II may also increase SMC marker gene expression by increasing binding affinity of SRF to CArG elements, and/or by enhancing cooperativity of CArG-SRF-myocardin complexes. Wang et al19 demonstrated that myocardin could form a homodimer, and authors proposed a model in which dimerized myocardin recruited four SRF and two CArG elements to activate CArG-dependent SMC marker genes. It is thus interesting to suggest that increased expression of myocardin by Ang II might enhance interaction of myocardin with SRF dimers bound to the two 5' CArG elements of the SM
-actin promoter (ie, CArGs B and A), and thereby stimulate SM
-actin gene transcription. This model is consistent with evidence showing that at least two CArG elements appear to be required for myocardin responsiveness,15 that phasing and spacing of these two 5' CArG elements has profound effects on the activity of this promoter,28 and our observations (Figure 7) showing enhanced formation of the CArG-SRF-myocardin higher order complex by overexpression of myocardin. That is, total binding did not seem to be simple function of sequential and independent binding of SRF followed by binding of myocardin. However, in vitro EMSA results may not reflect binding in intact genes, and much further work will be needed to elucidate the precise mechanisms whereby factors such as Ang II and myocardin increase CArG-SRF-myocardin-dependent gene expression.
Although we presented evidence showing that Ang II-induced increases in myocardin expression were mediated through the AT1R, the downstream intracellular signaling pathways responsible for these effects are unknown. One of the pathways that may be involved in Ang II-induced myocardin gene expression is the small GTP-binding protein RhoA. Yamakawa et al29 demonstrated involvement of RhoA in Ang II-induced vascular hypertrophy. They showed that RhoA was translocated from the soluble cytosolic fraction to the particulate fraction by Ang II in cultured SMCs. They also showed that a RhoA inhibitor, C3 exoenzyme, and a Rho-kinase inhibitor, Y-27632, suppressed Ang II-induced vascular hypertrophy as determined by measurements of 3H-leucine incorporation. Moreover, we previously demonstrated that RhoA increased transcription of the SM
-actin gene in cultured SMCs, whereas C3 exoenzyme and Y-27632, respectively, inhibited transcription.30 In addition, we presented evidence that RhoA-dependent regulation of the actin cytoskeleton and alterations in monomeric G-actin concentration selectively controlled SMC marker gene expression by modulating SRF-dependent transcription.30 Although the mechanisms linking RhoA activity and changes in actin to SMC gene transcription are unknown, these factors may be involved in Ang II-induced myocardin and SM
-actin expression. Of interest, Miralles et al31 recently showed that RhoA-actin signaling regulated the subcellular localization of the myocardin-related SRF coactivator, MAL (also known as MKL1, BSAC, and MRTF-A). MAL is normally sequestered by G-actin in the cytoplasm of serum-starved fibroblasts, but accumulates in the nucleus following serum stimulation. Although in SMCs myocardin is claimed to be localized in the nucleus,16 translocation of myocardin from cytoplasm to nucleus may also contribute to Ang II-induced SMC marker gene transcription. Furthermore, Liu et al32 have shown evidence for RhoA/Rho kinase-dependent nuclear localization of SRF. As such, it is interesting to postulate a model in which Ang II-induced activation of RhoA and subsequent translocation of SRF and/or myocardin/MAL may contribute to activation of CArG-dependent SMC genes, although there is no direct evidence for this at present.
In summary, the results of the present study provide evidence that myocardin and Prx1 play a key role in Ang II-induced expression of SM
-actin gene in rat aortic SMCs, and suggest that these effects are mediated in part by enhanced myocardin expression and SRF binding to CArG elements within the SM
-actin promoter. Further studies are required to determine whether myocardin also plays a role in Ang II-induced vascular hypertrophy in vivo.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Owens GK. Differential effects of antihypertensive drug therapy on vascular smooth muscle cell hypertrophy, hyperploidy, and hyperplasia in the spontaneously hypertensive rat. Circ Res. 1985; 56: 525536.
3. Owens GK, Schwartz SM. Alterations in vascular smooth muscle mass in the spontaneously hypertensive rat: role of cellular hypertrophy, hyperploidy, and hyperplasia. Circ Res. 1982; 51: 280289.
4. Lichtenstein AH, Brecher P, Chobanian AV. Effects of deoxycorticosterone-salt hypertension on cell ploidy in the rat aorta. Hypertension. 1986; 8 (pt 2): II50II54.[Medline] [Order article via Infotrieve]
5. Owens GK. Influence of blood pressure on development of aortic medial smooth muscle hypertrophy in spontaneously hypertensive rats. Hypertension. 1987; 9: 178187.
6. Geisterfer AAT, Peach MJ, Owens GK. Angiotensin II induces hypertrophy, not hyperplasia, of cultured rat aortic smooth muscle cells. Circ Res. 1988; 62: 749756.
7. Berk BC, Vekshtein V, Gordon HM, Tsuda T. Angiotensin II-stimulated protein synthesis in cultured vascular smooth muscle cells. Hypertension. 1989; 13: 305314.
8. Rao GN, Griendling KK, Frederickson RM, Sonenberg N, Alexander RW. Angiotensin II induces phosphorylation of eukaryotic protein synthesis initiation factor 4E in vascular smooth muscle cells. J Biol Chem. 1994; 269: 71807184.
9. Hershey JC, Hautmann M, Thompson MM, Rothblum LI, Haystead TAJ, Owens GK. Angiotensin II-induced hypertrophy of rat vascular smooth muscle is associated with increased 18S rRNA synthesis and phosphorylation of the rRNA transcription factor, upstream binding factor. J Biol Chem. 1995; 270: 2509625101.
10. Turla MB, Thompson MM, Corjay MH, Owens GK. Mechanisms of angiotensin II- and arginine vasopressin-induced increases in protein synthesis and content in cultured rat aortic smooth muscle cells: evidence for selective increases in smooth muscle isoactin expression. Circ Res. 1991; 68: 288299.
11. Hautmann MB, Thompson MM, Swartz EA, Olson EN, Owens GK. Angiotensin II-induced stimulation of smooth muscle
-actin expression by serum response factor and the homeodomain transcription factor MHox. Circ Res. 1997; 81: 600610.
12. Mack CP, Owens GK. Regulation of smooth muscle
-actin expression in vivo is dependent on CArG elements within the 5' and first intron promoter regions. Circ Res. 1999; 84: 852861.
13. Norman C, Runswick M, Pollock R, Treisman R. Isolation and property of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element. Cell. 1988; 55: 9891003.[CrossRef][Medline] [Order article via Infotrieve]
14. Grueneberg DA, Natesan S, Alexandre C, Gilman MZ. Human and Drosophila homeodomain proteins that enhance the DNA-binding activity of serum response factor. Science. 1992; 257: 10891095.
15. Wang D-Z, Chang PS, Wang Z, Sutherland L, Richardson JA, Small E, Krieg PA, Olson EN. Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell. 2001; 105: 851862.[CrossRef][Medline] [Order article via Infotrieve]
16. Yoshida T, Sinha S, Dandré F, Wamhoff BR, Hoofnagle MH, Kremer BE, Wang D-Z, Olson EN, Owens GK. Myocardin is a key regulator of CArG-dependent transcription of multiple smooth muscle marker genes. Circ Res. 2003; 92: 856864.
17. Du KL, Ip HS, Li J, Chen M, Dandre F, Yu W, Lu MM, Owens GK, Parmacek MS. Myocardin is a critical serum response factor cofactor in the transcriptional program regulating smooth muscle cell differentiation. Mol Cell Biol. 2003; 23: 24252437.
18. Chen J, Kitchen CM, Streb JW, Miano JM. Myocardin: a component of a molecular switch for smooth muscle differentiation. J Mol Cell Cardiol. 2002; 34: 13451356.[CrossRef][Medline] [Order article via Infotrieve]
19. Wang Z, Wang D-Z, Pipes GCT, Olson EN. Myocardin is a master regulator of smooth muscle gene expression. Proc Natl Acad Sci U S A. 2003; 100: 71297134.
20. Li S, Wang D-Z, Wang Z, Richardson JA, Olson EN. The serum response factor coactivator myocardin is required for vascular smooth muscle development. Proc Natl Acad Sci U S A. 2003; 100: 93669370.
21. Yoshida T, Yoshino J, Hayashi M, Saruta T. Identification of a renal proximal tubular cell-specific enhancer in the mouse 25-hydroxyvitamin D 1
-hydroxylase gene. J Am Soc Nephrol. 2002; 13: 14551463.
22. Putten VV, Li X, Maselli J, Nemenoff RA. Regulation of smooth muscle
-actin promoter by vasopressin and platelet-derived growth factor in rat aortic vascular smooth muscle cells. Circ Res. 1994; 75: 11261130.
23. Hautmann MB, Madsen CS, Owens GK. A transforming growth factor ß (TGFß) control element drives TGFß-induced stimulation of smooth muscle
-actin gene expression in concert with two CArG elements. J Biol Chem. 1997; 272: 1094810956.
24. Miano JM. Serum response factor: toggling between disparate programs of gene expression. J Mol Cell Cardiol. 2003; 35: 577593.[CrossRef][Medline] [Order article via Infotrieve]
25. Hautmann MB, Madsen CS, Mack CP, Owens GK. Substitution of the degenerate smooth muscle (SM)
-actin CC(A/T-rich)6GG elements with c-fos serum response elements results in increased basal expression but relaxed SM cell specificity and reduced angiotensin II inducibility. J Biol Chem. 1998; 273: 83988406.
26. Martin JF, Bradley A, Olson EN. The. paired-like homeo box gene MHox is required for early events of skeletogenesis in multiple lineages. Genes Dev. 1995; 9: 12371249.
27. Bergwerff M, Gittenberger-de Groot AC, Wisse LJ, DeRuiter MC, Wessels A, Martin JF, Olson EN, Kern MJ. Loss of function of the Prx1 and Prx2 homeobox genes alters architecture of the great elastic arteries and ductus arteriosus. Virchows Arch. 2000; 436: 1219.[CrossRef][Medline] [Order article via Infotrieve]
28. Mack CP, Thompson MM, Lawrenz-Smith S, Owens GK. Smooth muscle
-actin CArG elements coordinate formation of a smooth muscle cell-selective, serum response factor-containing activation complex. Circ Res. 2000; 86: 221232.
29. Yamakawa T, Tanaka S, Numaguchi K, Yamakawa Y, Motley ED, Ichihara S, Inagami T. Involvement of Rho-kinase in angiotensin II-induced hypertrophy of rat vascular smooth muscle cells. Hypertension. 2000; 35 (pt2): 313318.
30. Mack CP, Somlyo AV, Hautmann M, Somlyo AP, Owens GK. Smooth muscle differentiation marker gene expression is regulated by RhoA-mediated actin polymerization. J Biol Chem. 2001; 276: 341347.
31. Miralles F, Posern G, Zaromytidou A-I, Treisman R. Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell. 2003; 113: 329342.[CrossRef][Medline] [Order article via Infotrieve]
32. Liu HW, Halayko AJ, Fernandes DJ, Harmon GS, McCauley JA, Kocieniewski P, McConville J, Fu Y, Forsythe SM, Kogut P, Bellam S, Dowell M, Churchill J, Lesso H, Kassiri K, Mitchell RW, Hershenson MB, Camoretti-Mercado B, Solway J. The RhoA/Rho kinase pathway regulates nuclear localization of serum response factor. Am J Respir Cell Mol Biol. 2003; 29: 3943.
This article has been cited by other articles:
![]() |
H. P. Makarenkova, K. N. Gonzalez, W. B. Kiosses, and R. Meech Barx2 Controls Myoblast Fusion and Promotes MyoD-mediated Activation of the Smooth Muscle{alpha}-Actin Gene J. Biol. Chem., May 29, 2009; 284(22): 14866 - 14874. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Xie, Y. Fan, H. Zhang, Y. Zhang, M. She, D. Gu, C. Patterson, and H. Li CHIP Represses Myocardin-Induced Smooth Muscle Cell Differentiation via Ubiquitin-Mediated Proteasomal Degradation Mol. Cell. Biol., May 1, 2009; 29(9): 2398 - 2408. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shang, T. Yoshida, B. A. Amendt, J. F. Martin, and G. K. Owens Pitx2 is functionally important in the early stages of vascular smooth muscle cell differentiation J. Cell Biol., October 14, 2008; 181(3): 461 - 473. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Jiang and B. Stefanovic Homeobox Gene Prx1 Is Expressed in Activated Hepatic Stellate Cells and Transactivates Collagen {alpha}1(I) Promoter Experimental Biology and Medicine, March 1, 2008; 233(3): 286 - 296. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, C.-H. Ha, C. Wong, W. Wang, A. Hausser, K. Pfizenmaier, E. N. Olson, T. A. McKinsey, and Z.-G. Jin Angiotensin II Stimulates Protein Kinase D-Dependent Histone Deacetylase 5 Phosphorylation and Nuclear Export Leading to Vascular Smooth Muscle Cell Hypertrophy Arterioscler. Thromb. Vasc. Biol., November 1, 2007; 27(11): 2355 - 2362. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. G. McDonald and G. K. Owens Programming Smooth Muscle Plasticity With Chromatin Dynamics Circ. Res., May 25, 2007; 100(10): 1428 - 1441. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Jin, M. J. Kern, C. A. Otey, B. R. Wamhoff, and A. V. Somlyo Angiotensin II, Focal Adhesion Kinase, and PRX1 Enhance Smooth Muscle Expression of Lipoma Preferred Partner and its Newly Identified Binding Partner Palladin to Promote Cell Migration Circ. Res., March 30, 2007; 100(6): 817 - 825. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kawai-Kowase and G. K. Owens Multiple repressor pathways contribute to phenotypic switching of vascular smooth muscle cells Am J Physiol Cell Physiol, January 1, 2007; 292(1): C59 - C69. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Herring, O. El-Mounayri, P. J. Gallagher, F. Yin, and J. Zhou Regulation of myosin light chain kinase and telokin expression in smooth muscle tissues Am J Physiol Cell Physiol, November 1, 2006; 291(5): C817 - C827. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Han, W.-Y. Hu, O. Chernaya, N. Antic, L. Gu, M. Gupta, M. Piano, and P. de Lanerolle Increased Myosin Light Chain Kinase Expression in Hypertension: Regulation by Serum Response Factor via an Insertion Mutation in the Promoter Mol. Biol. Cell, September 1, 2006; 17(9): 4039 - 4050. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Yin, A. M. Hoggatt, J. Zhou, and B. P. Herring 130-kDa smooth muscle myosin light chain kinase is transcribed from a CArG-dependent, internal promoter within the mouse mylk gene Am J Physiol Cell Physiol, June 1, 2006; 290(6): C1599 - C1609. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Wamhoff, D. K. Bowles, and G. K. Owens Excitation-Transcription Coupling in Arterial Smooth Muscle Circ. Res., April 14, 2006; 98(7): 868 - 878. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gorenne, L. Jin, T. Yoshida, J.M. Sanders, I.J. Sarembock, G.K. Owens, A.P. Somlyo, and A.V. Somlyo LPP Expression During In Vitro Smooth Muscle Differentiation and Stent-Induced Vascular Injury Circ. Res., February 17, 2006; 98(3): 378 - 385. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Qiu, R. P. Ritchie, Z. Fu, D. Cao, J. Cumming, J. M. Miano, D.-Z. Wang, H. J. Li, and L. Li Myocardin Enhances Smad3-Mediated Transforming Growth Factor-{beta}1 Signaling in a CArG Box-Independent Manner: Smad-Binding Element Is an Important cis Element for SM22{alpha} Transcription In Vivo Circ. Res., November 11, 2005; 97(10): 983 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kawai-Kowase, M. S. Kumar, M. H. Hoofnagle, T. Yoshida, and G. K. Owens PIAS1 Activates the Expression of Smooth Muscle Cell Differentiation Marker Genes by Interacting with Serum Response Factor and Class I Basic Helix-Loop-Helix Proteins Mol. Cell. Biol., September 15, 2005; 25(18): 8009 - 8023. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu, S. Sinha, O. G. McDonald, Y. Shang, M. H. Hoofnagle, and G. K. Owens Kruppel-like Factor 4 Abrogates Myocardin-induced Activation of Smooth Muscle Gene Expression J. Biol. Chem., March 11, 2005; 280(10): 9719 - 9727. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshida and G. K. Owens Molecular Determinants of Vascular Smooth Muscle Cell Diversity Circ. Res., February 18, 2005; 96(3): 280 - 291. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshida, K. Kawai-Kowase, and G. K. Owens Forced Expression of Myocardin Is Not Sufficient for Induction of Smooth Muscle Differentiation in Multipotential Embryonic Cells Arterioscler. Thromb. Vasc. Biol., September 1, 2004; 24(9): 1596 - 1601. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.R. Wamhoff, D.K. Bowles, O.G. McDonald, S. Sinha, A.P. Somlyo, A.V. Somlyo, and G.K. Owens L-type Voltage-Gated Ca2+ Channels Modulate Expression of Smooth Muscle Differentiation Marker Genes via a Rho Kinase/Myocardin/SRF-Dependent Mechanism Circ. Res., August 20, 2004; 95(4): 406 - 414. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |