Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2004;94:462-470
Published online before print December 29, 2003, doi: 10.1161/01.RES.0000115555.05668.93
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
94/4/462    most recent
01.RES.0000115555.05668.93v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calzada, M. J.
Right arrow Articles by Roberts, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calzada, M. J.
Right arrow Articles by Roberts, D. D.
Related Collections
Right arrow Angiogenesis
Right arrow Animal models of human disease
Right arrow Endothelium/vascular type/nitric oxide
(Circulation Research. 2004;94:462.)
© 2004 American Heart Association, Inc.


Molecular Medicine

{alpha}4ß1 Integrin Mediates Selective Endothelial Cell Responses to Thrombospondins 1 and 2 In Vitro and Modulates Angiogenesis In Vivo

Maria J. Calzada, Longen Zhou, John M. Sipes, Jane Zhang, Henry C. Krutzsch, M. Luisa Iruela-Arispe, Douglas S. Annis, Deane F. Mosher, David D. Roberts

From the Laboratory of Pathology (M.J.C., L.Z., J.M.S., J.Z., H.C.K., D.D.R.), National Cancer Institute, National Institutes of Health, Bethesda, Md; Department of Molecular, Cell and Developmental Biology (M.L.I.-A.), UCLA, Los Angeles, Calif; and the Department of Medicine (D.S.A., D.F.M.), University of Wisconsin–Madison, Madison, Wis.

Correspondence to David D. Roberts, PhD, NIH, Building 10 Room 2A33, 10 Center Dr, Bethesda, MD 20892-1500. E-mail droberts{at}helix.nih.gov


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
We examined the function of {alpha}4ß1 integrin in angiogenesis and in mediating endothelial cell responses to the angiogenesis modulators, thrombospondin-1 and thrombospondin-2. {alpha}4ß1 supports adhesion of venous endothelial cells but not of microvascular endothelial cells on immobilized thrombospondin-1, vascular cell adhesion molecule-1, or recombinant N-terminal regions of thrombospondin-1 and thrombospondin-2. Chemotactic activities of this region of thrombospondin-1 and thrombospondin-2 are also mediated by {alpha}4ß1, whereas antagonism of fibroblast growth factor-2–stimulated chemotaxis is not mediated by this region. Immobilized N-terminal regions of thrombospondin-1 and thrombospondin-2 promote endothelial cell survival and proliferation in an {alpha}4ß1-dependent manner. Soluble {alpha}4ß1 antagonists inhibit angiogenesis in the chick chorioallantoic membrane and neovascularization of mouse muscle explants. The latter inhibition is thrombospondin-1–dependent and not observed in explants from thrombospondin-1-/- mice. Antagonizing {alpha}4ß1 may in part block proangiogenic activities of thrombospondin-1 and thrombospondin-2, because N-terminal regions of thrombospondin-1 and thrombospondin-2 containing the {alpha}4ß1 binding sequence stimulate angiogenesis in vivo. Therefore, {alpha}4ß1 is an important endothelial cell receptor for mediating motility and proliferative responses to thrombospondins and for modulation of angiogenesis.


Key Words: adhesion • proliferation • migration • angiogenesis • peptides


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Angiogenesis, the outgrowth of new blood vessels from existing vasculature, is an important event in normal development and pathological conditions such as cancer. Angiogenesis is regulated by interactions of endothelial cells with growth factors and components of the extracellular matrix that either promote or inhibit angiogenesis.1 Thrombospondins (TSPs) have diverse effects on cell behavior.2 Two members of this family, TSP1 and TSP2, are known to modulate angiogenic responses. TSP1 and TSP2 have antiangiogenic as well as antitumor activities in several xenograft models.3–6 TSP1 and TSP2 presumably regulate angiogenesis through their modulation of endothelial cell proliferation,7–9 motility,7,10 and apoptosis.11,12

Based on in vitro and in vivo angiogenesis assays, antiangiogenic activities of TSP1 and TSP2 have been mapped to the procollagen-homology domain and the type 1 repeats.13–15 Inhibition is mediated through interactions with CD36 and proteoglycan receptors.14–16 However, the N-terminal domain of TSP1 stimulates angiogenesis,17,18 in part through its interaction with {alpha}3ß1 integrin.18 TSP1 may also influence their behavior through additional TSP receptors expressed on endothelial cells, including LDL receptor–related protein, {alpha}vß3 and {alpha}6ß1 integrins, and CD47 or by activating latent TGFß.2,19

The role of TSP1 in angiogenesis is therefore complex, and includes both proangiogenic and antiangiogenic activities. Acquisition of an angiogenic phenotype is frequently associated with decreased expression of TSP1 or TSP2,20–22 whereas restoration of TSP1 levels in tumor cells reduces angiogenesis and tumor progression.3 Correlating levels of TSP1 with tumor progression and clinical prognosis in cancer patients, however, has yielded conflicting results.23–26 To understand its role in cancer and to define a molecular basis for the complex endothelial cell responses to TSP1, we must understand how the simultaneous signals from multiple TSP1 receptors are integrated. The complete identification of endothelial cell TSP1 receptors is the critical first step toward this goal.

In addition to the known endothelial cell receptors, TSP1 interacts with {alpha}4ß1 integrin on T cells27 and some cancer cells.28,29 A sequence in TSP1 recognized by {alpha}4ß1 was mapped to the N-terminal domain and is also conserved in TSP2.27 Leukocyte {alpha}4ß1 is a well-characterized counter receptor for endothelial cell vascular cell adhesion molecule-1 (VCAM-1),30 but its function in endothelial cells is poorly understood. The {alpha}4 integrin subunit is expressed in endothelial cells in vitro31,32 and in vivo,33 suggesting that {alpha}4ß1 could be an additional receptor for TSPs in these cells. We therefore examined the role of {alpha}4ß1 in venous and microvascular endothelial cell responses to TSP1 and TSP2 in vitro. Our data show that {alpha}4ß1 is an endothelial TSP receptor that regulates cell proliferation, adhesion, and migration. In vivo and ex vivo angiogenesis assays indicate that {alpha}4ß1 plays important roles in angiogenesis and its regulation by TSP1.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
Human umbilical vein endothelial cells (HUVECs) were maintained in M199 containing 20% FBS, 2 mmol/L glutamine, 80 µg/mL endothelial cell mitogen, and 10 µg/mL heparin. Human dermal microvascular endothelial cells (HDMVECs) and human lung microvascular endothelial (HMVE-L) cells were maintained as specified by the manufacturer (Clonetics). Adult iliac vein endothelial cells (AG10773A) were grown on flasks coated with 0.1% gelatin in medium M199 containing 10% FBS, 2 mmol/L glutamine, 30 µg/mL endothelial cell mitogen, and 30 µg/mL heparin.

Proteins, Peptides, and Antibodies
TSP1 was purified from human platelets. Recombinant trimeric proteins consisting of the N-terminal module (N), oligomeration sequence (o), and procollagen module (C) of TSP1 (NoC1) residues 1 to 356, or TSP2 (NoC2) residues 1 to 35934 and monomeric N-terminal module of TSP1 (residues 1 to 175)14 were prepared as described previously. Synthetic peptides containing TSP1 sequences were prepared as described.35 Recombinant soluble 7-domain VCAM-1 (residues 1 to 674) was prepared as described.27 VEGF was from R&D Systems, FGF2 from Prizm Pharmaceuticals, and Vitrogen type I collagen from Cohesion Technologies.

The ß1 integrin–activating antibody TS2/16 was purified from hybridoma supernatant.36 Anti-{alpha}4 and anti-{alpha}3 antibodies, P4C2 and Asc-1, respectively, were from Chemicon. The anti-ß1 blocking antibody mAb13 was provided by Dr Ken Yamada, National Institutes of Dental and Craniofacial Research, Bethesda, Md. The {alpha}4ß1 antagonist (4-((2-methylphenyl)aminocarbonyl) aminophenyl)acetyl-LDVP (phLDVP)37 was obtained from Bachem.

Endothelial Cell Functional Assays
Adhesion of endothelial cells was assessed as described.28 Chemotaxis was assessed using modified Boyden chambers and 8-µm pore membranes. Endothelial cell proliferation was quantified using a tetrazolium proliferation assay (Promega).

Integrin Expression Analyses
Cells were washed and incubated with TS2/16 or P4C2 for 1 hour. Cells were washed, incubated with FITC-conjugated anti-mouse antibody, washed, and fixed with 1% formaldehyde. Flow cytometry data were acquired using a Becton Dickinson flow cytometer. Cell lysates labeled with EZ-Link Sulfo-NHS-LC-Biotin (Pierce) were immunoprecipitated using 2 µg of P4C2 or Asc-1. The immune complexes were analyzed by Western blotting.

Angiogenesis Assays
Effects of the {alpha}4ß1-binding peptide from TSP1 and other {alpha}4ß1 antagonists on angiogenesis were evaluated using the chick chorioallantoic membrane (CAM) angiogenesis assay as described previously.15 Muscle explant vascularization in a 3-dimensional collagen matrix was assessed essentially as described.38

siRNA-Mediated Knockdown of {alpha}4ß1 Integrin
Selection of the target sequence AACUAUCAACGAAAGAACUGG from human {alpha}4 mRNA was done according to Elbashir et al.39 siRNA duplexes were synthesized using the Silencer siRNA kit (Ambion). HUVECs were transfected using a nuclear-localized ß-Gal expression vector alone, in combination with {alpha}4 siRNA or with {alpha}4 siRNA alone. Transfected cells were maintained in complete medium for 48 to 72 hours before use. Three siRNA sequences were screened initially, and the most active was selected. Adhesion assays were stained using 5-bromo-4-chloro-3-indoyl-ß-D-Gal to identify transfected cells.

An expanded Materials and Methods section can be found in the online data supplement available at http://circres.ahajournals.org.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
{alpha}4ß1 Integrin Mediates Adhesion of Large-Vessel Endothelial Cells on TSP1 and TSP2
{alpha}4ß1 and {alpha}6ß1 recognize N-terminal regions of both TSP1 and TSP2,19,27 whereas {alpha}3ß1 recognizes a sequence in this region of TSP1 that is not conserved in TSP235 (Figure 1A). We recently showed that {alpha}6ß1 is not a functional TSP receptor in HUVECs.19 However, the ß1 integrin–activating antibody TS2/16 increased adhesion of HUVECs similarly on recombinant portions of both TSP1 (NoC1) and TSP2 (NoC2) (Figure 1B). The cells spread on NoC1 and NoC2 forming prominent lamellipodia (Figure 1C). These results are consistent with the similar activities of NoC1 and NoC2 for interacting with {alpha}4ß1 on T cells.27



View larger version (59K):
[in this window]
[in a new window]
 
Figure 1. {alpha}4ß1 integrin mediates large-vessel endothelial cell adhesion on TSP1 and TSP2. A, ß1 Integrin binding sites of TSP1 and recombinant regions of TSP1 and TSP2. {alpha}4ß1 Mediates activation-dependent HUVEC (B) and AG10773A iliac vein endothelial cell (D) adhesion on N-terminal regions of TSP1 (NoC1) and TSP2 (NoC2) 30 µg/mL. Unstimulated cells (2 to 2.5x105 cells/mL, C) or cells treated with the ß1-activating antibody TS2/16 (5 µg/mL, S) were incubated in the absence or presence of the {alpha}4ß1 inhibitor, phLDVP (1 µmol/L). C, Morphologies of HUVECs activated using TS2/16 attaching on TSP1, NoC1, or NoC2. Bar=50 µm. E, Cell attachment (solid bars) and spreading (striped bars) on TSP1(1–175) (30 µg/mL) was determined using cells activated with TS2/16 and quantified after 1 hour. Results are expressed as the number of cells/mm2 ±SD, from 3 experiments. *P<0.05 relative to control.

Recognition of N-terminal regions of TSP1 and TSP2 is at least partially dependent on {alpha}4ß1 because an {alpha}4ß1-specific antagonist, phLDVP, partially inhibited adhesion of HUVECs and AG10773A venous endothelial cells on TSP1, NoC1, and NoC2 (P<=0.01) (Figures 1B and 1D). Recombinant TSP1(1–175), which contains the {alpha}4ß1 binding site27 but lacks the recognition site for {alpha}3ß1,35 also mediated HUVEC adhesion and was inhibited by phLDVP (P<=0.007) (Figure 1E). Therefore, this region of TSP1 is sufficient for promoting {alpha}4ß1-dependent endothelial cell adhesion.

To confirm a direct role of {alpha}4ß1 as an endothelial cell TSP receptor, we suppressed the expression of {alpha}4 integrin in HUVECs using RNA interference (siRNA). In cells cotransfected with a ß-galactosidase expression plasmid and {alpha}4 siRNA, attachment on TSP1, TSP1 (1–175), and NoC2 was significantly decreased relative to control cultures transfected with the ß-galactosidase plasmid alone (Figure 2A). The effect of the siRNA on adhesion to TSPs was specific, in that {alpha}2/{alpha}1ß1-mediated adhesion on type I collagen was not affected (Figure 2A). Loss of {alpha}4 expression in siRNA-transfected cells was confirmed by Western blotting (Figure 2B). Densitometric analysis showed a 5.7-fold decrease in {alpha}4 expression, whereas {alpha}3 expression did not show a significant change (Figure 2B). Therefore, {alpha}4ß1 is required for venous endothelial cell adhesion to TSP1 and an N-terminal region of TSP2.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. Suppression of {alpha}4ß1 expression inhibits HUVEC adhesion on TSP1 and TSP2. A, HUVECs cotransfected with ßGal plasmid and {alpha}4 siRNA or transfected with ßGal plasmid alone were incubated in dishes coated with TSP1 (40 µg/mL), TSP1(1–175), NoC2 (30 µg/mL), or type I collagen (5 µg/mL) in the presence of TS2/16 antibody. Cell adhesion was quantified after 1 hour. Results are expressed as percentage of siRNA-transfected cell adhesion with respect to cells transfected with ßGal alone as a control ±SD. B, Cell lysates from {alpha}4 siRNA-transfected cells or control were immunoprecipitated with anti-{alpha}3 (Asc-1) or anti-{alpha}4 (P4C2) antibodies. {alpha}4 Immunoprecipitates were also immunoblotted with P4C2.

{alpha}4ß1 Does Not Mediate Adhesion of Microvascular Endothelial Cells
Adhesion of microvascular endothelial cells on NoC1 and NoC2 is also ß1 integrin–dependent, based on complete inhibition by a ß1-blocking antibody19 and stimulation by a ß1-activating antibody (Figure 3A). However, the {alpha}4ß1 inhibitor phLDVP did not significantly inhibit adhesion of either HDMVECs or HME-L cells on NoC1 or NoC2 (Figures 3A and 3B). Adhesion of microvascular cells, therefore, is mediated exclusively by {alpha}3ß1 and {alpha}6ß1.18,19



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. {alpha}4ß1 Integrin does not contribute to microvascular endothelial cell adhesion on TSP1 or TSP2. A, Unstimulated (C) or TS2/16-activated HDMVECs (S, 2 to 2.5x105 cells/mL) were incubated on dishes coated using TSP1 (40 µg/mL), NoC1 or NoC2 (30 µg/mL) in triplicate. B, {alpha}4ß1-dependence was tested using phLDVP (1 µmol/L). TS2/16-activated HMVE-L cells were incubated on the indicated substrates alone or in the presence of phLDVP. Cell attachment and spreading after 1 hour are expressed as cells/mm2 ±SD, n=3.

Although microvascular cells exhibited no {alpha}4ß1-dependent adhesion on TSPs, they express {alpha}4ß1 (Figures 4A and 4B). The modest difference in {alpha}4 subunit surface expression between HUVECs and HDMVECs measured by flow cytometry (Figure 4A) was not sufficient to account for the differences in adhesion. To exclude the possibility that {alpha}4 pairs only with ß7 subunits in microvascular cells, cell lysates were immunoprecipitated using an {alpha}4 antibody and immunoblotted with a ß1 antibody. The amount of {alpha}4 complexed with ß1 was only slightly lower in HDMVECs than in HUVECs (Figure 4B). Thus, {alpha}4ß1 is present but may be maintained in an inactive state in microvascular cells. Consistent with this hypothesis, adhesion of HDMVECs to the {alpha}4ß1 ligand VCAM-1 was minimal relative to HUVECs and was not significantly stimulated by TS2/16 (Figure 4C).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. {alpha}4 Integrin expression in HUVECs and HDMVECs. A, HUVECs and HDMVECs were stained using antibodies specific for {alpha}4 (P4C2) and ß1 (TS2/16) subunits (2 µg/106 cells, thick lines) or isotype control (thin lines) and for surface expression analyzed by flow cytometry. B, Cell lysates from both cell types were immunoprecipitated using P4C2, resolved on SDS gels, and immunoblotted with TS2/16 (0.5 µg/mL). C, Adhesion on immobilized S7D-VCAM-1 (5 µg/mL) or TSP1 (40 µg/mL) was measured using unstimulated (C) or TS2/16-activated HUVECs and HDMVECs (S). Attached (solid bars) and spread cells (striped bars) after 1 hour and are expressed as cells/mm2 ±SD, n=3.

TSP1 and TSP2 Promote Endothelial Cell Survival and Proliferation Through {alpha}4ß1 Integrin
TSP1 has context-dependent effects on endothelial cell proliferation. In solution, it inhibits proliferation,7,40 whereas immobilized TSP1 stimulates proliferation at least in part through {alpha}3ß1.18 We examined whether {alpha}4ß1 also contributes to the proliferative activity of TSP1 and whether TSP2 shares this activity. Plating HUVECs on immobilized NoC1 and NoC2 at 0.1 µg/mL supported initial adhesion and cell survival, and higher concentrations dose-dependently increased cell numbers after 72 hours (Figure 5A). The cells did not attach or survive after 72 hour on wells without the proteins, indicating that immobilized N-terminal regions of TSP1 and TSP2 have both growth- and survival-promoting activities. Consistent with their differential {alpha}4ß1 activities, proliferation of HUVECs on NoC1 and NoC2 was greater than for HDMVECs (Figure 5B).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 5. Immobilized {alpha}4ß1 ligands promote endothelial cell survival and proliferation. A, Immobilized NoC1 and NoC2 stimulate HUVEC proliferation in a concentration-dependent manner. B, NoC1 and NoC2 differentially promote proliferation of HUVECs (circles) and HDMVECs (triangles). Proliferation was assessed after 72 hours at 37°C in the presence of TS2/16 (5 µg/mL). C, HUVEC survival and proliferation on immobilized NoC2 were assessed in the absence or presence of {alpha}4ß1-blocking antibody P4C2 (5 µg/mL) or phLDVP (1 µmol/L). D, Effect of immobilized S7D-VCAM-1 on HUVEC survival and proliferation was estimated at the indicated times in the absence or presence of P4C2 (5 µg/mL) or phLDVP (1 µmol/L). Duplicate plates developed at 1 hour were used to determine the starting cell number. Data were corrected for reagent background and are expressed as mean±SD, n=3. *P<=0.05.

Using NoC2 to avoid contributions of {alpha}3ß1 to the observed proliferative response,18 we examined the activities of two {alpha}4ß1 antagonists (Figure 5C). NoC2 at >0.5 µg/mL stimulated net proliferation, which was significantly inhibited by phLDVP and the {alpha}4ß1-blocking antibody (P<=0.04; Figure 5C). Cell adhesion, survival, and proliferation were also promoted by the immobilized {alpha}4ß1 ligand VCAM-1 at >0.7 µg/mL. Net proliferation stimulated by immobilized VCAM-1 was also inhibited by the {alpha}4ß1 antibody and phLDVP (P<=0.02; Figure 5D). Based on these data, {alpha}4ß1 mediates proliferative responses of venous endothelial cells to immobilized NoC2 and VCAM-1.

{alpha}4ß1 Mediates Endothelial Cell Chemotaxis
TSP1-stimulated chemotaxis of murine lung capillary and bovine aortic endothelial cells was inhibited by an antibody recognizing the N-module of TSP1.7 {alpha}3ß1 and {alpha}6ß1 contribute to this response for microvascular cells,19 but the receptor mediating venous endothelial cell motility to TSPs has not been identified. A report that {alpha}4ß1 mediates HUVEC chemotaxis stimulated by soluble VCAM-141 suggested {alpha}4ß1 may be involved. TSP1, NoC1, and NoC2 stimulated chemotaxis of HUVECs with similar dose dependencies (Figure 6A). The {alpha}4ß1 antagonist phLDVP strongly inhibited chemotactic responses to both TSP1 and NoC2 (Figures 6B and 6C). This inhibition was specific, because phLDVP did not inhibit the chemotactic activity of a recombinant region of fibronectin containing only its {alpha}5ß1 binding site (online Figure 1, available in the online data supplement at http://circres.ahajournals.org). Therefore, {alpha}4ß1 plays a role in endothelial cell chemotaxis to TSP1 and TSP2.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. {alpha}4ß1 Mediates chemotaxis to TSP1, NoC1, and NoC2. TSP1, NoC1, or NoC2 was added in the bottom wells of Boyden chambers at the indicated concentrations (A). HUVECs (0.5 to 1x105/well) added to the top wells were allowed to migrate 6 hours at 37°C in 5% CO2. HUVEC migration induced by the indicated concentrations of TSP1 (B) or NoC2 (C) was assayed with or without phLDVP (1 µmol/L). HUVEC migration induced by FGF2 (5 ng/mL, D) or VEGF (30 ng/mL, E) was assessed with the indicated concentrations of TSP1, NoC1, or NoC2 added with the cells in the upper chamber. Medium with BSA in the bottom chamber was used as a negative control ({blacksquare}). Results are presented as cells migrated/field ±SD, n=3.

In addition to its direct chemotactic activity, TSP1 inhibits endothelial cell motility induced by FGF2.7,10 In microvascular cells, this inhibition is mediated by CD36,16 although TSP1(1–175), which lacks a CD36-binding site, also inhibits FGF2-stimulated chemotaxis of BAE cells.14 The inhibitory activity of TSP1(1–175) was originally attributed to HSPG binding,14 but the present data suggested that {alpha}4ß1 should also be considered. Using HUVECs, which do not express CD36, TSP1 inhibited FGF2-stimulated chemotaxis, but NoC1 and NoC2 did not (Figure 6D).

When VEGF was used in place of FGF2 to stimulate migration of HUVECs, NoC1 and NoC2 weakly inhibited chemotaxis but were approximately 5-fold less active than native TSP1 (Figure 6E). Therefore, the N-terminal region of TSP1 does not contain its inhibitory activity for FGF2-mediated motility, and receptors recognizing this domain, including {alpha}4ß1, are not involved. However, these regions of TSP1 and TSP2 do contain inhibitory activities for VEGF-stimulated chemotaxis that are independent of CD36 expression. The mechanism of this inhibitory activity of TSP1 and TSP2 remains to be defined.

{alpha}4ß1 Antagonists Inhibit Angiogenesis
The activities of {alpha}4ß1 to mediate endothelial adhesion, chemotaxis, and survival responses to TSP1 and TSP2 in vitro suggested that {alpha}4ß1 may mediate proangiogenic activities of both proteins. Consistent with this hypothesis, a synthetic TSP1 peptide containing its {alpha}4ß1 binding site inhibited angiogenesis in the CAM assay (Figure 7A). AELDVP (753) inhibited angiogenesis in CAMs overlaid with either a pure type I collagen matrix or with a collagen plus fibronectin matrix to provide an exogenous {alpha}4ß1 ligand. In both cases, the peptide was specific in that the control VALAEP (755) was inactive. Furthermore, neither peptide altered the angiogenic response in the absence of growth factors (unpublished data, 2003).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Role of {alpha}4ß1 integrin in angiogenesis. A, {alpha}4ß1-binding TSP1 peptide 753 (acetyl-AELDVP) and control peptide 755 (acetyl-VALAEP) were evaluated in a CAM assay. Polymerized matrix of type I collagen alone (circles) or in combination with fibronectin (triangles) containing either 250 ng/mesh VEGF+25 ng FGF2 or vehicle in the presence or absence of peptide was placed onto the CAM of day 11 chicken embryos. Angiogenesis responses ±SEM (n=9 to 12) were normalized to growth factor (defined as 100%) and vehicle controls (0%). Responses were quantified 24 hours after application of matrix to the CAM surface. B, CAM angiogenesis was assessed on the indicated matrices containing either SD7-VCAM-1 or phLDVP, mean±SEM, n=21. C, TSP1-/- and +/+ mouse muscle explants were cultured in Vitrogen matrices in the absence or presence of 1 or 5 µmol/L phLDVP. Vascular outgrowth responses were evaluated by measuring maximal cell migration distances in 4 quadrants from each explant. Data represent the outgrowth migration normalized to controls for 6 explants at each time point, mean±SEM (*P<0.05). These results are representative of 3 independent experiments. D, RNAs from explants were amplified using GAPDH and TSP2 primers±reverse transcriptase (RT) and analyzed after 35 cycles using a 2% agarose gel.

In the presence of growth factors, native TSP1 had equivalent antiangiogenic activities in matrices of type I collagen or collagen plus fibronectin, whereas no response was observed in the absence of growth factors (Table). In contrast to intact TSP1, NoC1 and NoC2 stimulated angiogenesis above the control both in the presence and absence of growth factors. The greater activity of NoC1 compared with NoC2 may result from engaging {alpha}3ß1,18 but the activity of NoC2 suggested that {alpha}4ß1 also contributes to the proangiogenic activities. Engaging {alpha}4ß1 may be sufficient to stimulate angiogenesis in the CAM, because VCAM-1 had a weak proangiogenic activity, similar to NoC2, in the absence of growth factors, and a significant stimulation in the presence of growth factors was observed on the collagen matrix (Table; P<0.005, n=9).


View this table:
[in this window]
[in a new window]
 
Table 1. CAM Angiogenesis in the Presence or Absence of Growth Factors (FGF and VEGF)

This stimulatory activity of VCAM-1 is specific for collagen matrices, however, because addition of soluble VCAM-1 inhibited CAM angiogenesis in a Hydron gel and in a fibronectin matrix (Figure 7B). Under these conditions, soluble VCAM-1 appears to be an {alpha}4ß1 antagonist. Consistent with this, the specific {alpha}4ß1 antagonist phLDVP inhibited angiogenesis in CAM assays using collagen matrices with or without fibronectin (Figure 7B). VCAM-1 in collagen and the N-terminal regions of TSP1 and TSP2, in contrast, may be proangiogenic because they become immobilized in the matrix.

Inhibition by three specific antagonists indicated that {alpha}4ß1 is required for angiogenesis in the CAM. Although exogenous NoC1 stimulated CAM angiogenesis, we could not determine whether TSP1 is an important endogenous ligand for {alpha}4ß1 in this response. To address this question, we used a muscle explant angiogenesis assay38 to compare the sensitivity of neovascularization to an {alpha}4ß1 antagonist in wild-type and TSP1-/- mice (Figure 7C). The {alpha}4ß1 antagonist dose-dependently inhibited vascular outgrowth in explants from wild-type mice at days 3 to 9 (P<=0.05), but not in explants from TSP1-/- mice. Therefore, sensitivity of angiogenesis to {alpha}4ß1 antagonists in this context is clearly TSP1-dependent. Loss of inhibition in the -/- mice was not due to compensatory upregulation of TSP2, based on comparable TSP2 mRNA levels in the wild-type and null explants (Figure 7D).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Leukocyte {alpha}4ß1 plays critical roles in adhesion and migration by binding to VCAM-1 on activated endothelium.30 Although VCAM-1 can modulate angiogenesis,41,42 little is known about {alpha}4ß1 function in endothelial cells. We show in this study that inhibiting {alpha}4ß1 disrupts angiogenic responses in vivo and in vitro. In vitro, {alpha}4ß1 mediates proliferative, adhesive, and chemotactic responses to N-terminal regions of TSP1 and TSP2. Based on differential responses of wild-type and TSP1 null explants to an {alpha}4ß1 antagonist, the ability of endogenous TSP1 to influence muscle explant vascularization depends on this integrin. However, TSP1 is probably not the only ligand for {alpha}4ß1 that modulates vascularization. A soluble form of VCAM-1 induces chemotaxis and proliferation of HUVECs and modulates angiogenesis in both cornea41 and CAM assays. Fibronectin, TSP2,27 and osteopontin43 are also {alpha}4ß1 ligands. Because angiogenesis involves smooth muscle cells and pericytes as well as endothelial cells, the functions of {alpha}4ß1 that are disrupted by {alpha}4ß1 antagonists may not be limited to endothelium.

Endothelial cells now have three identified ß1 integrins that recognize TSP1, and these integrins have some overlapping functions. {alpha}3ß1 mediates adhesion and chemotaxis but has both stimulatory and inhibitory effects on proliferation.18,19 {alpha}6ß1 mediates adhesion and chemotaxis, but only in microvascular endothelial cells.19 Our data show that immobilized {alpha}4ß1 ligands selectively mediate venous endothelial adhesion and stimulate cell survival and proliferation. In addition, {alpha}4ß1 mediates chemotactic responses of venous endothelial cells to soluble TSP1 and TSP2. Both {alpha}4ß1 and {alpha}3ß1 contribute to angiogenesis in the CAM. Stimulation of angiogenesis by NoC2 demonstrates a role for {alpha}4ß1, but the stronger proangiogenic activity of NoC1 suggests that {alpha}3ß1 and {alpha}4ß1 are both proangiogenic TSP1 receptors.

Differential regulation may be key to understanding how functions of the eight endothelial cell TSP receptors identified to date are coordinated. {alpha}4ß1 and {alpha}3ß11 are widely expressed in endothelium,33,44 but their functional regulation differs. {alpha}3ß1 is inactivated by cell-cell contact and, therefore, may function as a TSP1 receptor only during vascular remodeling.18 {alpha}6ß1 is active only on microvascular cells,19 whereas {alpha}4ß1 functions are largely restricted to large-vessel endothelium. {alpha}4ß1-dependent adhesion is not regulated by cell contact (unpublished data, 2003). CD36 is expressed and functions selectively on microvascular endothelium.45,46 CD36 is required for inhibition of FGF2-stimulated endothelial cell chemotaxis in vitro16 and for inhibition of angiogenesis in the cornea.12 Differential effects of TSP1 on HUVEC and HDMVEC proliferation at concentrations lower than 10 nmol/L9 are also consistent with an inhibitory activity mediated by CD36.

Although native TSP1 has no proangiogenic activity in the CAM assay, NoC1, NoC2, and other contructs containing the N-domain17,18 are proangiogenic. Therefore, proteolytic processing that removes the inhibitory type 1 repeats could generate proangiogenic fragments of TSP1 and TSP2. Previous studies have established that native TSP1 displays proangiogenic activities under certain conditions.47,48 Whether these activities are mediated by intact TSP1 or by proteolytic fragments similar to NoC1 remains to be determined.

The inhibitory activities of {alpha}4ß1 antagonists in the CAM assay suggest that {alpha}4ß1 becomes activated on microvascular endothelium in vivo. Alternatively, {alpha}4ß1 may be essential for a perivascular cell contribution to angiogenesis. Although we do not know which of these cells express functional {alpha}4ß1 in vivo, the explant data show that TSP1 is essential for sensitivity of neovascularization to an {alpha}4ß1 antagonist.

Integrins play complex regulatory roles in angiogenesis. ß1 Integrins are essential for angiogenesis,49 but the roles of specific ß1 integrins in this process are unclear. The {alpha}4 subunit is widely expressed in endothelial cells during vascular development,33 but the specific role of {alpha}4ß1 in angiogenesis remains unclear. As is known for {alpha}vß3 antagonists, our results using {alpha}4ß1 antagonists do not prove an essential role for {alpha}4ß1 in angiogenesis. However, like {alpha}vß3,1 {alpha}4ß1 may be a useful pharmacological target to control pathological angiogenesis.


*    Acknowledgments
 
This work was supported in part by NIH grants 2RO1NIH-NCI-CA-6562-06 (M.L.I.-A.), HL54462, and HL56396 (D.F.M). We thank Dr Jack Lawler for providing TSP1 null mice.


*    Footnotes
 
Original received July 18, 2003; resubmission received November 12, 2003; revised resubmission received December 11, 2003; accepted December 17, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Eliceiri BP, Cheresh DA. Adhesion events in angiogenesis. Curr Opin Cell Biol. 2001; 13: 563–568.[CrossRef][Medline] [Order article via Infotrieve]

2. Adams JC. Thrombospondins: multifunctional regulators of cell interactions. Annu Rev Cell Dev Biol. 2001; 17: 25–51.[CrossRef][Medline] [Order article via Infotrieve]

3. Weinstat-Saslow DL, Zabrenetzky VS, VanHoutte K, Frazier WA, Roberts DD, Steeg PS. Transfection of thrombospondin 1 complementary DNA into a human breast carcinoma cell line reduces primary tumor growth, metastatic potential, and angiogenesis. Cancer Res. 1994; 54: 6504–6511.[Abstract/Free Full Text]

4. Dameron KM, Volpert OV, Tainsky MA, Bouck N. Control of angiogenesis in fibroblasts by p53 regulation of thrombospondin-1. Science. 1994; 265: 1582–1584.[Abstract/Free Full Text]

5. Streit M, Riccardi L, Velasco P, Brown LF, Hawighorst T, Bornstein P, Detmar M. Thrombospondin-2: a potent endogenous inhibitor of tumor growth and angiogenesis. Proc Natl Acad Sci U S A. 1999; 96: 14888–14893.[Abstract/Free Full Text]

6. Tenan M, Fulci G, Albertoni M, Diserens AC, Hamou MF, El Atifi-Borel M, Feige JJ, Pepper MS, Van Meir EG. Thrombospondin-1 is downregulated by anoxia and suppresses tumorigenicity of human glioblastoma cells. J Exp Med. 2000; 191: 1789–1798.[Abstract/Free Full Text]

7. Taraboletti G, Roberts D, Liotta LA, Giavazzi R. Platelet thrombospondin modulates endothelial cell adhesion, motility, and growth: a potential angiogenesis regulatory factor. J Cell Biol. 1990; 111: 765–772.[Abstract/Free Full Text]

8. Tomii Y, Kamochi J, Yamazaki H, Sawa N, Tokunaga T, Ohnishi Y, Kijima H, Ueyama Y, Tamaoki N, Nakamura M. Human thrombospondin 2 inhibits proliferation of microvascular endothelial cells. Int J Oncol. 2002; 20: 339–342.[Medline] [Order article via Infotrieve]

9. Armstrong LC, Bjorkblom B, Hankenson KD, Siadak AW, Stiles CE, Bornstein P. Thrombospondin 2 inhibits microvascular endothelial cell proliferation by a caspase-independent mechanism. Mol Biol Cell. 2002; 13: 1893–1905.[Abstract/Free Full Text]

10. Good DJ, Polverini PJ, Rastinejad F, Le BM, Lemons RS, Frazier WA, Bouck NP. A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally indistinguishable from a fragment of thrombospondin. Proc Natl Acad Sci U S A. 1990; 87: 6624–6628.[Abstract/Free Full Text]

11. Guo N, Krutzsch HC, Inman JK, Roberts DD. Thrombospondin 1 and type I repeat peptides of thrombospondin 1 specifically induce apoptosis of endothelial cells. Cancer Res. 1997; 57: 1735–1742.[Abstract/Free Full Text]

12. Jimenez B, Volpert OV, Crawford SE, Febbraio M, Silverstein RL, Bouck N. Signals leading to apoptosis-dependent inhibition of neovascularization by thrombospondin-1. Nat Med. 2000; 6: 41–48.[CrossRef][Medline] [Order article via Infotrieve]

13. Tolsma SS, Volpert OV, Good DJ, Frazier WA, Polverini PJ, Bouck N. Peptides derived from two separate domains of the matrix protein thrombospondin-1 have anti-angiogenic activity. J Cell Biol. 1993; 122: 497–511.[Abstract/Free Full Text]

14. Vogel T, Guo NH, Krutzsch HC, Blake DA, Hartman J, Mendelovitz S, Panet A, Roberts DD. Modulation of endothelial cell proliferation, adhesion, and motility by recombinant heparin-binding domain and synthetic peptides from the type I repeats of thrombospondin. J Cell Biochem. 1993; 53: 74–84.[CrossRef][Medline] [Order article via Infotrieve]

15. Iruela-Arispe ML, Lombardo M, Krutzsch HC, Lawler J, Roberts DD. Inhibition of angiogenesis by thrombspondin-1 is mediated by two independent regions within the type 1 repeats. Circulation. 1999; 100: 1423–1431.[Abstract/Free Full Text]

16. Dawson DW, Pearce SF, Zhong R, Silverstein RL, Frazier WA, Bouck NP. CD36 mediates the In vitro inhibitory effects of thrombospondin-1 on endothelial cells. J Cell Biol. 1997; 138: 707–717.[Abstract/Free Full Text]

17. Taraboletti G, Morbidelli L, Donnini S, Parenti A, Granger HJ, Giavazzi R, Ziche M. The heparin binding 25 kDa fragment of thrombospondin-1 promotes angiogenesis and modulates gelatinase and TIMP-2 production in endothelial cells. FASEB J. 2000; 14: 1674–1676.[Free Full Text]

18. Chandrasekaran L, He C-Z, Al-Barazi HO, Krutzsch HC, Iruela-Arispe ML, Roberts DD. Cell contact-dependent activation of {alpha}3ß1 integrin modulates endothelial cell responses to thrombospondin-1. Mol Biol Cell. 2000; 11: 2885–2900.[Abstract/Free Full Text]

19. Calzada MJ, Sipes JM, Krutzsch HC, Yurchenco PD, Annis DS, Mosher DF, Roberts DD. Recognition of the N-terminal modules of thrombospondin-1 and thrombospondin-2 by {alpha}6ß1 integrin. J Biol Chem. 2003; 278: 40679–40687.[Abstract/Free Full Text]

20. Zabrenetzky V, Harris CC, Steeg PS, Roberts DD. Expression of the extracellular matrix molecule thrombospondin inversely correlates with malignant progression in melanoma, lung and breast carcinoma cell lines. Int J Cancer. 1994; 59: 191–195.[Medline] [Order article via Infotrieve]

21. Volpert OV, Stellmach V, Bouck N. The modulation of thrombospondin and other naturally occurring inhibitors of angiogenesis during tumor progression. Breast Cancer Res Treat. 1995; 36: 119–126.[CrossRef][Medline] [Order article via Infotrieve]

22. Bertin N, Clezardin P, Kubiak R, Frappart L. Thrombospondin-1 and -2 messenger RNA expression in normal, benign, and neoplastic human breast tissues: correlation with prognostic factors, tumor angiogenesis, and fibroblastic desmoplasia. Cancer Res. 1997; 57: 396–399.[Abstract/Free Full Text]

23. Kawakami T, Tokunaga T, Hatanaka H, Tsuchida T, Tomii Y, Osada H, Onoda N, Morino F, Nagata J, Kijima H, Yamazaki H, Abe Y, Osamura Y, Ueyama Y, Nakamura M. Interleukin 10 expression is correlated with thrombospondin expression and decreased vascular involvement in colon cancer. Int J Oncol. 2001; 18: 487–491.[Medline] [Order article via Infotrieve]

24. Straume O, Akslen LA. Expression of vascular endothelial growth factor, its receptors (FLT-1, KDR) and TSP-1 related to microvessel density and patient outcome in vertical growth phase melanomas. Am J Pathol. 2001; 159: 223–235.[Abstract/Free Full Text]

25. Kodama J, Hashimoto I, Seki N, Hongo A, Yoshinouchi M, Okuda H, Kudo T. Thrombospondin-1 and -2 messenger RNA expression in invasive cervical cancer: correlation with angiogenesis and prognosis. Clin Cancer Res. 2001; 7: 2826–2831.[Abstract/Free Full Text]

26. Rice A, Quinn CM. Angiogenesis, thrombospondin, and ductal carcinoma in situ of the breast. J Clin Pathol. 2002; 55: 569–574.[Abstract/Free Full Text]

27. Li Z, Calzada M, Sipes J, Cashel J, Krutzsch H, Annis D, Mosher D, Roberts D. Interactions of thrombospondins with {alpha}4ß1 integrin and CD47 differentially modulate T cell behavior. J Cell Biol. 2002; 157: 509–519.[Abstract/Free Full Text]

28. Chandrasekaran S, Guo N, Rodrigues RG, Kaiser J, Roberts DD. Pro-adhesive and chemotactic activities of thrombospondin-1 for breast carcinoma cella are mediated by {alpha}3ß1 integrin and regulated by insulin-like growth factor-1 and CD98. J Biol Chem. 1999; 274: 11408–11416.[Abstract/Free Full Text]

29. Decker S, van Valen F, Vischer P. Adhesion of osteosarcoma cells to the 70-kDa core region of thrombospondin-1 is mediated by the {alpha}4ß1 integrin. Biochem Biophys Res Commun. 2002; 293: 86–92.[CrossRef][Medline] [Order article via Infotrieve]

30. Arroyo AG, Taverna D, Whittaker CA, Strauch UG, Bader BL, Rayburn H, Crowley D, Parker CM, Hynes RO. In vivo roles of integrins during leukocyte development and traffic: insights from the analysis of mice chimeric for {alpha}5, {alpha}v, and {alpha}4 integrins. J Immunol. 2000; 165: 4667–4675.[Abstract/Free Full Text]

31. Massia SP, Hubbell JA. Vascular endothelial cell adhesion and spreading promoted by the peptide REDV of the IIICS region of plasma fibronectin is mediated by integrin {alpha}4ß1. J Biol Chem. 1992; 267: 14019–14026.[Abstract/Free Full Text]

32. Brezinschek RI, Brezinschek HP, Lazarovits AI, Lipsky PE, Oppenheimer-Marks N. Expression of the ß7 integrin by human endothelial cells. Am J Pathol. 1996; 149: 1651–1660.[Abstract]

33. Sheppard AM, Onken MD, Rosen GD, Noakes PG, Dean DC. Expanding roles for {alpha}4 integrin and its ligands in development. Cell Adhes Commun. 1994; 2: 27–43.[Medline] [Order article via Infotrieve]

34. Misenheimer TM, Huwiler KG, Annis DS, Mosher DF. Physical characterization of the procollagen module of human thrombospondin 1 expressed in insect cells. J Biol Chem. 2000; 275: 40938–40945.[Abstract/Free Full Text]

35. Krutzsch HC, Choe B, Sipes JM, Guo N, Roberts DD. Identification of an {alpha}3ß1 integrin recognition sequence in thrombospondin-1. J Biol Chem. 1999; 274: 24080–24086.[Abstract/Free Full Text]

36. Hemler ME, Sanchez-Madrid F, Flotte TJ, Krensky AM, Burakoff SJ, Bhan AK, Springer TA, Strominger JL. Glycoproteins of 210,000 and 130,000 m.w. on activated T cells: cell distribution and antigenic relation to components on resting cells and T cell lines. J Immunol. 1984; 132: 3011–3018.[Abstract]

37. Lin K, Ateeq HS, Hsiung SH, Chong LT, Zimmerman CN, Castro A, Lee WC, Hammond CE, Kalkunte S, Chen LL, Pepinsky RB, Leone DR, Sprague AG, Abraham WM, Gill A, Lobb RR, Adams SP. Selective, tight-binding inhibitors of integrin {alpha}4ß1 that inhibit allergic airway responses. J Med Chem. 1999; 42: 920–934.[CrossRef][Medline] [Order article via Infotrieve]

38. Hiraoka N, Allen E, Apel IJ, Gyetko MR, Weiss SJ. Matrix metalloproteinases regulate neovascularization by acting as pericellular fibrinolysins. Cell. 1998; 95: 365–377.[CrossRef][Medline] [Order article via Infotrieve]

39. Elbashir SM, Harborth J, Weber K, Tuschl T. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods. 2002; 26: 199–213.[CrossRef][Medline] [Order article via Infotrieve]

40. Bagavandoss P, Wilks JW. Specific inhibition of endothelial cell proliferation by thrombospondin. Biochem Biophys Res Commun. 1990; 170: 867–872.[CrossRef][Medline] [Order article via Infotrieve]

41. Koch AE, Halloran MM, Haskell CJ, Shah MR, Polverini PJ. Angiogenesis mediated by soluble forms of E-selectin and vascular cell adhesion molecule-1. Nature. 1995; 376: 517–519.[CrossRef][Medline] [Order article via Infotrieve]

42. Fukushi J, Ono M, Morikawa W, Iwamoto Y, Kuwano M. The activity of soluble VCAM-1 in angiogenesis stimulated by IL-4 and IL-13. J Immunol. 2000; 165: 2818–2823.[Abstract/Free Full Text]

43. Bayless KJ, Davis GE. Identification of dual {alpha}4ß1 integrin binding sites within a 38 amino acid domain in the N-terminal thrombin fragment of human osteopontin. J Biol Chem. 2001; 276: 13483–13489.[Abstract/Free Full Text]

44. de Melker AA, Sterk LM, Delwel GO, Fles DL, Daams H, Weening JJ, Sonnenberg A. The A and B variants of the {alpha}3 integrin subunit: tissue distribution and functional characterization. Lab Invest. 1997; 76: 547–563.[Medline] [Order article via Infotrieve]

45. Swerlick RA, Lee KH, Wick TM, Lawley TJ. Human dermal microvascular endothelial but not human umbilical vein endothelial cells express CD36 in vivo and in vitro. J Immunol. 1992; 148: 78–83.[Abstract]

46. Febbraio M, Hajjar DP, Silverstein RL. CD36: a class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism. J Clin Invest. 2001; 108: 785–791.[CrossRef][Medline] [Order article via Infotrieve]

47. BenEzra D, Griffin BW, Maftzir G, Aharonov O. Thrombospondin and in vivo angiogenesis induced by basic fibroblast growth factor or lipopolysaccharide. Invest Ophthalmol Vis Sci. 1993; 34: 3601–3608.[Abstract/Free Full Text]

48. Nicosia RF, Tuszynski GP. Matrix-bound thrombospondin promotes angiogenesis in vitro. J Cell Biol. 1994; 124: 183–193.[Abstract/Free Full Text]

49. Bloch W, Forsberg E, Lentini S, Brakebusch C, Martin K, Krell HW, Weidle UH, Addicks K, Fassler R. ß1 Integrin is essential for teratoma growth and angiogenesis. J Cell Biol. 1997; 139: 265–278.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Mult SclerHome page
O Stich, D Janowitz, and S Rauer
Spontaneous intracerebral hemorrhage in a patient with multiple sclerosis and tumefactive demyelinating lesion
Multiple Sclerosis, April 1, 2009; 15(4): 517 - 519.
[Abstract] [PDF]


Home page
Cancer Res.Home page
J. K. Slack-Davis, K. A. Atkins, C. Harrer, E. D. Hershey, and M. Conaway
Vascular Cell Adhesion Molecule-1 Is a Regulator of Ovarian Cancer Peritoneal Metastasis
Cancer Res., February 15, 2009; 69(4): 1469 - 1476.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
C. R. Anderson, N. E. Hastings, B. R. Blackman, and R. J. Price
Capillary Sprout Endothelial Cells Exhibit a CD36low Phenotype: Regulation by Shear Stress and Vascular Endothelial Growth Factor-Induced Mechanism for Attenuating Anti-Proliferative Thrombospondin-1 Signaling
Am. J. Pathol., October 1, 2008; 173(4): 1220 - 1228.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Martin-Manso, S. Galli, L. A. Ridnour, M. Tsokos, D. A. Wink, and D. D. Roberts
Thrombospondin 1 Promotes Tumor Macrophage Recruitment and Enhances Tumor Cell Cytotoxicity of Differentiated U937 Cells
Cancer Res., September 1, 2008; 68(17): 7090 - 7099.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. E. Goldfinger, E. Tzima, R. Stockton, W. B. Kiosses, K. Kinbara, E. Tkachenko, E. Gutierrez, A. Groisman, P. Nguyen, S. Chien, et al.
Localized {alpha}4 Integrin Phosphorylation Directs Shear Stress-Induced Endothelial Cell Alignment
Circ. Res., July 18, 2008; 103(2): 177 - 185.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. D. Ochoa, H. Baker, S. Hasak, R. Matyal, A. Salam, C. A. Hales, W. Hancock, and D. A. Quinn
Cyclic Stretch Affects Pulmonary Endothelial Cell Control of Pulmonary Smooth Muscle Cell Growth
Am. J. Respir. Cell Mol. Biol., July 1, 2008; 39(1): 105 - 112.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Tan, M. Duquette, J.-h. Liu, K. Shanmugasundaram, A. Joachimiak, J. T. Gallagher, A. C. Rigby, J.-h. Wang, and J. Lawler
Heparin-induced cis- and trans-Dimerization Modes of the Thrombospondin-1 N-terminal Domain
J. Biol. Chem., February 15, 2008; 283(7): 3932 - 3941.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
F. Sozo, S. B. Hooper, and M. J. Wallace
Thrombospondin-1 expression and localization in the developing ovine lung
J. Physiol., October 15, 2007; 584(2): 625 - 635.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. S. Annis, K. A. Gunderson, and D. F. Mosher
Immunochemical Analysis of the Structure of the Signature Domains of Thrombospondin-1 and Thrombospondin-2 in Low Calcium Concentrations
J. Biol. Chem., September 14, 2007; 282(37): 27067 - 27075.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Isenberg, Y. Jia, J. Fukuyama, C. H. Switzer, D. A. Wink, and D. D. Roberts
Thrombospondin-1 Inhibits Nitric Oxide Signaling via CD36 by Inhibiting Myristic Acid Uptake
J. Biol. Chem., May 25, 2007; 282(21): 15404 - 15415.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
I. Staniszewska, S. Zaveri, L. D. Valle, I. Oliva, V. L. Rothman, S. E. Croul, D. D. Roberts, D. F. Mosher, G. P. Tuszynski, and C. Marcinkiewicz
Interaction of {alpha}9{beta}1 Integrin With Thrombospondin-1 Promotes Angiogenesis
Circ. Res., May 11, 2007; 100(9): 1308 - 1316.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Isenberg, L. A. Ridnour, J. Dimitry, W. A. Frazier, D. A. Wink, and D. D. Roberts
CD47 Is Necessary for Inhibition of Nitric Oxide-stimulated Vascular Cell Responses by Thrombospondin-1
J. Biol. Chem., September 8, 2006; 281(36): 26069 - 26080.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Bonnefoy, K. Daenens, H. B. Feys, R. De Vos, P. Vandervoort, J. Vermylen, J. Lawler, and M. F. Hoylaerts
Thrombospondin-1 controls vascular platelet recruitment and thrombus adherence in mice by protecting (sub)endothelial VWF from cleavage by ADAMTS13
Blood, February 1, 2006; 107(3): 955 - 964.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
F. Sozo, M. J. Wallace, V. A. Zahra, C. E. Filby, and S. B. Hooper
Gene expression profiling during increased fetal lung expansion identifies genes likely to regulate development of the distal airways
Physiol Genomics, January 12, 2006; 24(2): 105 - 113.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. S. Isenberg, L. A. Ridnour, E. M. Perruccio, M. G. Espey, D. A. Wink, and D. D. Roberts
Thrombospondin-1 inhibits endothelial cell responses to nitric oxide in a cGMP-dependent manner
PNAS, September 13, 2005; 102(37): 13141 - 13146.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. A. Ridnour, J. S. Isenberg, M. G. Espey, D. D. Thomas, D. D. Roberts, and D. A. Wink
Nitric oxide regulates angiogenesis through a functional switch involving thrombospondin-1
PNAS, September 13, 2005; 102(37): 13147 - 13152.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. M. Short, A. Derrien, R. P. Narsimhan, J. Lawler, D. E. Ingber, and B. R. Zetter
Inhibition of endothelial cell migration by thrombospondin-1 type-1 repeats is mediated by {beta}1 integrins
J. Cell Biol., February 14, 2005; 168(4): 643 - 653.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Yonekawa and J. M. Harlan
Targeting leukocyte integrins in human diseases
J. Leukoc. Biol., February 1, 2005; 77(2): 129 - 140.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. T.-B. Nguyen, J. P. T. Ward, and S. J. Hirst
{beta}1-Integrins Mediate Enhancement of Airway Smooth Muscle Proliferation by Collagen and Fibronectin
Am. J. Respir. Crit. Care Med., February 1, 2005; 171(3): 217 - 223.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
94/4/462    most recent
01.RES.0000115555.05668.93v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calzada, M. J.
Right arrow Articles by Roberts, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calzada, M. J.
Right arrow Articles by Roberts, D. D.
Related Collections
Right arrow Angiogenesis
Right arrow Animal models of human disease
Right arrow Endothelium/vascular type/nitric oxide