| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
4ß1 Integrin Mediates Selective Endothelial Cell Responses to Thrombospondins 1 and 2 In Vitro and Modulates Angiogenesis In Vivo
From the Laboratory of Pathology (M.J.C., L.Z., J.M.S., J.Z., H.C.K., D.D.R.), National Cancer Institute, National Institutes of Health, Bethesda, Md; Department of Molecular, Cell and Developmental Biology (M.L.I.-A.), UCLA, Los Angeles, Calif; and the Department of Medicine (D.S.A., D.F.M.), University of WisconsinMadison, Madison, Wis.
Correspondence to David D. Roberts, PhD, NIH, Building 10 Room 2A33, 10 Center Dr, Bethesda, MD 20892-1500. E-mail droberts{at}helix.nih.gov
| Abstract |
|---|
|
|
|---|
4ß1 integrin in angiogenesis and in mediating endothelial cell responses to the angiogenesis modulators, thrombospondin-1 and thrombospondin-2.
4ß1 supports adhesion of venous endothelial cells but not of microvascular endothelial cells on immobilized thrombospondin-1, vascular cell adhesion molecule-1, or recombinant N-terminal regions of thrombospondin-1 and thrombospondin-2. Chemotactic activities of this region of thrombospondin-1 and thrombospondin-2 are also mediated by
4ß1, whereas antagonism of fibroblast growth factor-2stimulated chemotaxis is not mediated by this region. Immobilized N-terminal regions of thrombospondin-1 and thrombospondin-2 promote endothelial cell survival and proliferation in an
4ß1-dependent manner. Soluble
4ß1 antagonists inhibit angiogenesis in the chick chorioallantoic membrane and neovascularization of mouse muscle explants. The latter inhibition is thrombospondin-1dependent and not observed in explants from thrombospondin-1-/- mice. Antagonizing
4ß1 may in part block proangiogenic activities of thrombospondin-1 and thrombospondin-2, because N-terminal regions of thrombospondin-1 and thrombospondin-2 containing the
4ß1 binding sequence stimulate angiogenesis in vivo. Therefore,
4ß1 is an important endothelial cell receptor for mediating motility and proliferative responses to thrombospondins and for modulation of angiogenesis.
Key Words: adhesion proliferation migration angiogenesis peptides
| Introduction |
|---|
|
|
|---|
Based on in vitro and in vivo angiogenesis assays, antiangiogenic activities of TSP1 and TSP2 have been mapped to the procollagen-homology domain and the type 1 repeats.1315 Inhibition is mediated through interactions with CD36 and proteoglycan receptors.1416 However, the N-terminal domain of TSP1 stimulates angiogenesis,17,18 in part through its interaction with
3ß1 integrin.18 TSP1 may also influence their behavior through additional TSP receptors expressed on endothelial cells, including LDL receptorrelated protein,
vß3 and
6ß1 integrins, and CD47 or by activating latent TGFß.2,19
The role of TSP1 in angiogenesis is therefore complex, and includes both proangiogenic and antiangiogenic activities. Acquisition of an angiogenic phenotype is frequently associated with decreased expression of TSP1 or TSP2,2022 whereas restoration of TSP1 levels in tumor cells reduces angiogenesis and tumor progression.3 Correlating levels of TSP1 with tumor progression and clinical prognosis in cancer patients, however, has yielded conflicting results.2326 To understand its role in cancer and to define a molecular basis for the complex endothelial cell responses to TSP1, we must understand how the simultaneous signals from multiple TSP1 receptors are integrated. The complete identification of endothelial cell TSP1 receptors is the critical first step toward this goal.
In addition to the known endothelial cell receptors, TSP1 interacts with
4ß1 integrin on T cells27 and some cancer cells.28,29 A sequence in TSP1 recognized by
4ß1 was mapped to the N-terminal domain and is also conserved in TSP2.27 Leukocyte
4ß1 is a well-characterized counter receptor for endothelial cell vascular cell adhesion molecule-1 (VCAM-1),30 but its function in endothelial cells is poorly understood. The
4 integrin subunit is expressed in endothelial cells in vitro31,32 and in vivo,33 suggesting that
4ß1 could be an additional receptor for TSPs in these cells. We therefore examined the role of
4ß1 in venous and microvascular endothelial cell responses to TSP1 and TSP2 in vitro. Our data show that
4ß1 is an endothelial TSP receptor that regulates cell proliferation, adhesion, and migration. In vivo and ex vivo angiogenesis assays indicate that
4ß1 plays important roles in angiogenesis and its regulation by TSP1.
| Materials and Methods |
|---|
|
|
|---|
Proteins, Peptides, and Antibodies
TSP1 was purified from human platelets. Recombinant trimeric proteins consisting of the N-terminal module (N), oligomeration sequence (o), and procollagen module (C) of TSP1 (NoC1) residues 1 to 356, or TSP2 (NoC2) residues 1 to 35934 and monomeric N-terminal module of TSP1 (residues 1 to 175)14 were prepared as described previously. Synthetic peptides containing TSP1 sequences were prepared as described.35 Recombinant soluble 7-domain VCAM-1 (residues 1 to 674) was prepared as described.27 VEGF was from R&D Systems, FGF2 from Prizm Pharmaceuticals, and Vitrogen type I collagen from Cohesion Technologies.
The ß1 integrinactivating antibody TS2/16 was purified from hybridoma supernatant.36 Anti-
4 and anti-
3 antibodies, P4C2 and Asc-1, respectively, were from Chemicon. The anti-ß1 blocking antibody mAb13 was provided by Dr Ken Yamada, National Institutes of Dental and Craniofacial Research, Bethesda, Md. The
4ß1 antagonist (4-((2-methylphenyl)aminocarbonyl) aminophenyl)acetyl-LDVP (phLDVP)37 was obtained from Bachem.
Endothelial Cell Functional Assays
Adhesion of endothelial cells was assessed as described.28 Chemotaxis was assessed using modified Boyden chambers and 8-µm pore membranes. Endothelial cell proliferation was quantified using a tetrazolium proliferation assay (Promega).
Integrin Expression Analyses
Cells were washed and incubated with TS2/16 or P4C2 for 1 hour. Cells were washed, incubated with FITC-conjugated anti-mouse antibody, washed, and fixed with 1% formaldehyde. Flow cytometry data were acquired using a Becton Dickinson flow cytometer. Cell lysates labeled with EZ-Link Sulfo-NHS-LC-Biotin (Pierce) were immunoprecipitated using 2 µg of P4C2 or Asc-1. The immune complexes were analyzed by Western blotting.
Angiogenesis Assays
Effects of the
4ß1-binding peptide from TSP1 and other
4ß1 antagonists on angiogenesis were evaluated using the chick chorioallantoic membrane (CAM) angiogenesis assay as described previously.15 Muscle explant vascularization in a 3-dimensional collagen matrix was assessed essentially as described.38
siRNA-Mediated Knockdown of
4ß1 Integrin
Selection of the target sequence AACUAUCAACGAAAGAACUGG from human
4 mRNA was done according to Elbashir et al.39 siRNA duplexes were synthesized using the Silencer siRNA kit (Ambion). HUVECs were transfected using a nuclear-localized ß-Gal expression vector alone, in combination with
4 siRNA or with
4 siRNA alone. Transfected cells were maintained in complete medium for 48 to 72 hours before use. Three siRNA sequences were screened initially, and the most active was selected. Adhesion assays were stained using 5-bromo-4-chloro-3-indoyl-ß-D-Gal to identify transfected cells.
An expanded Materials and Methods section can be found in the online data supplement available at http://circres.ahajournals.org.
| Results |
|---|
|
|
|---|
4ß1 Integrin Mediates Adhesion of Large-Vessel Endothelial Cells on TSP1 and TSP2
4ß1 and
6ß1 recognize N-terminal regions of both TSP1 and TSP2,19,27 whereas
3ß1 recognizes a sequence in this region of TSP1 that is not conserved in TSP235 (Figure 1A). We recently showed that
6ß1 is not a functional TSP receptor in HUVECs.19 However, the ß1 integrinactivating antibody TS2/16 increased adhesion of HUVECs similarly on recombinant portions of both TSP1 (NoC1) and TSP2 (NoC2) (Figure 1B). The cells spread on NoC1 and NoC2 forming prominent lamellipodia (Figure 1C). These results are consistent with the similar activities of NoC1 and NoC2 for interacting with
4ß1 on T cells.27
|
Recognition of N-terminal regions of TSP1 and TSP2 is at least partially dependent on
4ß1 because an
4ß1-specific antagonist, phLDVP, partially inhibited adhesion of HUVECs and AG10773A venous endothelial cells on TSP1, NoC1, and NoC2 (P
0.01) (Figures 1B and 1D). Recombinant TSP1(1175), which contains the
4ß1 binding site27 but lacks the recognition site for
3ß1,35 also mediated HUVEC adhesion and was inhibited by phLDVP (P
0.007) (Figure 1E). Therefore, this region of TSP1 is sufficient for promoting
4ß1-dependent endothelial cell adhesion.
To confirm a direct role of
4ß1 as an endothelial cell TSP receptor, we suppressed the expression of
4 integrin in HUVECs using RNA interference (siRNA). In cells cotransfected with a ß-galactosidase expression plasmid and
4 siRNA, attachment on TSP1, TSP1 (1175), and NoC2 was significantly decreased relative to control cultures transfected with the ß-galactosidase plasmid alone (Figure 2A). The effect of the siRNA on adhesion to TSPs was specific, in that
2/
1ß1-mediated adhesion on type I collagen was not affected (Figure 2A). Loss of
4 expression in siRNA-transfected cells was confirmed by Western blotting (Figure 2B). Densitometric analysis showed a 5.7-fold decrease in
4 expression, whereas
3 expression did not show a significant change (Figure 2B). Therefore,
4ß1 is required for venous endothelial cell adhesion to TSP1 and an N-terminal region of TSP2.
|
4ß1 Does Not Mediate Adhesion of Microvascular Endothelial Cells
Adhesion of microvascular endothelial cells on NoC1 and NoC2 is also ß1 integrindependent, based on complete inhibition by a ß1-blocking antibody19 and stimulation by a ß1-activating antibody (Figure 3A). However, the
4ß1 inhibitor phLDVP did not significantly inhibit adhesion of either HDMVECs or HME-L cells on NoC1 or NoC2 (Figures 3A and 3B). Adhesion of microvascular cells, therefore, is mediated exclusively by
3ß1 and
6ß1.18,19
|
Although microvascular cells exhibited no
4ß1-dependent adhesion on TSPs, they express
4ß1 (Figures 4A and 4B). The modest difference in
4 subunit surface expression between HUVECs and HDMVECs measured by flow cytometry (Figure 4A) was not sufficient to account for the differences in adhesion. To exclude the possibility that
4 pairs only with ß7 subunits in microvascular cells, cell lysates were immunoprecipitated using an
4 antibody and immunoblotted with a ß1 antibody. The amount of
4 complexed with ß1 was only slightly lower in HDMVECs than in HUVECs (Figure 4B). Thus,
4ß1 is present but may be maintained in an inactive state in microvascular cells. Consistent with this hypothesis, adhesion of HDMVECs to the
4ß1 ligand VCAM-1 was minimal relative to HUVECs and was not significantly stimulated by TS2/16 (Figure 4C).
|
TSP1 and TSP2 Promote Endothelial Cell Survival and Proliferation Through
4ß1 Integrin
TSP1 has context-dependent effects on endothelial cell proliferation. In solution, it inhibits proliferation,7,40 whereas immobilized TSP1 stimulates proliferation at least in part through
3ß1.18 We examined whether
4ß1 also contributes to the proliferative activity of TSP1 and whether TSP2 shares this activity. Plating HUVECs on immobilized NoC1 and NoC2 at 0.1 µg/mL supported initial adhesion and cell survival, and higher concentrations dose-dependently increased cell numbers after 72 hours (Figure 5A). The cells did not attach or survive after 72 hour on wells without the proteins, indicating that immobilized N-terminal regions of TSP1 and TSP2 have both growth- and survival-promoting activities. Consistent with their differential
4ß1 activities, proliferation of HUVECs on NoC1 and NoC2 was greater than for HDMVECs (Figure 5B).
|
Using NoC2 to avoid contributions of
3ß1 to the observed proliferative response,18 we examined the activities of two
4ß1 antagonists (Figure 5C). NoC2 at >0.5 µg/mL stimulated net proliferation, which was significantly inhibited by phLDVP and the
4ß1-blocking antibody (P
0.04; Figure 5C). Cell adhesion, survival, and proliferation were also promoted by the immobilized
4ß1 ligand VCAM-1 at >0.7 µg/mL. Net proliferation stimulated by immobilized VCAM-1 was also inhibited by the
4ß1 antibody and phLDVP (P
0.02; Figure 5D). Based on these data,
4ß1 mediates proliferative responses of venous endothelial cells to immobilized NoC2 and VCAM-1.
4ß1 Mediates Endothelial Cell Chemotaxis
TSP1-stimulated chemotaxis of murine lung capillary and bovine aortic endothelial cells was inhibited by an antibody recognizing the N-module of TSP1.7
3ß1 and
6ß1 contribute to this response for microvascular cells,19 but the receptor mediating venous endothelial cell motility to TSPs has not been identified. A report that
4ß1 mediates HUVEC chemotaxis stimulated by soluble VCAM-141 suggested
4ß1 may be involved. TSP1, NoC1, and NoC2 stimulated chemotaxis of HUVECs with similar dose dependencies (Figure 6A). The
4ß1 antagonist phLDVP strongly inhibited chemotactic responses to both TSP1 and NoC2 (Figures 6B and 6C). This inhibition was specific, because phLDVP did not inhibit the chemotactic activity of a recombinant region of fibronectin containing only its
5ß1 binding site (online Figure 1, available in the online data supplement at http://circres.ahajournals.org). Therefore,
4ß1 plays a role in endothelial cell chemotaxis to TSP1 and TSP2.
|
In addition to its direct chemotactic activity, TSP1 inhibits endothelial cell motility induced by FGF2.7,10 In microvascular cells, this inhibition is mediated by CD36,16 although TSP1(1175), which lacks a CD36-binding site, also inhibits FGF2-stimulated chemotaxis of BAE cells.14 The inhibitory activity of TSP1(1175) was originally attributed to HSPG binding,14 but the present data suggested that
4ß1 should also be considered. Using HUVECs, which do not express CD36, TSP1 inhibited FGF2-stimulated chemotaxis, but NoC1 and NoC2 did not (Figure 6D).
When VEGF was used in place of FGF2 to stimulate migration of HUVECs, NoC1 and NoC2 weakly inhibited chemotaxis but were approximately 5-fold less active than native TSP1 (Figure 6E). Therefore, the N-terminal region of TSP1 does not contain its inhibitory activity for FGF2-mediated motility, and receptors recognizing this domain, including
4ß1, are not involved. However, these regions of TSP1 and TSP2 do contain inhibitory activities for VEGF-stimulated chemotaxis that are independent of CD36 expression. The mechanism of this inhibitory activity of TSP1 and TSP2 remains to be defined.
4ß1 Antagonists Inhibit Angiogenesis
The activities of
4ß1 to mediate endothelial adhesion, chemotaxis, and survival responses to TSP1 and TSP2 in vitro suggested that
4ß1 may mediate proangiogenic activities of both proteins. Consistent with this hypothesis, a synthetic TSP1 peptide containing its
4ß1 binding site inhibited angiogenesis in the CAM assay (Figure 7A). AELDVP (753) inhibited angiogenesis in CAMs overlaid with either a pure type I collagen matrix or with a collagen plus fibronectin matrix to provide an exogenous
4ß1 ligand. In both cases, the peptide was specific in that the control VALAEP (755) was inactive. Furthermore, neither peptide altered the angiogenic response in the absence of growth factors (unpublished data, 2003).
|
In the presence of growth factors, native TSP1 had equivalent antiangiogenic activities in matrices of type I collagen or collagen plus fibronectin, whereas no response was observed in the absence of growth factors (Table). In contrast to intact TSP1, NoC1 and NoC2 stimulated angiogenesis above the control both in the presence and absence of growth factors. The greater activity of NoC1 compared with NoC2 may result from engaging
3ß1,18 but the activity of NoC2 suggested that
4ß1 also contributes to the proangiogenic activities. Engaging
4ß1 may be sufficient to stimulate angiogenesis in the CAM, because VCAM-1 had a weak proangiogenic activity, similar to NoC2, in the absence of growth factors, and a significant stimulation in the presence of growth factors was observed on the collagen matrix (Table; P<0.005, n=9).
|
This stimulatory activity of VCAM-1 is specific for collagen matrices, however, because addition of soluble VCAM-1 inhibited CAM angiogenesis in a Hydron gel and in a fibronectin matrix (Figure 7B). Under these conditions, soluble VCAM-1 appears to be an
4ß1 antagonist. Consistent with this, the specific
4ß1 antagonist phLDVP inhibited angiogenesis in CAM assays using collagen matrices with or without fibronectin (Figure 7B). VCAM-1 in collagen and the N-terminal regions of TSP1 and TSP2, in contrast, may be proangiogenic because they become immobilized in the matrix.
Inhibition by three specific antagonists indicated that
4ß1 is required for angiogenesis in the CAM. Although exogenous NoC1 stimulated CAM angiogenesis, we could not determine whether TSP1 is an important endogenous ligand for
4ß1 in this response. To address this question, we used a muscle explant angiogenesis assay38 to compare the sensitivity of neovascularization to an
4ß1 antagonist in wild-type and TSP1-/- mice (Figure 7C). The
4ß1 antagonist dose-dependently inhibited vascular outgrowth in explants from wild-type mice at days 3 to 9 (P
0.05), but not in explants from TSP1-/- mice. Therefore, sensitivity of angiogenesis to
4ß1 antagonists in this context is clearly TSP1-dependent. Loss of inhibition in the -/- mice was not due to compensatory upregulation of TSP2, based on comparable TSP2 mRNA levels in the wild-type and null explants (Figure 7D).
| Discussion |
|---|
|
|
|---|
4ß1 plays critical roles in adhesion and migration by binding to VCAM-1 on activated endothelium.30 Although VCAM-1 can modulate angiogenesis,41,42 little is known about
4ß1 function in endothelial cells. We show in this study that inhibiting
4ß1 disrupts angiogenic responses in vivo and in vitro. In vitro,
4ß1 mediates proliferative, adhesive, and chemotactic responses to N-terminal regions of TSP1 and TSP2. Based on differential responses of wild-type and TSP1 null explants to an
4ß1 antagonist, the ability of endogenous TSP1 to influence muscle explant vascularization depends on this integrin. However, TSP1 is probably not the only ligand for
4ß1 that modulates vascularization. A soluble form of VCAM-1 induces chemotaxis and proliferation of HUVECs and modulates angiogenesis in both cornea41 and CAM assays. Fibronectin, TSP2,27 and osteopontin43 are also
4ß1 ligands. Because angiogenesis involves smooth muscle cells and pericytes as well as endothelial cells, the functions of
4ß1 that are disrupted by
4ß1 antagonists may not be limited to endothelium.
Endothelial cells now have three identified ß1 integrins that recognize TSP1, and these integrins have some overlapping functions.
3ß1 mediates adhesion and chemotaxis but has both stimulatory and inhibitory effects on proliferation.18,19
6ß1 mediates adhesion and chemotaxis, but only in microvascular endothelial cells.19 Our data show that immobilized
4ß1 ligands selectively mediate venous endothelial adhesion and stimulate cell survival and proliferation. In addition,
4ß1 mediates chemotactic responses of venous endothelial cells to soluble TSP1 and TSP2. Both
4ß1 and
3ß1 contribute to angiogenesis in the CAM. Stimulation of angiogenesis by NoC2 demonstrates a role for
4ß1, but the stronger proangiogenic activity of NoC1 suggests that
3ß1 and
4ß1 are both proangiogenic TSP1 receptors.
Differential regulation may be key to understanding how functions of the eight endothelial cell TSP receptors identified to date are coordinated.
4ß1 and
3ß11 are widely expressed in endothelium,33,44 but their functional regulation differs.
3ß1 is inactivated by cell-cell contact and, therefore, may function as a TSP1 receptor only during vascular remodeling.18
6ß1 is active only on microvascular cells,19 whereas
4ß1 functions are largely restricted to large-vessel endothelium.
4ß1-dependent adhesion is not regulated by cell contact (unpublished data, 2003). CD36 is expressed and functions selectively on microvascular endothelium.45,46 CD36 is required for inhibition of FGF2-stimulated endothelial cell chemotaxis in vitro16 and for inhibition of angiogenesis in the cornea.12 Differential effects of TSP1 on HUVEC and HDMVEC proliferation at concentrations lower than 10 nmol/L9 are also consistent with an inhibitory activity mediated by CD36.
Although native TSP1 has no proangiogenic activity in the CAM assay, NoC1, NoC2, and other contructs containing the N-domain17,18 are proangiogenic. Therefore, proteolytic processing that removes the inhibitory type 1 repeats could generate proangiogenic fragments of TSP1 and TSP2. Previous studies have established that native TSP1 displays proangiogenic activities under certain conditions.47,48 Whether these activities are mediated by intact TSP1 or by proteolytic fragments similar to NoC1 remains to be determined.
The inhibitory activities of
4ß1 antagonists in the CAM assay suggest that
4ß1 becomes activated on microvascular endothelium in vivo. Alternatively,
4ß1 may be essential for a perivascular cell contribution to angiogenesis. Although we do not know which of these cells express functional
4ß1 in vivo, the explant data show that TSP1 is essential for sensitivity of neovascularization to an
4ß1 antagonist.
Integrins play complex regulatory roles in angiogenesis. ß1 Integrins are essential for angiogenesis,49 but the roles of specific ß1 integrins in this process are unclear. The
4 subunit is widely expressed in endothelial cells during vascular development,33 but the specific role of
4ß1 in angiogenesis remains unclear. As is known for
vß3 antagonists, our results using
4ß1 antagonists do not prove an essential role for
4ß1 in angiogenesis. However, like
vß3,1
4ß1 may be a useful pharmacological target to control pathological angiogenesis.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
3ß1 integrin modulates endothelial cell responses to thrombospondin-1. Mol Biol Cell. 2000; 11: 28852900.
6ß1 integrin. J Biol Chem. 2003; 278: 4067940687.
4ß1 integrin and CD47 differentially modulate T cell behavior. J Cell Biol. 2002; 157: 509519.
3ß1 integrin and regulated by insulin-like growth factor-1 and CD98. J Biol Chem. 1999; 274: 1140811416.
4ß1 integrin. Biochem Biophys Res Commun. 2002; 293: 8692.[CrossRef][Medline]
[Order article via Infotrieve]
5,
v, and
4 integrins. J Immunol. 2000; 165: 46674675.
4ß1. J Biol Chem. 1992; 267: 1401914026.
4 integrin and its ligands in development. Cell Adhes Commun. 1994; 2: 2743.[Medline]
[Order article via Infotrieve]
3ß1 integrin recognition sequence in thrombospondin-1. J Biol Chem. 1999; 274: 2408024086.
4ß1 that inhibit allergic airway responses. J Med Chem. 1999; 42: 920934.[CrossRef][Medline]
[Order article via Infotrieve]
4ß1 integrin binding sites within a 38 amino acid domain in the N-terminal thrombin fragment of human osteopontin. J Biol Chem. 2001; 276: 1348313489.
3 integrin subunit: tissue distribution and functional characterization. Lab Invest. 1997; 76: 547563.[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
G. Martin-Manso, S. Galli, L. A. Ridnour, M. Tsokos, D. A. Wink, and D. D. Roberts Thrombospondin 1 Promotes Tumor Macrophage Recruitment and Enhances Tumor Cell Cytotoxicity of Differentiated U937 Cells Cancer Res., September 1, 2008; 68(17): 7090 - 7099. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Goldfinger, E. Tzima, R. Stockton, W. B. Kiosses, K. Kinbara, E. Tkachenko, E. Gutierrez, A. Groisman, P. Nguyen, S. Chien, et al. Localized {alpha}4 Integrin Phosphorylation Directs Shear Stress-Induced Endothelial Cell Alignment Circ. Res., July 18, 2008; 103(2): 177 - 185. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Ochoa, H. Baker, S. Hasak, R. Matyal, A. Salam, C. A. Hales, W. Hancock, and D. A. Quinn Cyclic Stretch Affects Pulmonary Endothelial Cell Control of Pulmonary Smooth Muscle Cell Growth Am. J. Respir. Cell Mol. Biol., July 1, 2008; 39(1): 105 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tan, M. Duquette, J.-h. Liu, K. Shanmugasundaram, A. Joachimiak, J. T. Gallagher, A. C. Rigby, J.-h. Wang, and J. Lawler Heparin-induced cis- and trans-Dimerization Modes of the Thrombospondin-1 N-terminal Domain J. Biol. Chem., February 15, 2008; 283(7): 3932 - 3941. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Sozo, S. B. Hooper, and M. J. Wallace Thrombospondin-1 expression and localization in the developing ovine lung J. Physiol., October 15, 2007; 584(2): 625 - 635. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Annis, K. A. Gunderson, and D. F. Mosher Immunochemical Analysis of the Structure of the Signature Domains of Thrombospondin-1 and Thrombospondin-2 in Low Calcium Concentrations J. Biol. Chem., September 14, 2007; 282(37): 27067 - 27075. [Abstract] |