Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2004;94:1571-1578
Published online before print May 20, 2004, doi: 10.1161/01.RES.0000132747.12860.10
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
94/12/1571    most recent
01.RES.0000132747.12860.10v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brunelli, S.
Right arrow Articles by Cossu, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brunelli, S.
Right arrow Articles by Cossu, G.
Related Collections
Right arrow Developmental biology
Right arrow Functional genomics
Right arrow Gene expression
Right arrow Myogenesis
Right arrow Smooth muscle proliferation and differentiation
(Circulation Research. 2004;94:1571.)
© 2004 American Heart Association, Inc.


Molecular Medicine

Msx2 and Necdin Combined Activities Are Required for Smooth Muscle Differentiation in Mesoangioblast Stem Cells

Silvia Brunelli, Enrico Tagliafico, Fernanda G. De Angelis, Rossana Tonlorenzi, Silvia Baesso, Sergio Ferrari, Michio Niinobe, Kazuaki Yoshikawa, Robert J. Schwartz, Irene Bozzoni, Stefano Ferrari, Giulio Cossu

From the Stem Cell Research Institute (S Brunelli, R.T., S Baesso, G.C.), DIBIT-HSR, Milan, Italy; Department of Biomedical Science (E.T., Se Ferrari, St Ferrari), University of Modena, Modena, Italy; Institute Pasteur Fondazione Cenci-Bolognetti (F.G.D.A., I.B.), Department of Genetics and Molecular Biology and IPBM, University "La Sapienza," Rome, Italy; Division of Regulation of Macromolecular Functions (M.N., K.Y.), Institute for Protein Research, Osaka University, Yamadaoka Suita, Osaka, Japan; The Center for Cardiovascular Development (R.J.S.), Baylor College of Medicine, Houston, Tex; and Department of Histology and Embryology (G.C.), University "La Sapienza," Rome, Italy.

Correspondence to Dr Giulio Cossu, Stem Cell Research Institute, DIBIT-H San Raffaele, via Olgettina 58, 20132 Milan, Italy. E-mail cossu.giulio{at}hsr.it


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Little is known about the molecular mechanism underlying specification and differentiation of smooth muscle (SM), and this is, at least in part, because of the few cellular systems available to study the acquisition of a SM phenotype in vitro. Mesoangioblasts are vessel-derived stem cells that can be induced to differentiate into different cell types of the mesoderm, including SM. We performed a DNA microarray analysis of a mesoangioblast clone that spontaneously expresses an immature SM phenotype and compared it with a sister clone mainly composed of undifferentiated progenitor cells. This study allowed us to define a gene expression profile for "stem" cells versus smooth muscle cells (SMCs) in the absence of differentiation inducers such as transforming growth factor ß. Two transcription factors, msx2 and necdin, are expressed at least 100 times more in SMCs than in stem cells, are coexpressed in all SMCs and tissues, are induced by transforming growth factor ß, and, when coexpressed, induce a number of SM markers in mesoangioblast, fibroblast, and endothelial cell lines. Conversely, their downregulation through RNA interference results in a decreased expression of SM markers. These data support the hypothesis that Msx2 and necdin act as master genes regulating SM differentiation in at least a subset of SMCs.


Key Words: muscle, smooth • embryo • mesoangioblast


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Smooth muscle cells (SMCs) regulate a variety of functions, such as arterial tone, airway resistance, and gastrointestinal and genitourinary tract contractility; alterations of vascular smooth muscle cells (VSMCs) contribute to occlusive arteriosclerosis, which often leads to heart and brain stroke, the major causes of death in developed countries.1,2 Still, little is known about the developmental control of SMC specification and differentiation. For example, vascular development requires the correct spatial and temporal expression of specific sets of genes in at least 2 different progenitor cells, that is, the angioblasts that form a primary vascular network and the pericytes that surround the network and differentiate into VSMCs. SMCs may also derive from angioblast transdifferentiation and from migrating neural crest cells. This complex embryological origin suggests a similar complexity in its molecular control. Indeed, until now, no early specific marker or master gene has been demonstrated to play a role comparable to that of MyoD in skeletal muscle development.

Insights have been recently provided by work on the transcription factor modulator recognition factor 2 (Mrf2), which has been shown to be expressed at the onset of SM differentiation and to be a candidate regulator of SMC differentiation and proliferation.3,4

Moreover, myocardin, a transcriptional coactivator of serum response factor (SRF), has been shown to play a crucial role in smooth myogenesis, as shown by severe reduction of SM differentiation in the myocardin null embryo.5–7

We recently identified and characterized a class of vessel-associated stem cells called mesoangioblasts, which in the fetal stage of development are distributed to tissue anlagen through angiogenesis and through the circulation. They contribute to perinatal tissue growth and may represent the ancestors of postnatal stem cells;8–10 they also contribute to repair of cardiac and skeletal muscle.11,12

Here we show that 1 of the mesoangioblast clones isolated, although maintaining stem cell features such as pluripotency and self-renewal ability, also displays phenotypic traits of definitive SMCs. This led us to compare this cell line, through microarray analysis, with a sister clone (mainly composed of undifferentiated cells) to search for differentially expressed genes that may control the process of SM differentiation. Here we report that 2 such genes, msx2 and necdin, are likely candidates as regulators of SM differentiation.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
Mesoangioblast cell clones were derived from the dorsal aorta of C57/Bl6 9.5 dpc embryos and grown as described.9

Cell Proliferation Assay
D16 and D351 cells were seeded in microtiter plates (tissue culture grade 96 wells) at an initial density of 3x103 cells/well in 100 µL of complete medium. The relative increase in cell number was measured after 4 hours, 24 hours, 48 hours, and 72 hours using the Cell Proliferation Kit II (XTT) assay (Roche).

Immunofluorescence
Immunofluorescence on cells and cryostat sections was performed as reported.9 The antibodies used in this study and their working dilution were as follows: {alpha} smooth muscle actin ({alpha}SMA) monoclonal antibody (mAb) (1:350) (Sigma), SM22 mAb (1:300),13 calponin mAb (1:500) (Sigma), SM-MyoHC 1 e 2 mAb (1:400),14 rabbit anti-sarcomeric myosin (1:300), and MF20 mAb (1:2),9 NC243.15

Biotin-Labeled cRNA Transcription and GeneChip Hybridization
RNA (5 µg), isolated from quasi-confluent D16 and D351 culture, was converted into double-stranded cDNA by reverse transcription using the cDNA synthesis SuperScript Choice System kit (Invitrogen). Labeled cRNA was generated from the cDNA sample by in vitro transcription (Enzo bio array HY RNA transcript labeling kit; Enzo) supplemented with biotin-11-CTP and biotin-16-UTP. Fifteen micrograms of biotinylated cRNA were fragmented, assessed by gel electrophoresis, and placed in a hybridization cocktail containing 4 biotinylated hybridization controls (BioB, BioC, BioD, and Cre). Samples were hybridized to an identical lot of Affymetrix MGU74Av2, MGU74Bv2, and MGU74Cv2 GeneChip arrays for 16 hours. GeneChips were washed and stained according to the Eukaryotic GE WS2 protocol (Affymetrix).

Microarray Data Analysis
The images from the scanned chips were processed using the Affymetrix Microarray Analysis Suite 5.0 (MAS 5.0; see the online data supplement available at http://circres.ahajournals.org).

Constructs and Transfections
Necdin ORF and 3' probes were isolated by polymerase chain reaction (PCR) on 129 genomic DNA using the following primers, respectively, and using Pfu Taq polymerase (Promega): NECF1, AAAGATCTGTCCTGCTCTGATCCGAAGG; NECR2, AAGAATTTCGTATGGGTCAGAAACTATCAGTG (necdin ORF, 1020 bp); NECF2, CAAGGATCCACTGATAGTTTCTGACCCATAC; and NECR1, AAGAATTCGCCAGTTGAAGTCATATGGAG (necdin 3' probe, 400 bp). Necdin 3' probe fragment was cloned in pBluescript KS- (Stratagene); necdin ORF and Msx2 ORF (a gift from David Sassoon, Brookdale Department of Molecular, Cell and Developmental Biology, Mount Sinai Medical School, New York) were cloned in pCDNA3 (Invitrogen) and in pIRES2EGFP (Clontech).

D16 cells were transiently transfected with the necdin and msx2 expression vectors, alone or in combination, using the lipofectamin reagent (Invitrogen). Twenty-four hours after transfection, the serum concentration was lowered to facilitate differentiation, and after an additional 48 hours, cells were processed for immunofluorescence, or total RNA was extracted for RT-PCR analysis. Transfection efficiency ({approx}50%) of pCDNA3-based expression vectors was determined by cotransfection with pCMV-LacZ. D16 was also stably transfected with the same expression vectors. A pool of neomicin-resistant cells for each transfection combination were grown at low serum concentration for 4 days and processed for immunofluorescence.

In Situ Hybridization
In situ hybridization whole mount and on mouse cryostat sections was performed according to procedures described,16,17 using the necdin 3' probe.

Reverse Transcription—Polymerase Chain Reaction
RNA (1 µg) collected from various cell types and dissected embryos was converted into double-stranded cDNA by reverse transcription using the cDNA synthesis Thermoscript RT-PCR System kit (Invitrogen). cDNA was then amplified using specific primers (see the online data supplement).

RNA Interference
Small interfering RNA (siRNA)–expressing vectors, psiUc/necdin and psiUc/msx2, were obtained by cloning in the BglII and XhoI sites of the psiUx vector.17a DNA fragments were derived by annealing the following oligos: necdin F, 5'GATCTCAACAACCGTATGCCCATGACATTTGTGTAGTGTCATGGGCATACGGTTGTTTGACTTTCTGGAGTTTCAAAAGTAGAC-3'; necdin R, 5'TCGAGTCTACTTTTGAAACTCCAGAAAGTCAAACAACCGTATGCCCATG- ACACTACACAAATGTCATGGGCATACGGTTGTTGA-3'; Msx2 F, 5'GATCTCAACAGTACCTGTCCATAGCAGTTTGTGTAGCTGCTATGGACAGGTACTGTTTGACTTTCTGGAGTTTCAAAAGTAGAC-3'; Msx2 R, 5'TCGAGTCTACTTTTGAAACTCCAG-AAAGTCAAACAGTACCTGTCCATAGCAGCTACACAAAC-TGCTATGGACAGGTACTGTTGA-3'.

The selected target sequences on necdin and msx2 were taken from National Center for Biotechnology Information Database accession numbers NM_010882 (nucleotides 621 to 641) and NM_013601 (nucleotides 857 to 877), respectively.

For Northern Blot analysis on 10 µg of total RNA, we used the following oligos: {alpha} necdin, 5'-ACAACCGTATGCCCATGACA-3'; {alpha} msx2, 5'-ACAGTACCTGTCCATAGCAG-3'.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Characterization of a Mesoangioblast Cell Clone Displaying Features of SMCs
We isolated mesoangioblast cell clones from the dorsal aorta of a C57BL6 9.5 dpc embryo. These clones (called clones D) express the endothelial markers characteristic of mesoangioblast cells, including Sca-1, CD34, and Thy-1.9

The large majority of mesoangioblast cell clones contain a variable percentage of cells (ranging from 5% to 30%) that express the SM marker {alpha}SMA. When treated with transforming growth factor (TGF) ß1, cells in all clones differentiate into {alpha}SMA-positive SMCs, although with percentages that vary from clone to clone. However, one clone, D351, contains 80% to 90% of {alpha}SMA-positive cells, even in the absence of TGFß (Figure S1A through S1D in the online data supplement). D351 cells appear morphologically different, the cells being more flattened and extended compared with another clone, D16, which contains very few {alpha}SMA-positive cells (Figure 1A and 1B).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 1. Analysis of growth, SM-marker expression and differentiation potential of D16 and D351 cells. Phase-contrast image of D16 (A) and D351 (B) cells growing in standard culture conditions. C, Growth curve of D16 (black squares) and D351 cells (white circles) measured as relative absorbance using a colorimetric assay. D, Immunofluorescence on D351 cells growing in standard culture condition using antibody against {alpha}SMA, SM22, SM-MyoHC, and Calponin (green) merged with 4',6-diamidino-2-phenylindole (blue). E, Scatter plot showing the distribution of hybridization signals of D351 and D16 transcripts. The y axis indicates D351 signal; x axis, D16 signal. Genes with a higher signal in D351 are shown in red, genes with a higher signal in D16 in green, and unchanged genes in yellow. F, Histogram illustrating the relative expression of SM-specific genes in D16 (black columns) and D351 cells (white columns).

D351 cells proliferate at a lower rate than D16 cells (Figure 1C), are more resistant to apoptosis induced by serum starvation (Figure S1E through S1L in the online data supplement), and express SMC-specific markers such as SM22, calponin1, and SM-specific myosin (SM-MyoHC), in addition to {alpha}SMA (Figure 1D). Under the same conditions, D16 does not express SM22, calponin, or SM-MyHC1 and -2.

Nevertheless, D351 cells were able to differentiate in vitro into a variety of cell types, such as skeletal muscle, cardiac muscle, and osteocytes (Figure S2A through S2F in the online data supplement), with similar efficiency as D16 cells. The occurrence of transdifferentiation from SM to skeletal muscle or bone was documented by detection of a SM marker (calponin) in the same cytoplasm of cells that were also expressing sarcomeric myosin or alkaline phosphatase, respectively (Figure S2G through S2L in the online data supplement).

These observations led us to conclude that D351 cells still retain, at least in vitro, the pluripotency characteristic of mesoangioblasts, even if they have acquired a more defined SMC phenotype.

Phenotypic Analysis of Mesoangioblast Cell Clones by DNA Microarray
We then defined the molecular phenotype of D16 and D351 cells by DNA microarray technique to provide a thorough definition of the gene expression profile with respect to "stemness," embryological origin, and presence of lineage-specific markers in the absence of differentiation inducers. Fluorescent-labeled cRNA from D16 and D351 cells was hybridized to the Affymetrix Murine Genome U74v2 set, which consists of 3 GeneChip probe arrays (U74Av2, U74Bv2, U74Cv2), interrogating {approx}36 000 mouse genes and expressed sequence tag clusters from the UniGene database (Build 74). As shown in the scatter plot in Figure 1E and in the online data supplement, D16 and D351 express a similar number of sequences (12 696 in D16 and 14 162 in D351), with a slight increase in complexity in D351 (+11.5%). Most sequences are expressed in both D16 and D351 (11516). In this category, 6648 sequences are not changed in the 2 cell populations, whereas 2204 show an increased expression in D16 and 2664 in D351. The number of sequences that can be considered specifically expressed in either cell population, on the basis of a significant change probability value, is 499 in D16 and 1038 in D351. The complete set of data from the hybridization experiment has been submitted to the Gene Expression Omnibus repository18 and is available online at the site http://www.ncbi.nlm.nih.gov/geo (accession numbers: GSM8510, GSM8511, GSM8512, GSM8513, GSM8514, GSM8515, GSM8516, GSM8517, GSM8518, GSE552, GSE554, GSE555, and GSE563) (see also information in the online data supplement).

Identification of SM-Differentiation Cofactors
The microarray revealed the presence of differentially expressed transcription factor encoding messengers in the D351 pool that may represent putative transcriptional master genes for SM differentiation or genes involved in maintaining a differentiated state.

Among the transcription factor expressed exclusively in D351 (listed in Table S2 in the online data supplement), we decided to focus on the 2 most highly expressed transcription factors and whose role has never been studied in the context of SM development: necdin, a MAGE protein19,20 and msx2, a homeodomain-containing protein.21,22

To investigate whether these genes could indeed initiate or facilitate SM development and differentiation, we first analyzed their expression pattern during embryogenesis. Msx2 is already known to be expressed in the neural crest cells,23 progenitors for different types of SMCs, and also in the SM layer of many embryonic vessels24 (B. Robert, personal communication).

To gain information on the embryonic expression of necdin outside the central nervous system,25–27 we performed in situ hybridization and immunofluorescence on cryostat sections of E10.5 and E16.5 embryos. (E indicates embryonic day.)

This analysis showed that in E10.5 embryos, necdin is expressed in the neural tube (Figure 2A), in the myotomes (Figure 2B), ) and in mesenchymal condensation between the branchial arches pouch and the branchial arteries, 1 site of origin for vascular SMCs28 (arrow in Figure 2A). At E16.5, expression is found in brain, spinal chord, cranial nerves and dorsal root ganglion (data not shown), and in major skeletal muscle masses in the limbs (Figure 2E). In the abdomen, expression is found also in the external muscular layer outlining the gut (Figure 2C and 2D, arrows), and staining is also present in cells associate with some vessels in the limbs (Figure 2F, arrow). The localization of necdin in the SM layer in the gut, small vessels, and in the dorsal aorta is confirmed by immunostaining using an antibody specific for necdin15 that largely overlaps with {alpha}SMA-positive cells (Figure S2G through S2J in the online data supplement).



View larger version (111K):
[in this window]
[in a new window]
 
Figure 2. Expression of necdin during mouse embryogenesis. A through F, In situ hybridization on cryostat transverse (A and B) and sagittal (C through F) sections of mouse embryos at E10.5 (A and B) and E16.5 (C through F). Black arrow in A points to expression in mesenchyme around the branchial arteries, arrows in C and D point to staining in the forming gut, and arrow in F points to stained cells surrounding vessels of the limbs. D shows a higher magnification of the section shown in C. F shows a higher magnification of the section shown in E. G through J, Immunofluorescencee on cryostate transverse section of mouse embryos at E16.5 using antibodies specific for necdin (red) and {alpha}SMA (green). G and I show only necdin staining and DAPI (blue); H and J show the same sections as in G and I, but necdin signal is merged with the {alpha}SMA signal (green). Arrows in G and H point to a small vessel, positive for both necdin and {alpha}SMA. g indicates gut; m, myotomes; me, external muscular layer surrounding the gut; mn, motorneurons; nc, neural crest cells; and s, somites. Bar: A, B, and C, 300 µm; D and G through J, 200 µm; E, 100 µm.

Expression of Msx2 and Necdin in SMCs and Tissues
To test a possible role of msx2 and necdin in differentiation of SM, we investigated whether these genes are upregulated on TGFß-induced SM differentiation of mesoangioblast cells. We also tested their expression in other cell types, before and after TGFß treatment, including fibroblasts (3T3), embryonic fibroblasts (10T1/2), endothelial cells (H5V), and SMCs (rat SMC [RSMC]), as well as in embryonic aorta and gut at different developmental stages. Untreated D16 cells do not express detectable levels of msx2 and necdin, which are induced by TGFß after 18 hours, 36 hours, and 72 hours; this correlates with the expression of SM myosin (SM-MyoHC) and SM22. Interestingly, msx2 and necdin are coexpressed only in SMCs, both in cell lines and tissues. We also tested the expression of other transcription factors, which have been suggested to play a role in SM differentiation including myocardin, myocardin-related transcription factor (MRTFA), serum response factor (SRF), and Mrf2{alpha}4–6,29,30 (Figure 3A). Mrf2{alpha}, SRF, and MRTFA are expressed by both D351 and D16, before and after TGFß stimulation, but also in fibroblast, endothelial, and SMC lines at variable but consistent levels. As expected, expression of myocardin is restricted to SM cell lines and tissues, but no myocardin transcripts were observed in mesoangioblast cells in any condition (Figure 3A).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 3. A, Expression of necdin, msx2, and other SM genes in various cell lines and embryo tissues. RT-PCR using primers specific for necdin, msx2, myocardin, Mrf2{alpha}, MRTFA, SRF, SM-MyoHC, SM22, and glyceraldehyde 3-phosphate hydrogenase (G3PD) on D351 untreated cells; on D16 cells untreated or treated with TGFß for 18 hours, 36 hours, or 72 hours; on 3T3, 10T1/2, H5V, and RSMC untreated or treated with TGFß for 72 hours; on aorta (indicated as "A") or gut (indicated as "G") of E11.5, E13.5, and E17.5 mouse embryos; and on total E16.5 dpc embryo (indicated as "E"). B, Histogram illustrating the relative expression of 4 SMC markers {alpha}SMA (black), SM22 (white), calponin (gray), and SM-MyoHC (striped) in D16 transfected with an empty vector (mock) or with expression vectors for necdin and msx2 alone or in combination. C, RT-PCR using primers specific for necdin, msx2, myocardin, SM-MyoHC, calponin and G3PD in D16, 10T1/2, and H5V cells before or after transfection with necdin and msx2 expression vectors or both, in D351 untreated cells and in total E16.5 embryo.

Msx2 and Necdin Are Necessary and Sufficient to Activate SM Gene Expression in Different Cell Types
Msx2 and necdin were then overexpressed, individually or in combination, in D16 cells (which do not express either), in 10T1/2 cells that express only necdin, and in H5V cells (which express only msx2). Expression of either gene alone in D16 cells modestly increased the percentage of D16 cells expressing {alpha}SMA (Figure 3B), but did not induce expression of other SM markers; however, the combined expression of the 2 genes resulted in the induction of the SM-specific genes SM22, calponin, and SM-MyoHC (Figure 3B and 3C). In addition, the proliferation rate of D16 stably transfected with both genes, but did with a single one, appeared to be reduced (not shown). Expression of SM-specific myosin was also induced in 10T1/2 cells transfected with msx2 and at lower levels in H5V cells transfected with necdin, although expression of calponin was not detected in these conditions. The same was also observed when both necdin and msx2 were overexpressed in 10T1/2 and H5V (not shown).

To verify whether expression of SM markers was because of a direct transcriptional activation of the SMC genes by msx2 and necdin, we tested the ability of these 2 factors, alone or in combination, to transactivate SMC promoters, in D16 and 10T1/2 cells. We observed that msx2 and necdin, either alone or together, are incapable of activating the expression of the Luciferase reporters driven by 4 different SMC promoters, {alpha}-SMA, SM22, calponin, and {gamma}-SMA (Figure S3A in the online data supplement), thus suggesting that their action is likely indirect.

Finally, we wanted to ascertain if loss of expression of msx2 and necdin in D351 cells could affect their ability to express a SM phenotype. We transfected D351 with vectors expressing siRNA specific for necdin and msx2, alone or in combination. Forty-eight hours after transfection, we detected expression of the siRNA in the cells (Figure 4A). After 72 hours, we observed a reduction in the level of necdin and msx2 transcripts (Figure 4B), accompanied by a decreased expression of {alpha}SMA, SM22, calponin, and SM-MyoHC (Figure 4C through 4E), which appeared to be greater in cells expressing both siRNAs. We observed similar results when we transfected both siRNA in RSMCs (Figure 4F and 4G and data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. Downregulation of necdin and msx2 in D351 using RNA interference. A, Northern blot on total RNA from D351 cells transfected with the siRNA constructs, showing expression of the siRNA specific for necdin or msx2. B, RT-PCR for necdin, msx2, and G3PD on D351 total RNA transfected with the different siRNA. C, Histogram illustrating the percentage of D351 cells expressing the SM markers {alpha}SMA (black), SM22 (white), calponin (gray), and SM-MyoHC (striped) after transfection with the siRNA specific for necdin and msx2 or both, or a mock DNA. D through G, Immunofluorescence on D351 cells (D and E) or RSMCs (F and G) after transfection with the siRNA specific for necdin and msx2 (E and G), or a mock DNA using antibody against {alpha}SMA (green) merged with 4',6-diamidino-2-phenylindole (blue). Bar: 100 µn.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Origin of SM
Tracing the lineage of SM differentiation has been hampered by the lack of early markers, and, consequently, little knowledge is available on the origin of SMCs, apart from the observation that they arise from both the splanchnic mesoderm and the neural crest; similarly, little is known about the developmental program that leads to their differentiation.1,31–33 Because SMCs readily de-differentiate in vitro and show the same plasticity in vivo, it is conceivable that extrinsic positional cues, likely emanating from adjacent epithelia, play an important part in maintaining and, likewise, in inducing the differentiated SM phenotype. Moreover, different adjacent epithelia may induce subtle phenotypic differences in the associated SMCs. At least in the case of vascular development, SM may also derive from transdifferentiation of endothelial cells and, as mentioned above, from neural crest cells in specific districts of the vascular tree. In this context, it is interesting to note that mesoangioblasts, originally derived from angioblastic cells, at low frequency undergo differentiation into {alpha}SMA positive cells, suggesting that they mimic in vitro a phenomenon naturally occurring in vivo.10

Phenotypic Features of Mesoangioblast-Derived SMCs Revealed by Microarray Analysis
Both mesoangioblast cell clones D351 and D16 originate from the embryonic dorsal aorta and share a number of markers and similar transdifferentiation ability, but differ in the spontaneous expression of {alpha}SMA and other SMC markers.

Microarray analysis of transcripts of the 2 cell clones confirmed the SM phenotype of D351 cells, which express a number of SM-specific genes. Despite the expression of differentiated markers, D351 cells express some of the stem-cell–specific markers present in D16 cells, such as Sca-1 and Thy-1, but not others, such as CD34, indicating that D351 may represent an intermediate progenitor state toward terminally differentiated SM. This is also suggested by the maintained ability to differentiate into other mesoderm cell types, such as cardiac and skeletal muscle as well as bone.

Transcription Factors Selectively Expressed in Mesoangioblast-Derived SM
Among several transcription factors highly expressed in D351 cells, we focused on msx2 and necdin, whose role had never been associated with SM development and differentiation. Msx2 is expressed in the neural crest, and it is known to play different roles in osteogenesis, chondrogenesis, or in patterning cardiac neural crest.21,23,34 In addition, recent evidence indicates that msx2 is also expressed in the SM layer of many embryonic vessels24 (and B. Robert, personal communication).

Necdin has mainly been implicated in neuronal differentiation and has been associated with the Prader–Willi syndrome.19,20,35 In addition, we found that necdin is expressed in the mesenchyme of the interbranchial arch region, where SMCs that will surround the branchial arteries originate;28 later on, it is expressed in the external muscular layer surrounding the gut and many vessels.

The undifferentiated mesoangioblast stem cell clone D16 does not express SM markers, but is competent for SM differentiation on TGFß1 induction. A first response to TGFß1 stimulation is indeed the simultaneous upregulation of necdin and msx2. These results indicate that, at least in vitro, these 2 genes are early targets of TGFß1. Interestingly, msx2 and necdin are coexpressed only in SMCs or SM-fated cells, such as the mesoangioblast D351 line, whereas non-SMCs, such as 10T1/2 or H5V, express either one or the other. When overexpressed in D16 cells, in the absence of other growth factors, necdin and msx2 together (but not alone) are necessary and sufficient to initiate the differentiation program and to induce the appearance of several SMC markers, thus mimicking the action of TGFß stimulation. A similar effect was also seen in the embryonic fibroblast line 10T1/2, transfected only with msx2, and in the endothelial cell line H5V, transfected only with necdin, thus "complementing" the already expressed cofactor. In this situation, however, only some SMC markers are induced, such as SM-specific myosin, but not others, such as calponin. This suggests that for the complete induction of the SM differentiation pathway, other factors are needed in endothelial and fibroblast cells.

Conversely, when both necdin and msx2 are downregulated by RNA interference in both D351 and RSMCs, decreased expression of SM markers is observed, suggesting that necdin and msx2 also play a role in the maintenance of the SM-differentiated state.

Interestingly, it has been suggested that both necdin and msx2 have a role as transcriptional corepressors or direct transcriptional repressors.36–39 In particular, necdin has been shown to facilitate cell cycle exit and to promote survival by preventing p53-mediated apoptosis.40–42 Msx2 appears to play roles in cell cycle control and has a proapoptotic effect in vivo, particularly in osteogenesis.43–45 Intriguingly, just recently, it has been shown that necdin and msx2 form a stable complex via MAGE-D1 (NRAGE, Dlxin-1) (K. Yoshikawa, H. Taniura, I. Nishimura, and K. Yoshikawa, manuscript in preparation).

It has been independently reported that myocardin (a serum response cofactor), MRTFA, and Mrf2{alpha} and -ß (A-T rich interaction domain transcription factors) play a central role in SM differentiation. Myocardin is expressed in visceral and vascular SMC during development,5 and in cotransfection assays of rat aortic cells or 10T1/2 it activates several SMC-specific genes in a TGFß-independent way.6,29 The 2 myocardin-related transcription factors, MRTFA and -B, expressed in numerous embryonic and adult tissues, have been shown to interact with SRF and to stimulate its transcriptional activity.30 More recently, it has been demonstrated that myocardin mutant mice show a severe deficiency in SMC development.7 D16 and D351 mesoangioblasts do express, constitutively, MRF2{alpha} and MRTFA, as well as SRF, whereas they do not express myocardin, before or after TGFß-induced SMCs differentiation. Thus, it appears that TGFß-mediated mesoangioblast differentiation into SMC is myocardin independent; on the other hand, necdin and msx2 may cooperate with MRFTA or Mrf2{alpha} in the course of this process.

The scenario is also complicated by some of these proteins acting mainly as transcriptional activators, whereas others, including msx2 and necdin, act as repressors. Thus, a role for these 2 proteins in the process may be to repress transcription of another repressor of differentiation or, alternatively, to switch from repressors to activators, depending on their molecular partners, such as in the case of Tcf/Groucho ve Tcf/b catenin molecular complexes.46 Indeed, transient transfection of msx2 and necdin does not activate transcription of smooth promoter–directed reporter genes, but causes accumulation of the relative protein product in the cytoplasm. Whichever the underlying molecular mechanism, msx2 and necdin are necessary and sufficient to activate the SM program and, thus, act as SM master genes at least in a subset of progenitors. They act independently of myocardin (which is not expressed by mesoangioblasts nor induced by TGFß), indicating that the latter gene may play a crucial role in SM differentiation, but is not absolutely necessary for this process, at least in a subset of SMCs. This fact may explain why ablation of the myocardin gene results in a severe, but not complete, disappearance of SM.

Clearly, more experiments and deeper analysis of null mice are required to definitively clarify the role of these factors in SM differentiation. Currently, the simplest interpretation of the different data is that the embryological and phenotypic heterogeneity of SMCs may easily relate to the existence of different molecular entry points into the differentiation program, each mediated by different combinations of transcription factors, possibly activated at different times and in different places during embryonic, fetal, and postnatal development.


*    Acknowledgments
 
This work was supported by grants from Telethon, the European Community, Duchenne Parent Project Italia/Compagnia di San Paolo, Fondazione Istituto Pasteur-Cenci Bolognetti (FIRB), Consiglio Nazionale delle Ricerche (CNR), and the Italian Ministries of Health and of Education, University and Research (MIUR). We are grateful to Anna Innocenzi for her help with histology and immunofluorescence and to members of the laboratory for their critical reading of the manuscript. We are also indebted to Saverio Sartore for antibodies and to David Sassoon for constructs.


*    Footnotes
 
Original received January 28, 2004; revision received May 3, 2004; accepted May 7, 2004.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Owens GK. Regulation of differentiation of vascular smooth muscle cells. Physiol Rev. 1995; 75: 487–517.[Abstract/Free Full Text]

2. Gibbons GH, Dzau VJ. Molecular therapies for vascular diseases. Science. 1996; 272: 689–693.[Abstract]

3. Whitson RH, Huang T, Itakura K. The novel Mrf-2 DNA-binding domain recognizes a five-base core sequence through major and minor-groove contacts. Biochem Biophys Res Commun. 1999; 258: 326–331.[CrossRef][Medline] [Order article via Infotrieve]

4. Watanabe M, Layne MD, Hsieh C-M, Maemura K, Gray G, Lee M-E, Jain MK. Regulation of smooth muscle cell differentiation by AT-rich interaction domain transcription factors Mrf2{alpha} and Mrf2ß. Circ Res. 2002; 91: 382–389.[Abstract/Free Full Text]

5. Du KL, Ip HS, Li J, Chen M, Dandre F, Yu W, Lu MM, Owens GK, Parmacek MS. Myocardin is a critical serum response factor cofactor in the transcriptional program regulating smooth muscle cell differentiation. Mol Cell Biol. 2003; 23: 2425–2437.[Abstract/Free Full Text]

6. Wang Z, Wang D-Z, Pipes GCT, Olson EN. Myocardin is a master regulator of smooth muscle gene expression. Proc Natl Acad Sci U S A. 2003; 100: 7129–7134.[Abstract/Free Full Text]

7. Li S, Wang DZ, Wang Z, Richardson JA, Olson EN. The serum response factor coactivator myocardin is required for vascular smooth muscle development. Proc Natl Acad Sci U S A. 2003; 100: 9366–9370.[Abstract/Free Full Text]

8. De Angelis L, Berghella L, Coletta M, Cusella De Angelis MG, Lattanzi L, Ponzetto C, Cossu G. Skeletal myogenic progenitors originating from embryonic dorsal aorta coexpress endothelial and myogenic markers and contribute to post-natal muscle growth and regeneration. J Cell Biol. 1999; 147: 869–878.[Abstract/Free Full Text]

9. Minasi MG, Riminucci M, De Angelis L, Borello U, Berarducci B, Innocenzi A, Caprioli A, Sirabella D, Baiocchi M, De Maria R, Boratto R, Jaffredo T, Broccoli V, Bianco P, Cossu G. The meso-angioblast: a multipotent, self-renewing cell that originates from the dorsal aorta and differentiates into most mesodermal tissues. Development. 2002; 129: 2773–2783.[Abstract/Free Full Text]

10. Cossu G, Bianco P. Mesoangioblasts–vascular progenitors for extravascular mesodermal tissues. Curr Opin Genet Dev. 2003; 13: 537–542.[CrossRef][Medline] [Order article via Infotrieve]

11. Condorelli G, Borello U, De Angelis L, Latronico M, Sirabella D, Coletta M, Galli R, Balconi G, Follenzi A, Frati G, Cusella De Angelis MG, Gioglio L, Amuchastegui S, Adorini L, Naldini L, Vescovi A, Dejana E, Cossu G. Cardiomyocytes induce endothelial cells to transdifferentiate into cardiac muscle: implications for myocardium regeneration. Proc Natl Acad Sci U S A. 2001; 98: 10733–10738.[Abstract/Free Full Text]

12. Sampaolesi M, Torrente Y, Innocenzi A, Tonlorenzi R, D’Antona G, Pellegrino MA, Barresi R, Bresolin N, Cusella De Angelis MG, Campbell KP, Bottinelli R, Cossu G. Cell therapy of alpha sarcoglycan null dystrophic mice through intra-arterial delivery of mesoangioblasts. Science. 2003; 301: 487–492.[Abstract/Free Full Text]

13. Chiavegato A, Roelofs M, Franch R, Castellucci E, Sarinella F, Sartore S. Differential expression of SM22 isoforms in myofibroblasts and smooth muscle cells from rabbit bladder. J Muscle Res Cell Motil. 1999; 20: 133–146.[CrossRef][Medline] [Order article via Infotrieve]

14. Borrione AC, Zanellato AM, Scannapieco G, Pauletto P, Sartore S. Myosin heavy-chain isoforms in adult and developing rabbit vascular smooth muscle. Eur J Biochem. 1989; 183: 413–417.[Medline] [Order article via Infotrieve]

15. Niinobe M, Koyama K, Yoshikawa K. Cellular and subcellular localization of necdin in fetal and adult mouse brain. Dev Neurosci. 2000; 22: 310–319.[CrossRef][Medline] [Order article via Infotrieve]

16. Avilion AA, Bell DM, Lovell-Bedge R. Micro-capillary tube in situ hybridisation: a novel method for processing small individual samples. Genesis. 2000; 27: 76–80.[CrossRef][Medline] [Order article via Infotrieve]

17. Strähle U, Ingham PW. A simple and efficient procedure for non-isotopic in situ hybridization to sectioned material. Trends Genet. 1994; 10: 75–76.[CrossRef][Medline] [Order article via Infotrieve]

17. Denti MA, Rosa A, Sthandier O, De Angelis FG, Bozzoni I. Mol Ther. In press.

18. Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucl Acids Res. 2002; 30: 207–210.[Abstract/Free Full Text]

19. Muscatelli F, Abrous DN, Massacrier A, Boccaccio I, Le Moal M, Cau P, Cremer H. Disruption of the mouse Necdin gene results in hypothalamic and behavioral alterations reminiscent of the human Prader-Willi syndrome. Hum Mol Genet. 2000; 9: 3101–3110.[Abstract/Free Full Text]

20. Takazaki R, Nishimura I, Yoshikawa K. Necdin is required for terminal differentiation and survival of primary dorsal root ganglion neurons. Exp Cell Res. 2002; 277: 220–232.[CrossRef][Medline] [Order article via Infotrieve]

21. Satokata I, Ma L, Ohshima H, Bei M, Woo W, Nishizawa K, Maeda T, Takano Y, Uchiyama M, Heaney S, Peters H, Tang Z, Maxson R, Maas R. Msx2 deficiency in mice causes pleiotropic defects in bone growth and ectodermal organ formation. Nat Genet. 2000; 24: 291–295.[CrossRef][Medline] [Order article via Infotrieve]

22. Marazzi G, Wang Y, Sassoon D. msx2 is a transcriptional regulator in the BMP4-mediated programmed cell death pathway. Dev Biol. 1997; 186: 127–138.[CrossRef][Medline] [Order article via Infotrieve]

23. Kwang SJ, Brugger SM, Lazik A, Merrill AE, Wu LY, Liu YH, Ishii M, Sangiorgi FO, Rauchman M, Sucov HM, Maas RL, Maxson RE Jr. Msx2 is an immediate downstream effector of Pax3 in the development of the murine cardiac neural crest. Development. 2002; 129: 527–538.[Medline] [Order article via Infotrieve]

24. Tyson KL, Reynolds JL, McNair R, Zhang Q, Weissberg PL, Shanahan CM. Osteo/chondrocytic transcription factors and their target genes exhibit distinct patterns of expression in human arterial calcification. Arterioscler Thromb Vasc Biol. 2003; 23: 489–494.[Abstract/Free Full Text]

25. Uetsuki T, Takagi K, Sugiura H, Yoshikawa K. Structure and expression of the mouse necdin gene. Identification of a postmitotic neuron-restrictive core promoter. J Biol Chem. 1996; 271: 918–924.[Abstract/Free Full Text]

26. Yoshikawa K. Cell cycle regulators in neural stem cells and postmitotic neurons. Neurosci Res. 2000; 37: 1–14.[CrossRef][Medline] [Order article via Infotrieve]

27. Andrieu D, Watrin F, Niinobe M, Yoshikawa K, Muscatelli F, Fernandez PA. Expression of the Prader-Willi gene Necdin during mouse nervous system development correlates with neuronal differentiation and p75NTR expression. Gene Expr Patterns. 2003; 3: 761–765.[CrossRef][Medline] [Order article via Infotrieve]

28. Etchevers HC, Couly G, Le Douarin NM. Morphogenesis of the branchial vascular sector. Trends Cardiovasc Med. 2002; 12: 299–304.[CrossRef][Medline] [Order article via Infotrieve]

29. Yoshida T, Sinha S, Dandre F, Wamhoff BR, Hoofnagle MH, Kremer BE, Wang D-Z, Olson EN, Owens GK. Myocardin is a key regulator of CArG-dependent transcription of multiple smooth muscle marker genes. Circ Res. 2003; 92: 856–864.[Abstract/Free Full Text]

30. Wang DZ, Li S, Hockemeyer D, Sutherland L, Wang Z, Schratt G, Richardson JA, Nordheim A, Olson EN. Potentiation of serum response factor activity by a family of myocardin-related transcription factors. Proc Natl Acad Sci U S A. 2002; 99: 14855–14860.[Abstract/Free Full Text]

31. Topouzis S, Majesky MW. Smooth muscle lineage diversity in the chick embryo. Dev Biol. 1996; 178: 430–445.[CrossRef][Medline] [Order article via Infotrieve]

32. Etchevers H, Vincent C, Le Douarin N, Couly G. The cephalic neural crest provides pericytes and smooth muscle cells to all blood vessels of the face and forebrain. Development. 2001; 128: 1059–1068.[Abstract]

33. Hirschi KK, Majesky MW. Smooth muscle stem cells. Anat Rec. 2004; 276A: 22–33.

34. Takahashi K, Nuckolls GH, Takahashi I, Nonaka K, Nagata M, Ikura T, Slavkin HC, Shum L. Msx2 is a repressor of chondrogenic differentiation in migratory cranial neural crest cells. Dev Dyn. 2001; 222: 252–262.[CrossRef][Medline] [Order article via Infotrieve]

35. Gerard M, Hernandez L, Wevrick R, Stewart CL. Disruption of the mouse necdin gene results in early post-natal lethality. Nat Genet. 1999; 23: 199–202.[CrossRef][Medline] [Order article via Infotrieve]

36. Zhou YL, Lei Y, Snead ML. Functional antagonism between Msx2 and CCAAT/enhancer-binding protein alpha in regulating the mouse amelogenin gene expression is mediated by protein-protein interaction. J Biol Chem. 2000; 275: 29066–29075.[Abstract/Free Full Text]

37. Shirakabe K, Terasawa K, Miyama K, Shibuya H, Nishida E. Regulation of the activity of the transcription factor Runx2 by two homeobox proteins, Msx2 and Dlx5. Genes Cells. 2001; 6: 851–856.[Abstract]

38. Kuwako KI, Taniura H, Yoshikawa K. Necdin-related MAGE proteins differentially interact with the E2F1 transcription factor and the p75 neurotrophin receptor. J Biol Chem. 2004; 279: 1703–1712.[Abstract/Free Full Text]

39. Matsumoto K, Taniura H, Uetsuki T, Yoshikawa K. Necdin acts as a transcriptional repressor that interacts with multiple guanosine clusters. Gene. 2001; 272: 173–179.[CrossRef][Medline] [Order article via Infotrieve]

40. Barker PA, Salehi A. The MAGE proteins: emerging roles in cell cycle progression, apoptosis, and neurogenetic disease. J Neurosci Res. 2002; 67: 705–712.[CrossRef][Medline] [Order article via Infotrieve]

41. Tsai TF, Armstrong D, Beaudet AL. Necdin-deficient mice do not show lethality or the obesity and infertility of Prader-Willi syndrome. Nat Genet. 1999; 22: 15–16.[CrossRef][Medline] [Order article via Infotrieve]

42. Taniura H, Matsumoto K, Yoshikawa K. Physical and functional interactions of neuronal growth suppressor necdin with p53. J Biol Chem. 1999; 274: 16242–16248.[Abstract/Free Full Text]

43. Bendall AJ, Abate-Shen C. Roles for Msx and Dlx homeoproteins in vertebrate development. Gene. 2000; 247: 17–31.[CrossRef][Medline] [Order article via Infotrieve]

44. Hu G, Lee H, Price SM, Shen MM, Abate-Shen C. Msx homeobox genes inhibit differentiation through upregulation of cyclin D1. Development. 2001; 128: 2373–2384.[Abstract/Free Full Text]

45. Gomes WA, Kessler JA. Msx-2 and p21 mediate the pro-apoptotic but not the anti-proliferative effects of BMP4 on cultured sympathetic neuroblasts. Dev Biol. 2001; 237: 212–221.[CrossRef][Medline] [Order article via Infotrieve]

46. Tutter AV, Fryer CJ, Jones KA. Chromatin-specific regulation of LEF-1-beta-catenin transcription activation and inhibition in vitro. Genes Dev. 2001; 15: 3342–3354.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Cell Sci.Home page
C. Sciorati, T. Touvier, R. Buono, P. Pessina, S. Francois, C. Perrotta, R. Meneveri, E. Clementi, and S. Brunelli
Necdin is expressed in cachectic skeletal muscle to protect fibers from tumor-induced wasting
J. Cell Sci., April 15, 2009; 122(8): 1119 - 1125.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
N. L.G. Miller, R. Wevrick, and P. L. Mellon
Necdin, a Prader-Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development
Hum. Mol. Genet., January 15, 2009; 18(2): 248 - 260.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-L. Cheng, J.-S. Shao, J. Cai, O. L. Sierra, and D. A. Towler
Msx2 Exerts Bone Anabolism via Canonical Wnt Signaling
J. Biol. Chem., July 18, 2008; 283(29): 20505 - 20522.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
E. J. Chapman, G. Kelly, and M. A. Knowles
Genes Involved in Differentiation, Stem Cell Renewal, and Tumorigenesis Are Modulated in Telomerase-Immortalized Human Urothelial Cells
Mol. Cancer Res., July 1, 2008; 6(7): 1154 - 1168.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Tanaka, H. Sato, H. Doi, C. A. Yoshida, T. Shimizu, H. Matsui, M. Yamazaki, H. Akiyama, K. Kawai-Kowase, T. Iso, et al.
Runx2 Represses Myocardin-Mediated Differentiation and Facilitates Osteogenic Conversion of Vascular Smooth Muscle Cells
Mol. Cell. Biol., February 1, 2008; 28(3): 1147 - 1160.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
D. Deponti, S. Francois, S. Baesso, C. Sciorati, A. Innocenzi, V. Broccoli, F. Muscatelli, R. Meneveri, E. Clementi, G. Cossu, et al.
Necdin mediates skeletal muscle regeneration by promoting myoblast survival and differentiation
J. Cell Biol., October 22, 2007; 179(2): 305 - 319.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. Sciorati, B. G. Galvez, S. Brunelli, E. Tagliafico, S. Ferrari, G. Cossu, and E. Clementi
Ex vivo treatment with nitric oxide increases mesoangioblast therapeutic efficacy in muscular dystrophy
J. Cell Sci., December 15, 2006; 119(24): 5114 - 5123.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Hayashi, S. Nakamura, W. Nishida, and K. Sobue
Bone Morphogenetic Protein-Induced Msx1 and Msx2 Inhibit Myocardin-Dependent Smooth Muscle Gene Transcription
Mol. Cell. Biol., December 15, 2006; 26(24): 9456 - 9470.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. Porto, R. Palumbo, M. Pieroni, G. Aprigliano, R. Chiesa, F. Sanvito, A. Maseri, and M. E. Bianchi
Smooth muscle cells in human atherosclerotic plaques secrete and proliferate in response to high mobility group box 1 protein
FASEB J, December 1, 2006; 20(14): 2565 - 2566.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Morosetti, M. Mirabella, C. Gliubizzi, A. Broccolini, L. De Angelis, E. Tagliafico, M. Sampaolesi, T. Gidaro, M. Papacci, E. Roncaglia, et al.
MyoD expression restores defective myogenic differentiation of human mesoangioblasts from inclusion-body myositis muscle
PNAS, November 7, 2006; 103(45): 16995 - 17000.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Kuwajima, I. Nishimura, and K. Yoshikawa
Necdin promotes GABAergic neuron differentiation in cooperation with Dlx homeodomain proteins.
J. Neurosci., May 17, 2006; 26(20): 5383 - 5392.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. Pisconti, S. Brunelli, M. Di Padova, C. De Palma, D. Deponti, S. Baesso, V. Sartorelli, G. Cossu, and E. Clementi
Follistatin induction by nitric oxide through cyclic GMP: a tightly regulated signaling pathway that controls myoblast fusion
J. Cell Biol., January 17, 2006; 172(2): 233 - 244.
[Abstract] [Full Text] [PDF]


Home page
QJMHome page
D. Hamerman
Osteoporosis and atherosclerosis: biological linkages and the emergence of dual-purpose therapies
QJM, July 1, 2005; 98(7): 467 - 484.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Yoshida and G. K. Owens
Molecular Determinants of Vascular Smooth Muscle Cell Diversity
Circ. Res., February 18, 2005; 96(3): 280 - 291.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kuwajima, H. Taniura, I. Nishimura, and K. Yoshikawa
Necdin Interacts with the Msx2 Homeodomain Protein via MAGE-D1 to Promote Myogenic Differentiation of C2C12 Cells
J. Biol. Chem., September 24, 2004; 279(39): 40484 - 40493.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
E. Tagliafico, S. Brunelli, A. Bergamaschi, L. De Angelis, R. Scardigli, D. Galli, R. Battini, P. Bianco, S. Ferrari, G. Cossu, et al.
TGF{beta}/BMP activate the smooth muscle/bone differentiation programs in mesoangioblasts
J. Cell Sci., September 1, 2004; 117(19): 4377 - 4388.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
94/12/1571    most recent
01.RES.0000132747.12860.10v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brunelli, S.
Right arrow Articles by Cossu, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brunelli, S.
Right arrow Articles by Cossu, G.
Related Collections
Right arrow Developmental biology
Right arrow Functional genomics
Right arrow Gene expression
Right arrow Myogenesis
Right arrow Smooth muscle proliferation and differentiation