| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
Agonists Ameliorate Endothelial Cell Activation via Inhibition of DiacylglycerolProtein Kinase C Signaling Pathway
From Signal Transduction Laboratory (E.V., L.W., C.W., N.A., M.A.V., P.X.), Hanson Institute, Institute of Medical and Veterinary Science (C.H., J.R.G.), and Department of Medicine, University of Adelaide (J.R.G., M.A.V., P.X.), Australia; and Department of Medicine (V.K.K.C.), University of Cambridge, UK.
Correspondence to Pu Xia, MD, Signal Transduction Laboratory, Hanson Institute, Frome Road, PO Box 14 Rundle Mall, Adelaide, SA 5000, Australia. E-mail pu.xia{at}imvs.sa.gov.au
| Abstract |
|---|
|
|
|---|
agonists are emerging as potential protectors against inflammatory cardiovascular diseases including atherosclerosis and diabetic complications. However, their molecular mechanism of action within vasculature remains unclear. We report here that PPAR
agonists, thiazolidinedione class drugs (TZDs), or 15-deoxy-
12,14-prostaglandin J2 (15d-PGJ2) were capable of activating diacylglycerol (DAG) kinase (DGK), resulting in attenuation of DAG levels and inhibition of protein kinase C (PKC) activation. The PPAR
agonist-induced DGK was completely blocked by a dominant-negative mutant of PPAR
, indicating an essential receptor-dependent action. Importantly, the suppression of DAG-PKC signaling pathway was functional linkage to the anti-inflammatory properties of PPAR
agonists in endothelial cells (EC), characterized by the inhibition of proinflammatory adhesion molecule expression and adherence of monocytes to the activated EC induced by high glucose. These findings thus demonstrate a novel molecular action of PPAR
agonists to suppress the DAG-PKC signaling pathway via upregulation of an endogenous attenuator, DGK.
Key Words: PPAR
diacylglycerol kinase protein kinase C vascular inflammation diabetic complications
| Introduction |
|---|
|
|
|---|
(PPAR
), have emerged as useful agents to protect against vascular inflammation. PPAR
is originally identified as a master regulator in adipogenesis and glucose homeostasis (reviewed in3). PPAR
is also expressed in vascular cells and exhibit anti-inflammatory properties within the vessel wall.4 Clinical observations have suggested that the thiazolidinedione (TZD) class of antihyperglycemic drugs, such as troglitazone, rosiglitazone, and pioglitazone, a set of PPAR
agonists, have beneficial effects on vasculature in addition to their insulin-sensitizing action.5,6 However, the precise effects of PPAR
agonists on vascular cells and the molecular mechanisms underlying their anti-inflammatory action remain unclear.
The integrity of vascular endothelial cells (EC) is fundamental for normal homeostasis of the vessel wall, particularly for maintaining the uninterrupted circulation of leukocytes, which is responsible for the anti-inflammatory phenotype of the endothelium.7 The anti-inflammatory phenotype of EC is maintained by a balance between positive and negative cellular signals in response to the environmental stimuli. In various disease states, such as atherosclerosis and diabetes, multiple or individual risk factors damage this phenotype through deregulation of signal transduction pathways, often rendering the induction of lipid second messengers such as diacylglycerol (DAG). DAG serves as an allosteric activator of the conventional and novel protein kinase C (PKC) isoforms that mediate many cellular functions including cell growth, activation, and differentiation.8 The DAG-PKC signaling pathway has been implicated in the pathogenesis of diabetic vascular diseases and insulin-resistance.9,10 Inhibition of this pathway by specific inhibitors of PKC, exemplified by the PKCß inhibitor, was demonstrated to ameliorate the dysfunction of vasculature in diabetic animals,11 providing a new strategy for the treatment of diabetic vascular diseases. Inhibition of the DAG-PKC pathway can also be achieved by diacylglycerol kinase (DGK) that functions via decreasing intracellular DAG levels by phosphorylation of DAG yielding phosphatidic acid. DGK is thus regarded as an endogenous attenuator of the DAG-PKC pathway.12 In the present study, we have examined this endogenous attenuation mechanism in EC and found that the PPAR
agonists were capable of increasing DGK
production and DGK activity resulting in suppression of the DAG-PKC signaling pathway. Consequently, this inhibition was connected to the PPAR
agonists anti-inflammatory effect characterized by an inhibition of the proinflammatory adhesion molecule induction and adherence of monocytes to the activated EC induced by high glucose. These findings demonstrate that inhibition of DAG-PKC pathway through upregulation of DGK is a novel molecular mechanism by which PPAR
agonists ameliorate EC activation and protect against vascular inflammation.
| Materials and Methods |
|---|
|
|
|---|
Plasmids and Transfection
The human wild-type PPAR
1 cDNA and the double mutant PPAR
L468A/E471A tagged with a FLAG tag were subcloned into the pcDNA3 plasmids (Invitrogen, Melbourne, Australia) as previous described.15 Lipofectamine 2000-mediated (Invitrogen) transfection was performed in BAE cells according to the manufacturers protocols.
Flow Cytometry Analysis
After the indicated treatment, HUVECs were incubated with primary monoclonal antibodies to VCAM-1, ICAM-1, and E-selectin or the isotype-matched nonrelevant antibody for 30 minutes. The antibodies were generated in our laboratory and their characteristics have been described previously.13 Cells were then incubated with FITC-conjugated secondary antibody and fixed in 2.5% formaldehyde. Expression of cell-surface adhesion molecules was measured as fluorescence intensity by use of a Coulter Epics Profile XL flow cytometer.
Adherence of U937 Cells to EC
U937 cells (CRL 1593.2; American Type Culture Collection, Manassas, Va) were grown in RPMI-1640 medium (Invitrogen) containing 10% FCS and colorific labeled with 0.2 mg/mL MTT in the medium for 30 minutes at 37°C. The cells were then collected by low-speed centrifugation and resuspended at a density of 2x105 cells/mL in medium without FCS. HUVECs were seeded into 24-well plates and cultured with NG or HG medium for 3 days after confluence. After washing twice with warm RPMI-1640 medium, the MTT-labeled U937 cell suspension (100 µL/well) was added and incubated for 30 minutes at 37°C. Nonadherent cells were removed by rinsing the plates 3 times with phosphate-buffered saline, and the number of adherent cells were counted under microscopy with at least 6 fields per well culture analyzed.
Measurement of DGK Activity
DGK activity was determined in cell lysates as previously described.16 Briefly, cell lysates were incubated with 1,2-dioleoylglycerol in the presence of [
-32P]ATP. Thereafter, the generation of [32P]PA by endogenous DGK was determined by its separation using TLC using a solvent system consisting of chloroform/methanol/4 mol/L ammonium hydroxide [9:7:2 (v/v/v)]. Bands corresponding to radiolabeled PA were quantified by using the PhosphorImager (Molecular Dynamics).
Determination of total DAG Levels
Total lipids were extracted from cells exposed to NG or HG for 3 days. The amount of DAG mass was determined by its conversion into [32P]PA by Escherichia coli DGK in the presence of [
-32P]ATP as previously described.17 DAG levels were then corrected to the protein levels assayed by Bio-Rad reagents.
Reverse-Transcription Polymerase Chain Reaction and Real-Time Reverse-Transcription Polymerase Chain Reaction Analysis
Total RNA was isolated from HUVEC using Trizol (Invitrogen) in combination with RNeasy RNA kit (Qiagen). First-strand cDNA was synthesized from 1 µg of RNA, using 1 µmol/L of poly A primer of the sequence AAGCAGTGGTAACAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTT with Omniscript RT Kit (Qiagen) following the manufactures instructions. The sequences of polymerase chain reaction (PCR) primers used were forward GGGTACGAGGGATTCCAGCA and reverse CATCTCCAGACCCAGCAGCA for DGK
; and forward GGCAAATGCTGGACCCAACACAAA and reverse CTAGGCATGGGAGGGAACAAGGAA for a housekeeping gene, cyclophilin. For transcript quantification purposes, real-time PCR was performed. Then 1 µL of the reverse-transcriptase product was used in a 25 µL volume reaction containing 200 µmol/L of each dNTP, 5 pmol of each primer, 1x PCR buffer II, 1.5 mmol/L MgCl2, 0.2x SYBR Green I (Molecular Probes), and 1.25 U of Amplitaq Gold (Applied Biosystems). Amplification was performed using Rotor Gene-3000 (Corbett Research) programmed as 94°C for 12 minutes followed by 40 cycles of (94°C for 20 seconds, 57°C for 20 seconds, 72°C for 40 seconds). A standard curve of DGK
amplification was generated by using known concentrations of the full DGK
sequence. Variability in the initial quantities of cDNA was normalized to the internal control, cyclophilin. A negative control was included in each set of experiments. Melting curve analysis was performed to enhance specificity of the amplification reaction, and the Rotorgene software was used to compare the amplification in the experimental samples during the log-linear phase to the standard curve.
Immunoblotting
Cell lysates were equalized to the same amount of proteins and resolved on 10% polyacrylamide-SDS gel followed by transfer to a nitrocellulose membrane. Thereafter, immunoblotting was performed with the antibodies against DGK
(Gift from Dr F. Sakane, Sapporo Medical University, Japan), DGK
, PKCß1 (Santa Cruz Biotechnology, Calif), FLAG (M2; Sigma, Clayton, Australia), and Actin (CHEMICON, Calif), respectively.
Assay of PKC Activity and Translocation
PKC activity was assayed in situ as described previously.14 Briefly, cells were seeded in 24-well plates and exposed to NG or HG for 3 days. After the indicated treatments, total PKC activity was determined in the permeabilized cells in the presence of 10 µmol/L [
32P]ATP (5000 cpm/pmol) and 200 µmol/L PKC-specific peptide substrate (RKRTLRRL). The activity was then quantified by scintillation counting and normalized with total protein levels. For PKCß translocation analysis, transfected BAEC with stable overexpression of enhanced green fluorescent protein-fused PKCß1 isoform (PKCß-EGFP) were grown in NG or HG medium for 1 week, then plated onto fibronectin-coated 8-well microscope slides and incubated for 24 to 48 hours under the same culture conditions. The cells were washed once with serum-free DMEM containing NG or HG and then incubated for 4 hours in the presence or absence of 1 µmol/L or 10 µmol/L ciglitazone. Cells stimulated with VEGF were incubated with 10 ng/mL VEGF165 for 5 minutes. After the treatments, cells were immunostained for F-actin using rhodamine phalloidin. Epifluorescence microscopic analysis was performed using either 100x oil-immersion or 40x objective on an Olympus BX-51 microscope system, acquired to a Cool Snap FX charge-coupled device camera (Photometrics). Images were then analyzed with V++ software (Digital Optics, Auckland, New Zealand). For immunoblot analysis of PKCß translocation, cytosolic and membrane fractions were isolated as described previously17 from the treated PKCß-transfected BAEC.
| Results |
|---|
|
|
|---|
Agonists Ameliorate EC Activation
agonists on the production of VCAM-1, ICAM-1, and E-selectin in HUVEC exposed to high glucose. After the glucose level was increased from 5.5 to 22 mmol/L in the media for 3 days, cell surface expression of VCAM-1, ICAM-1, and E-selectin were significantly increased by
3-fold, 2-fold, and 4-fold in cultured HUVEC, respectively (Figure 1). Neither mannitol nor L-glucose at 22 mmol/L had significant effect on the adhesion molecule expression (data not shown), indicating a specific effect of high glucose on EC caused by the surplus cellular metabolites of D-glucose rather than osmotic stress. Interestingly, the high-glucoseinduced adhesion molecule expression was completely inhibited after treatment with the PPAR
agonists ciglitazone, troglitazone, or 15d-PGJ2 at a concentration of 2 µmol/L (Figure 1). This concentration used herein is reflective of the known affinity of the ligands binding to PPAR
,18 suggesting a receptor-dependent effect. Investigating the functional consequences of this observation, EC exposed to 22 mmol/L glucose resulted in significant increases in adherence of leukocytes to the EC (Figure 2). Remarkably, administration of 2 µmol/L ciglitazone profoundly reduced the number of leukocytes adhering to high-glucosestimulated EC (Figure 2), suggesting a role for PPAR
agonists in protection against high-glucosemediated EC activation.
|
|
The Effect of PPAR
Agonists on EC Requires DGK Activity
It has been recognized that activation of DAG-PKC signaling pathway plays a critical role in high-glucosemediated dysfunction of vasculature including EC activation in diabetes.9 We thus examined a possible role of DAG-PKC pathway in the action of PPAR
agonists. As shown in Figure 3, high-glucoseinduced expression of VCAM-1 was significantly attenuated by a PKC-specific inhibitor, GF-109203X. In contrast, PMA, an exogenous activator of PKC, significantly enhanced adhesion molecule expression, suggesting an involvement of DAG-PKC pathway in the regulation of adhesion molecule expression. However, although ciglitazone effectively blocked the high-glucoseinduced VACM-1 expression (Figure 3A), the PPAR
agonists were unable to inhibit the PMA-induced adhesion protein expression (Figure 3B), indicating that the PPAR
agonists had no direct effect on PKC activity. Interestingly, pretreatment with a specific inhibitor of DGK, R59949,19 completely reversed the inhibitory effect of ciglitazone on high-glucoseinduced expression of VCAM-1 (Figure 3A). By contrast, R59949 had no influence on the inhibitory effect of GF-109203X (Figure 3A), and R59949 alone had no effect on the adhesion molecule expression (data not shown). Therefore, a possible role of DGK in the PPAR
agonists action was then examined. Treatment of HUVEC with TZDs or 15d-PGJ2 resulted in significant increases in DGK activity in a dose-dependent manner, reaching a maximum effect (>2-fold increases) at
20 µmol/L (Figure 4A and 4B). Even at a concentration as low as 2 µmol/L, the PPAR
agonists were capable of significantly increasing DGK activity by 40% (Figure 4B). As a control, fenofibrate, a PPAR
agonist, had no effect on the DGK activity (data not shown), indicating a specific effect of PPAR
agonists. Collectively, these data suggest that DGK may be a potential molecular target for the action of PPAR
agonists in protection of EC against activation.
|
|
PPAR
Agonists Upregulate DGK
Production
Time-course analysis showed that a significant increase in DGK activity induced by TZDs or 15d-PGJ2 appeared after treatment for at least 4 hours (Figure 4C). In addition, the effect of PPAR
agonists was abrogated by pretreated with a transcription inhibitor, actinomycin-D (Figure 4A), suggesting that PPAR
-dependent transcriptional activities are required for the increased DGK activity. Reverse-transcriptase polymerase chain reaction (RT-PCR) analysis showed that treatment of cells with the PPAR
agonists for 4 hours resulted in significant increases in the mRNA levels of DGK
(Figure 5A), but not DGK-ß or DGK-
isoforms (data not shown). The increased DGK
mRNA levels were quantified by real-time PCR analysis, showing
5-fold to 8-fold increases in the mRNA levels after the treatment with PPAR
agonists (Figure 5B). Furthermore, the immunoblotting analysis revealed marked increases in DGK
protein levels in the cells treated with TZDs or 15d-PGJ2 in a dose-dependent manner (Figure 5C). These data demonstrate a role for PPAR
agonists in the regulation of DGK
production. To verify whether these PPAR
agonists effects are mediated by the receptors, we used a dominant-negative PPAR
mutant, PPAR
L468A/E471A, which has been shown to effectively silence the PPAR
-dependent gene transcriptions.15 Neither TZDs nor 15d-PGJ2 were able to induce DGK
production in the cells expressing PPAR
L468A/E471A, whereas overexpression of the wild-type receptors enhanced the PPAR
agonist-induced DGK
expression (Figure 5D), indicating the action of PPAR
agonists principally dependent on the nuclear receptors.
|
PPAR
Agonists Inhibit Activation of the DAG-PKC Pathway
Given the ability of PPAR
agonists to upregulate DGK, we sought to define the consequent effects on the DAG-PKC signaling pathway. Consistent with previous reports,17,20 EC exposed to high glucose for 3 days resulted in significant increases in total DAG levels and PKC activities in comparison with the cells exposed to 5.5 mmol/L glucose (Figure 6A and 6B). Treatment of cells with 2 µmol/L TZDs or 15d-PGJ2 significantly reduced the high-glucoseinduced increases in DAG levels by 81.2%±10.7%, 61.4%±11.7%, and 80.2%±3.2%, respectively (Figure 6A). Consequently, the high-glucoseinduced PKC activity was reversed nearly to basal levels by the PPAR
agonists (Figure 6B). Among the various PKC isoforms in vascular EC, PKCß isoform has been shown to be preferentially activated by high glucose.21 In agreement with this, the transfected BAEC with stable overexpression of EGFP-tagged PKCß exposed to high glucose resulted in a significant translocation of EGFP-PKCß from cytosol to plasma membrane (Figure 7A and 7C). However, this translocation was dramatically inhibited by pretreatment with ciglitazone at a concentration as low as 1 µmol/L. To further verify the inhibition of PKCß activation by PPAR
agonists, we examined the effect of PPAR
agonists on VEGF-induced PKC activation, because VEGF has been demonstrated to activate PKCß though PLC
activation and DAG generation.22 Again, the translocation of PKCß induced by VEGF was also markedly inhibited by ciglitazone (Figure 7B and 7C). By contrast, PMA-promoted PKCß translocation was not influenced by the PPAR
agonists (Figure 7C), suggesting the effect of PPAR
agonists specifically targeting the upstream of PKC activation (ie, DGK) rather than PKC itself.
|
|
| Discussion |
|---|
|
|
|---|
agonists, such as TZD antidiabetic drugs and 15d-PJ2, protect against EC activation and vascular inflammation. We found that PPAR
agonists were capable of attenuating the activation of DAG-PKC signal transduction pathway via upregulation of DGK activity, leading to the inhibition of high-glucoseinduced EC activation. Induction of adhesion molecules on the EC surface and the interaction between EC and blood cells are critical for the pathogenesis of atherosclerotic cardiovascular diseases including diabetic complications.7 For instance, the expression of VCAM-1, ICAM-1, or E-selectin has been seen in atherosclerosis-prone regions and over fatty streaks and is likely, at least in part, to be responsible for the recruitment of monocytes to these areas.23,24 Atherogenic stimuli such as native or oxidized low-density lipoproteins stimulated adhesion protein expression,25 and protective agents such as high-density lipoproteins inhibited this.26 Hyperglycemia or high glucose was also capable of inducing hyperadhesion of leukocyte to the endothelium both in vitro and in vivo.27,28 Consistent with these reports, we found that HUVEC exposed to high glucose for 3 days resulted in significant increases in cell-surface expression of VCAM-1, ICAM-1, and E-selectin and consequently enhanced adherence of leukocytes to the activated EC. This thus represents an ideal model for the study of high-glucoseinduced EC activation.
PPAR
agonists such as TZDs and 15d-PGJ2 have been reported to inhibit the expression of adhesion molecules in cytokine-activated EC, albeit with some inconsistencies because of different laboratories using different cell lines.29,30 The inhibitory effect of PPAR
has been recently demonstrated by enforced expression of a constitutively active mutant of PPAR
in EC, resulting in significant suppression of adhesion molecule expression,31 revealing an essential PPAR
receptor-dependent mode of action. In agreement with this finding, we found that the high-glucoseinduced expression of VCAM-1, ICAM-1, and E-selectin was completely inhibited by both TZDs and 15d-PGJ2 at 2 µmol/L (Figure 1), within the range of known affinity of the ligands binding to the receptors,18 suggesting the role for PPAR
receptors. Consequently, adhesion of leukocytes to the activated EC was significantly reduced by the PPAR
agonists, further indicating the anti-inflammatory effect of PPAR
on EC.
The finding that PPAR
agonists-induced reduction of adhesion molecule expression was blocked by R59949, a DGK-specific inhibitor, suggests a potential role of DGK in the action of PPAR
agonists. In support of this notion, we found that the PPAR
agonists were strong inducers of DGK activity as documented by an in vitro kinase activity assay (Figure 4) and intracellular DAG level determination (Figure 6). The observations of a delayed increase in DGK activity and the ability of a transcriptional inhibitor to block the elevated DGK activity suggest that the PPAR
agonist-induced increases in DGK activity may result from an increase in the production of DGK. The increased DGK protein levels could cause changes in the enzyme subcellular localization that facilitates the enzymatic activation and/or enhances the availability of substrate, leading to increases in the DGK activity. Indeed, it has been reported that enforced overexpression of DGK
per se caused increases in DGK activity and attenuation of DAG signaling.32 Demonstrating the effect of PPAR
agonists on DGK production, both mRNA and protein levels of DGK
, but not DGK-ß or DGK-
isoforms, were significantly increased in EC treated with TZDs or 15d-PGJ2 (Figure 5). Remarkably, the PPAR
agonist-induced production of DGK
was completely abolished by the dominant-negative mutant, PPAR
L468A/E471A, suggesting that the effect depends on the receptor-mediated transcriptional activity. Analysis of genome sequences of human DGK
shows that at least 2 PPAR-responsive elements are present in the putative promoter region of the gene, further supporting the role of PPAR
in the regulation of DGK
expression. Additional studies are required to identify the direct effect of PPAR
in DGK
gene regulation.
DGK is a well-conserved lipid kinase that phosphorylates DAG to yield phosphatidic acid and is therefore a potent endogenous terminator of DAG-PKC signaling.12 To date, 9 DGK isoenzymes have been identified in mammals. Although our findings suggest that DGK
is a key isoform of DGK to be upregulated by PPAR
activators in human EC, the effect of PPAR
on other isoenzymes needs further investigation. As consequences of the increased DGK activity, PPAR
agonists profoundly attenuated DAG levels and inhibited PKC activation reflected in the decrease of total PKC activities and inhibition of PKC intracellular translocation in the high-glucosetreated EC (Figures 6 and 7
). It was noted that at a concentration as low as 2 µmol/L, the PPAR
agonists induced a 40% increase in DGK activity and a nearly complete inhibition of high-glucoseinduced PKC activity, suggesting an upstream inhibition of the signaling cascades. By contrast, PMA-stimulated PKC activity was not influenced by the PPAR
agonists, supporting the view that PPAR
agonist-induced inhibition of DAG-PKC signaling pathway is initiated by the elevated DGK activity.
Within the family of PKC, at least 7 isoforms represent major downstream targets for DAG, including the conventional and novel PKC subfamilies.8 Among these isoforms PKCß has been shown to be preferentially linked to the pathogenesis of cardiovascular diseases, especially in diabetic vascular complications.11,21 In vascular cells including EC, PKCß can be activated by high glucose or VEGF, known factors that contribute to the development of vascular lesions in diabetes. By using stably EGFP-PKCßtransfected EC, we are able to convincingly show a translocation of PKCß to the plasma membrane in response to high glucose or VEGF stimulation, which was consistent with previous data from membrane fractionation experiments.21,22 Remarkably, either the high-glucoseinduced or the VEGF-induced translocation of PKCß was blocked by the PPAR
agonists (Figure 7). It is interesting to note that VEGF-activated PKC is mediated by DAG generation on PLC
activation,22 whereas high glucose induces DAG production mainly through the de novo synthesis pathway.17 Both sources of DAG-promoted PKC activation were attenuated by the PPAR
agonists, indicating a general broad effect of PPAR
on the termination of DAG-PKC signaling.
It has been recently recognized that PKC is not the only molecular target of DAG. Other proteins, such as RasGRP, Unc-13, protein kinase D, and chimaeras, bear C1 domains that bind to DAG, and these proteins can be activated by DAG.33 However, phosphatidic acid, the product of DAG phosphorylation on DGK activation, has also emerged as a potential second messenger, with several candidate target proteins including Raf-1 kinase, PKC
, phosphatidylinositol 4-phoaphate 5-kinase, and protein tyrosine phosphatases (reviewed in34). Thus, the biological action of the PPAR
agonist-induced DGK activity and DAG attenuation possibly involve various signaling pathways. For instance, PPAR
agonists have been shown to activate PKC
and enhance insulin action in adipocytes.35 Wakino et al have recently reported that PPAR
agonists were capable of increasing protein tyrosine phosphatase activity leading to inhibition of PKC
activation and p21Cip1 turnover in vascular smooth muscle cells.36 It will be of interest to test whether these effects of PPAR
agonists are mediated via the upregulation of DGK resulting in attenuation of DAG and elevated phosphatidic acid levels.
As a transcription factor, PPAR
regulates the expression of numerous genes that are involved in the process of vascular inflammation including cytokines, chemokines, and adhesion molecules.3,4 However, the observed anti-inflammatory effect of PPAR
often vary according to the agonists used and are not always consistent with their capacity to bind to the receptors. Recent studies have suggested an ability of PPAR
to regulate other transcription factors and their signaling, such as NF-
B,31,37 and C/EBP
,38 which could account for the effect of PPAR
on the gene regulation. In this respect, the PPAR
agonist-induced upregulation of DGK and attenuation of DAG-PKC pathway as described in this study demonstrate a novel signaling pathway in coupling PPAR
activators to the inhibition of proinflammatory gene expression, and as such PPAR
agonists may serve as potent anti-inflammatory regents for the prevention and treatment of atherosclerotic diseases and diabetic vascular lesions.
| Acknowledgments |
|---|
antibodies. This study was supported by Juvenile Diabetes Foundation International and National Heart Foundation of Australia (to P.X.). | Footnotes |
|---|
Original received May 22, 2003; resubmission received December 12, 2003; revised resubmission received April 19, 2004; accepted April 20, 2004.
| References |
|---|
|
|
|---|
2. Libby P. Inflammation in atherosclerosis. Nature. 2002; 420: 868874.[CrossRef][Medline] [Order article via Infotrieve]
3. Rosen ED, Spiegelman BM. PPARgamma: a nuclear regulator of metabolism, differentiation, and cell growth. J Biol Chem. 2001; 276: 3773137734.
4. Marx N, Libby P, Plutzky J. Peroxisome proliferator-activated receptors (PPARs) and their role in the vessel wall: possible mediators of cardiovascular risk? J Cardiovasc Risk. 2001; 8: 203210.[CrossRef][Medline] [Order article via Infotrieve]
5. Buchanan TA, Meehan WP, Jeng YY, Yang D, Chan TM, Nadler JL, Scott S, Rude RK, Hsueh WA. Blood pressure lowering by pioglitazone. Evidence for a direct vascular effect. J Clin Invest. 1995; 96: 354360.[Medline] [Order article via Infotrieve]
6. Minamikawa J, Tanaka S, Yamauchi M, Inoue D, Koshiyama H. Potent inhibitory effect of troglitazone on carotid arterial wall thickness in type 2 diabetes. J Clin Endocrinol Metab. 1998; 83: 18181820.
7. Cines DB, Pollak ES, Buck CA, Loscalzo J, Zimmerman GA, McEver RP, Pober JS, Wick TM, Konkle BA, Schwartz BS, Barnathan ES, McCrae KR, Hug BA, Schmidt AM, Stern DM. Endothelial cells in physiology and in the pathophysiology of vascular disorders. Blood. 1998; 91: 35273561.
8. Nishizuka Y. Protein kinase C and lipid signaling for sustained cellular responses. FASEB J. 1995; 9: 484496.[Abstract]
9. King GL, Kunisaki M, Nishio Y, Inoguchi T, Shiba T, Xia P. Biochemical and molecular mechanisms in the development of diabetic vascular complications. Diabetes. 1996; 45 Suppl 3: S105108.
10. Shmueli E, Alberti KG, Record CO. Diacylglycerol/protein kinase C signalling: a mechanism for insulin resistance? J Intern Med. 1993; 234: 397400.[Medline] [Order article via Infotrieve]
11. Ishii H, Jirousek MR, Koya D, Takagi C, Xia P, Clermont A, Bursell SE, Kern TS, Ballas LM, Heath WF, Stramm LE, Feener EP, King GL. Amelioration of vascular dysfunctions in diabetic rats by an oral PKC beta inhibitor. Science. 1996; 272: 728731.[Abstract]
12. Topham MK, Prescott SM. Mammalian diacylglycerol kinases, a family of lipid kinases with signaling functions. J Biol Chem. 1999; 274: 1144711450.
13. Xia P, Gamble JR, Rye KA, Wang L, Hii CS, Cockerill P, Khew-Goodall Y, Bert AG, Barter PJ, Vadas MA. Tumor necrosis factor-alpha induces adhesion molecule expression through the sphingosine kinase pathway. Proc Natl Acad Sci U S A. 1998; 95: 1419614201.
14. Xia P, Kramer RM, King GL. Identification of the mechanism for the inhibition of Na+, K(+)-adenosine triphosphatase by hyperglycemia involving activation of protein kinase C and cytosolic phospholipase A2. J Clin Invest. 1995; 96: 733740.[Medline] [Order article via Infotrieve]
15. Gurnell M, Wentworth JM, Agostini M, Adams M, Collingwood TN, Provenzano C, Browne PO, Rajanayagam O, Burris TP, Schwabe JW, Lazar MA, Chatterjee VK. A dominant-negative peroxisome proliferator-activated receptor gamma (PPARgamma) mutant is a constitutive repressor and inhibits PPARgamma-mediated adipogenesis. J Biol Chem. 2000; 275: 57545759.
16. Tang W, Bunting M, Zimmerman GA, McIntyre TM, Prescott SM. Molecular cloning of a novel human diacylglycerol kinase highly selective for arachidonate-containing substrates. J Biol Chem. 1996; 271: 1023710241.
17. Xia P, Inoguchi T, Kern TS, Engerman RL, Oates PJ, King GL. Characterization of the mechanism for the chronic activation of diacylglycerol-protein kinase C pathway in diabetes and hypergalactosemia. Diabetes. 1994; 43: 11221129.[Abstract]
18. Willson TM, Cobb JE, Cowan DJ, Wiethe RW, Correa ID, Prakash SR, Beck KD, Moore LB, Kliewer SA, Lehmann JM. The structure-activity relationship between peroxisome proliferator-activated receptor gamma agonist and the antihyperglycemic activity of thiazolidinediones. J Med Chem. 1996; 39: 665668.[CrossRef][Medline] [Order article via Infotrieve]
19. Jiang Y, Sakane F, Kanoh H, Walsh JP. Selectivity of the diacylglycerol kinase inhibitor 3-[2-(4-[bis-(4-fluorophenyl)methylene]-1-piperidinyl)ethyl]-2, 3-dihydro-2-thioxo-4(1H)quinazolinone (R59949) among diacylglycerol kinase subtypes. Biochem Pharmacol. 2000; 59: 763772.[CrossRef][Medline] [Order article via Infotrieve]
20. Inoguchi T, Xia P, Kunisaki M, Higashi S, Feener EP, King GL. Insulins effect on protein kinase C and diacylglycerol induced by diabetes and glucose in vascular tissues. Am J Physiol. 1994; 267: E369E379.[Medline] [Order article via Infotrieve]
21. Inoguchi T, Battan R, Handler E, Sportsman JR, Heath W, King GL. Preferential elevation of protein kinase C isoform beta II and diacylglycerol levels in the aorta and heart of diabetic rats: differential reversibility to glycemic control by islet cell transplantation. Proc Natl Acad Sci U S A. 1992; 89: 1105911063.
22. Xia P, Aiello LP, Ishii H, Jiang ZY, Park DJ, Robinson GS, Takagi H, Newsome WP, Jirousek MR, King GL. Characterization of vascular endothelial growth factors effect on the activation of protein kinase C, its isoforms, and endothelial cell growth. J Clin Invest. 1996; 98: 20182026.[Medline] [Order article via Infotrieve]
23. Cybulsky MI, Gimbrone MA Jr. Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis. Science. 1991; 251: 788791.
24. OBrien KD, McDonald TO, Chait A, Allen MD, Alpers CE. Neovascular expression of E-selectin, intercellular adhesion molecule-1, and vascular cell adhesion molecule-1 in human atherosclerosis and their relation to intimal leukocyte content. Circulation. 1996; 93: 672682.
25. Allen S, Khan S, Al Mohanna F, Batten P, Yacoub M. Native low density lipoprotein-induced calcium transients trigger VCAM-1 and E-selectin expression in cultured human vascular endothelial cells. J Clin Invest. 1998; 101: 10641075.[Medline] [Order article via Infotrieve]
26. Xia P, Vadas MA, Rye KA, Barter PJ, Gamble JR. High density lipoproteins (HDL) interrupt the sphingosine kinase signaling pathway. A possible mechanism for protection against atherosclerosis by HDL. J Biol Chem. 1999; 274: 3314333147.
27. Morigi M, Angioletti S, Imberti B, Donadelli R, Micheletti G, Figliuzzi M, Remuzzi A, Zoja C, Remuzzi G. Leukocyte-endothelial interaction is augmented by high glucose concentrations and hyperglycemia in a NF-kB-dependent fashion. J Clin Invest. 1998; 101: 19051915.[Medline] [Order article via Infotrieve]
28. Schmidt AM, Hori O, Chen JX, Li JF, Crandall J, Zhang J, Cao R, Yan SD, Brett J, Stern D. Advanced glycation endproducts interacting with their endothelial receptor induce expression of vascular cell adhesion molecule-1 (VCAM-1) in cultured human endothelial cells and in mice. A potential mechanism for the accelerated vasculopathy of diabetes. J Clin Invest. 1995; 96: 13951403.[Medline] [Order article via Infotrieve]
29. Pasceri V, Wu HD, Willerson JT, Yeh ET. Modulation of vascular inflammation in vitro and in vivo by peroxisome proliferator-activated receptor-gamma activators. Circulation. 2000; 101: 235238.
30. Jackson SM, Parhami F, Xi XP, Berliner JA, Hsueh WA, Law RE, Demer LL. Peroxisome proliferator-activated receptor activators target human endothelial cells to inhibit leukocyte-endothelial cell interaction. Arterioscler Thromb Vasc Biol. 1999; 19: 20942104.
31. Wang N, Verna L, Chen NG, Chen J, Li H, Forman BM, Stemerman MB. Constitutive activation of peroxisome proliferator-activated receptor-gamma suppresses pro-inflammatory adhesion molecules in human vascular endothelial cells. J Biol Chem. 2002; 277: 3417634181.
32. Sanjuan MA, Jones DR, Izquierdo M, Merida I. Role of diacylglycerol kinase alpha in the attenuation of receptor signaling. J Cell Biol. 2001; 153: 207220.
33. Ron D, Kazanietz MG. New insights into the regulation of protein kinase C and novel phorbol ester receptors. FASEB J. 1999; 13: 16581676.
34. van Blitterswijk WJ, Houssa B. Properties and functions of diacylglycerol kinases. Cell Signal. 2000; 12: 595605.[CrossRef][Medline] [Order article via Infotrieve]
35. Kanoh Y, Bandyopadhyay G, Sajan MP, Standaert ML, Farese RV. Thiazolidinedione treatment enhances insulin effects on protein kinase C-zeta/lambda activation and glucose transport in adipocytes of nondiabetic and Goto-Kakizaki type II diabetic rats. J Biol Chem. 2000; 275: 1669016696.
36. Wakino S, Kintscher U, Liu Z, Kim S, Yin F, Ohba M, Kuroki T, Schonthal AH, Hsueh WA, Law RE. Peroxisome proliferator-activated receptor gamma ligands inhibit mitogenic induction of p21(Cip1) by modulating the protein kinase Cdelta pathway in vascular smooth muscle cells. J Biol Chem. 2001; 276: 4765047657.
37. Straus DS, Pascual G, Li M, Welch JS, Ricote M, Hsiang CH, Sengchanthalangsy LL, Ghosh G, Glass CK. 15-deoxy-delta 12,14-prostaglandin J2 inhibits multiple steps in the NF-kappa B signaling pathway. Proc Natl Acad Sci U S A. 2000; 97: 48444849.
38. Takata Y, Kitami Y, Yang ZH, Nakamura M, Okura T, Hiwada K. Vascular inflammation is negatively autoregulated by interaction between CCAAT/enhancer-binding protein-delta and peroxisome proliferator-activated receptor-gamma. Circ Res. 2002; 91: 427433.
This article has been cited by other articles:
![]() |
M. Ingbir, I. F. Schwartz, A. Shtabsky, I. Filip, R. Reshef, T. Chernichovski, N. Levin-Iaina, U. Rozovski, Y. Levo, and D. Schwartz Rosiglitazone improves aortic arginine transport, through inhibition of PKC{alpha}, in uremic rats Am J Physiol Renal Physiol, August 1, 2008; 295(2): F471 - F477. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Alibin, M. A. Kopilas, and H. D. I. Anderson Suppression of Cardiac Myocyte Hypertrophy by Conjugated Linoleic Acid: ROLE OF PEROXISOME PROLIFERATOR-ACTIVATED RECEPTORS {alpha} AND {gamma} J. Biol. Chem., April 18, 2008; 283(16): 10707 - 10715. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Z. Duan, M. G. Usher, and R. M. Mortensen Peroxisome Proliferator-Activated Receptor-{gamma}-Mediated Effects in the Vasculature Circ. Res., February 15, 2008; 102(3): 283 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ceolotto, A. Gallo, I. Papparella, L. Franco, E. Murphy, E. Iori, E. Pagnin, G. P. Fadini, M. Albiero, A. Semplicini, et al. Rosiglitazone Reduces Glucose-Induced Oxidative Stress Mediated by NAD(P)H Oxidase via AMPK-Dependent Mechanism Arterioscler. Thromb. Vasc. Biol., December 1, 2007; 27(12): 2627 - 2633. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wadham, A. Parker, L. Wang, and P. Xia High Glucose Attenuates Protein S-Nitrosylation in Endothelial Cells: Role of Oxidative Stress Diabetes, November 1, 2007; 56(11): 2715 - 2721. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ptasinska, S. Wang, J. Zhang, R. A. Wesley, and R. L. Danner Nitric oxide activation of peroxisome proliferator-activated receptor gamma through a p38 MAPK signaling pathway FASEB J, March 1, 2007; 21(3): 950 - 961. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Qi and B. Rodrigues Glucocorticoids produce whole body insulin resistance with changes in cardiac metabolism Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E654 - E667. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. von Knethen, M. Soller, N. Tzieply, A. Weigert, A. M. Johann, C. Jennewein, R. Kohl, and B. Brune PPAR{gamma}1 attenuates cytosol to membrane translocation of PKC{alpha} to desensitize monocytes/macrophages J. Cell Biol., February 26, 2007; 176(5): 681 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Subramanian, P. Krishnamurthy, K. Singh, and M. Singh Lack of osteopontin improves cardiac function in streptozotocin-induced diabetic mice Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H673 - H683. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kohl, S. Preiss, A. von Knethen, and B. Brune Oxidized low-density lipoprotein depletes PKC{alpha} and attenuates reactive oxygen species formation in monocytes/macrophages Cardiovasc Res, August 1, 2006; 71(3): 574 - 585. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Alfranca, M. A. Iniguez, M. Fresno, and J. M. Redondo Prostanoid signal transduction and gene expression in the endothelium: Role in cardiovascular diseases Cardiovasc Res, June 1, 2006; 70(3): 446 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Arimoto, Y. Takeishi, H. Takahashi, T. Shishido, T. Niizeki, Y. Koyama, R. Shiga, N. Nozaki, O. Nakajima, K. Nishimaru, et al. Cardiac-Specific Overexpression of Diacylglycerol Kinase {zeta} Prevents Gq Protein-Coupled Receptor Agonist-Induced Cardiac Hypertrophy in Transgenic Mice Circulation, January 3, 2006; 113(1): 60 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, X.-P. Xing, A. Holmes, C. Wadham, J. R. Gamble, M. A. Vadas, and P. Xia Activation of the Sphingosine Kinase-Signaling Pathway by High Glucose Mediates the Proinflammatory Phenotype of Endothelial Cells Circ. Res., October 28, 2005; 97(9): 891 - 899. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Fukunaga-Takenaka, Y. Shirai, K. Yagi, N. Adachi, N. Sakai, E. Merino, I. Merida, and N. Saito Importance of chroman ring and tyrosine phosphorylation in the subtype-specific translocation and activation of diacylglycerol kinase {alpha} by D-{alpha}-tocopherol Genes Cells, April 1, 2005; 10(4): 311 - 319. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takahashi, Y. Takeishi, T. Seidler, T. Arimoto, H. Akiyama, Y. Hozumi, Y. Koyama, T. Shishido, Y. Tsunoda, T. Niizeki, et al. Adenovirus-Mediated Overexpression of Diacylglycerol Kinase-{zeta} Inhibits Endothelin-1-Induced Cardiomyocyte Hypertrophy Circulation, March 29, 2005; 111(12): 1510 - 1516. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rask-Madsen and G. L. King Proatherosclerotic Mechanisms Involving Protein Kinase C in Diabetes and Insulin Resistance Arterioscler. Thromb. Vasc. Biol., March 1, 2005; 25(3): 487 - 496. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |