© 2004 American Heart Association, Inc.
Letters to the Editor |
Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand
Christchurch Cardioendocrine Research Group, Department of Medicine, Christchurch School of Medicine, and Health Sciences, Christchurch, New Zealand, barry.palmer{at}chmeds.ac.nz
Division of Receptor Biology, Advanced Medical Research Center, Nihon University School of Medicine, Tokyo, Japan
To the Editor:
Nakayama et al1 have described an interesting polymorphism in the NPR-A gene in a Japanese population. An 8-nucleotide deletion in the 5' untranslated region (UTR) of the gene was found to be associated with essential hypertension and left ventricular hypertrophy in a study of 200 hypertensive (HT) and 200 normotensive (NT) subjects. The polymorphism occurred at a frequency of 4% in the HT patients and in a single NT subject (0.5%) who was subsequently found to have left ventricular hypertrophy. Carriers of the functional deletion (D) allele had higher plasma BNP levels, a strong marker of cardiac stress, than those with the wild-type allele. Expression of NPR-A from the D allele was reduced compared with the wild-type allele and it is suggested that the deletion interferes with binding of regulatory factors to the 5' UTR of the gene.1
We screened 498 patients from the Christchurch Post-Myocardial Infarction (PMI) Study2–4 who had acute myocardial infarction for the NPR-A D allele. DNA samples were amplified using the polymerase chain reaction primers hNPR-Af 5'acgcgcctgatgcctgggac3' and hNPR-Ar 5'cagtaccacggctaccgtcaggtt3' and the wild-type (I) and D amplimers (216 and 208 bp, respectively) were resolved on 3% agarose, 0.5 x TBE gels and visualized using ethidium bromide and a Bio-Rad Fluor-S imaging system (Hercules, Calif). Patient DNA samples with (n=3) and without (n=3) the functional deletion from the Japanese study were used as controls.1 The New Zealand patients were 75% male, with a mean age of 62.4 (±0.5) years, 15.0% had a history of previous myocardial infarction, 52.0% had or were being treated for hypertension, 60.4% were past or present smokers, 11.4% had diabetes, 1.6% had had congestive heart failure, 52.7% were being treated with ß-blockers, and 31.7% were being treated with an angiotensin-converting enzyme inhibitor; 83.3% were of European ethnicity, 3.8% Maori, 1.2% other (Indian, Middle Eastern, Pacific Islanders), and 11.7% not stated.
None of the 498 New Zealand patients carried the NPR-A D allele. However, patient DNA samples with the functional deletion mutation from the original Japanese study1 were positive in our assay, indicating that any positive samples in our New Zealand sample population would have been detected had they been present. The upper 95% confidence limit for the prevalence of carriers of the D allele is 0.60% in this PMI patient cohort.
These findings suggest that this functional deletion polymorphism is rare outside Japanese populations. This conclusion is supported by the report of Knowles et al,5 who studied the structure of the entire NPR-A gene from 34 unrelated individuals of black, white, and unknown ethnicities, finding 10 polymorphic sites in noncoding regions of the gene, but not the 5' UTR 8 bp I/D polymorphism.
References
1. Nakayama T, Soma M, Takahashi Y, Rehemudula D, Kanmatsuse K, Furuya K. Functional deletion mutation of the 5'-flanking region of type A human natriuretic peptide receptor gene and its association with essential hypertension and left ventricular hypertrophy in the Japanese. Circ Res. 2000; 86: 841–845.
2. Richards AM, Nicholls MG, Yandle TG, Frampton C, Espiner EA, Turner JG, Buttimore RC, Lainchbury JG, Elliott JM, Ikram H, Crozier IG, Smyth DW. Plasma N-terminal pro-brain natriuretic peptide and adrenomedullin: new neurohormonal predictors of left ventricular function and prognosis after myocardial infarction. Circulation. 1998; 97: 1921–1929.
3. Palmer B, Pilbrow A, Frampton C, Yandle T, Nicholls M, Richards A, Cameron V. ACE gene polymorphism interacts with LVEF and BNP levels to predict mortality following myocardial infarction. J Am Coll Cardiol. 2003; 41: 729–736.
4. Richards AM, Nicholls MG, Espiner EA, Lainchbury JG, Troughton RW, Elliott J, Frampton C, Turner J, Crozier IG, Yandle TG. B-type natriuretic peptides and ejection fraction for prognosis after myocardial infarction. Circulation. 2003; 107: 2786–2792.
5. Knowles JW, Erickson LM, Guy VK, Sigel CS, Wilder JC, Maeda N. Common variations in noncoding regions of the human natriuretic peptide receptor A gene have quantitative effects. Hum Genet. 2003; 112: 62–70.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  C. Vassalle and M. G. Andreassi Genetic Polymorphisms of the Natriuretic Peptide System in the Pathogenesis of Cardiovascular Disease: What Lies on the Horizon? Clin. Chem., May 1, 2009; 55(5): 878 - 887. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||