This Article Abstract Full Text (PDF) All Versions of this Article: 94/10/1318    most recent 01.RES.0000129182.46440.4av1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, L. Articles by Kruger, W. D. Search for Related Content PubMed PubMed Citation Articles by Wang, L. Articles by Kruger, W. D. Related Collections Animal models of human disease

(Circulation Research. 2004;94:1318.)
© 2004 American Heart Association, Inc.

Molecular Medicine

Modulation of Cystathionine ß-Synthase Level Regulates Total Serum Homocysteine in Mice

Liqun Wang, Kwang-Hwan Jhee, Xiang Hua, Patricia M. DiBello, Donald W. Jacobsen, Warren D. Kruger

From the Division of Population Science (L.W., K.H.J., X.H., W.D.K.), Fox Chase Cancer Center, Philadelphia, Pa; and the Department of Cell Biology (P.M.D., D.W.J.), Lerner Research Center, Cleveland Clinic Foundation, Ohio. The present address for K.H.J. is the Department of Applied Chemistry, Kumoh National Institute of Technology, Korea.

Correspondence to Warren D. Kruger, Fox Chase Cancer Center, 333 Cottman Ave, Philadelphia, PA 19111. E-mail warren.kruger{at}fccc.edu

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Elevated total plasma homocysteine is an independent risk factor in the development of vascular disease in humans. Cystathionine ß-synthase (CBS) is an enzyme that condenses homocysteine with serine to form cystathionine. In this article, we describe the effects of modulating CBS activity using a transgenic mouse that contains the human CBS cDNA under control of the zinc-inducible metallothionein promoter (Tg-CBS). In the presence of zinc, Tg-CBS mice have a 2- to 4-fold increase in liver and kidney CBS activity compared with nontransgenic littermates. Transgenic mice on standard mouse chow had a 45% decrease in their serum homocysteine (12.1 to 7.2 µmol/L; P<0.0001) when zinc was added to drinking water, although zinc had minimal effect on their nontransgenic siblings (13.2 µmol/L versus 13.0 µmol/L; P=NS). Tg-CBS mice maintained on a high-methionine, low-folate diet also had significantly lower serum homocysteine compared with control animals (179 µmol/L versus 242 µmol/L; P<0.02). CBS overexpression also significantly lowered serum cysteinylglycine (3.6 versus 2.8 µmol/L; P<0.003) levels and reduced the levels of many amino acids in the liver. We also found that expression of Tg-CBS rescued the severe hyperhomocysteinemia and neonatal lethality of Cbs deletion animals. Our results show that elevating CBS activity is an effective method to lower plasma homocysteine levels. In addition, the creation of an inducible mouse system to modulate plasma homocysteine will also be useful in the study of homocysteine-related vascular disease.

Key Words: metabolism • genetics • amino acids • cardiovascular diseases

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
In the past decade, elevated plasma total homocysteine (tHcy) has emerged as an important risk factor for the development of vascular disease. More than 80 clinical and epidemiological studies, including more than 10 000 patients, have established tHcy as a risk factor for disease of the coronary, cerebral, and peripheral arteries, and for arterial and venous thromboembolism.¹ Elevated tHcy is a graded risk factor with no threshold and is independent of other known risk factors.² Analysis of prospective studies suggests that elevated tHcy accounts for a significant fraction of coronary artery disease and stroke in the general population.^3–5

Emerging evidence indicates that elevated tHcy is not simply a marker for vascular disease, but actually has pathological effects on vascular endothelium. Monkeys and mice with elevated tHcy levels caused by diet or mutations have impaired vascular endothelium characterized by abnormal vasodilator properties.^6,7 Elevated tHcy has also been shown to cause oxidative stress by inhibition of NO, resulting in lower intracellular glutathione (GSH) pools in endothelial cells.⁸ Finally, elevated homocysteine in both cell culture and in livers has been shown to stimulate the unfolded protein response, leading to activation and dysregulation of the sterol response pathway and apoptosis in vascular endothelium.^9,10

Because of the link between tHcy and vascular disease, there has been much interest in strategies to lower tHcy. Several studies have shown that folic acid and multivitamin supplementation can lower plasma homocysteine.^11,12 In fact, as a result of the fortification of grain with folic acid in the United States, there has been a 50% decrease in the number of individuals with elevated tHcy concentrations (>13 µmol/L) in the general population.¹³ However, not all individuals respond to vitamin therapy. In a study of 304 individuals, it was found that 20% actually had elevations in plasma homocysteine levels after 3 weeks of folic acid supplementation,¹⁴ which correlated with the status of single-nucleotide polymorphisms in the cystathionine ß-synthase (Cbs) gene.¹⁵ It has also been observed that end-stage renal disease patients as a group have extremely elevated plasma homocysteine despite vitamin therapy.¹⁶ Thus, there is a need for additional strategies to lower plasma homocysteine.

Homocysteine has 2 possible metabolic fates: remethylation to form methionine or transsulfuration to form cystathionine (Figure 1). The transsulfuration reaction is performed by the enzyme cystathionine ß-synthase (CBS). This enzyme condenses homocysteine with serine to form cystathionine and requires pyridoxine (vitamin B₆) as a cofactor. Previous work has shown that it is possible to increase the activity of human CBS (hCBS) by deletion or mutation of the C-terminal regulatory domain.^17–19 These findings suggest that it may be possible to identify drugs that bind to the C-terminal domain and increase CBS activity.

View larger version (29K): [in this window] [in a new window]   Figure 1. A, Methionine metabolism in mammals. The methionine recycling and transsulfuration pathways are shown. B, Schematic of the Tg-CBS construct used in this study. The regulatory and coding sequences are indicated by the arrows. ORF indicates hCBS open reading frame.

The rationale for pursuing drugs that activate CBS would be enhanced by showing that elevated CBS activity can result in a lowering of plasma homocysteine in vivo. To address this question, we have created a transgenic mouse model that overexpresses CBS in an inducible manner. Our results show that CBS overexpression can lower plasma homocysteine levels in mammals.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Hemagglutinin-Tagged hCBS
A hemagglutinin (HA) epitope tagged version of hCBS was created as follows. Primers HA CBS (5'-ATGTACCCATACGATGTTCC- AGATTACGCTCCTTCTGAGACCCCC-3') and WK90 (5'-TTACCAATCACGCGTGTGTTTAGGGC-3') were used to polymerase chain reaction (PCR)-amplify hCBS using pHCBS²⁰ as template. The resulting PCR product contains the HA epitope (YPYDVPDYA) fused in frame to the second amino acid of hCBS. The PCR product was then cloned into PCR-cloning vector PCR 2.1 (Invitrogen) to create pCR2.1::hCBS. To test the epitope-tagged version of the protein for function, pCR2.1::hCBS was digested with EcoR1 and cloned into the EcoRI site pYEPXB.²⁰ This plasmid was then introduced in yeast-lacking endogenous CBS and tested for function by examining growth on media lacking cysteine as previously described.²⁰

Transgene Construct
The parent plasmid was MT-LCR expression vector 2999 obtained from Richard Palmiter²¹ (University of Washington, Seattle). This vector contains 814 bp of the mouse MT-I (mMT-I) promoter fused via an NruI linker to 650 bp of the human growth hormone (hGH) 3' untranslated region and polyadenylation signal on an EcoRI cassette. Flanking this cassette are 10 kb of the mMT-I 5' hypersensitive site and 7 kb of the 3' hypersensitive site. Unique SalI sites flank the mouse sequences and can be used to remove the Bluescript-based vector sequences.

Because we had difficulties cloning directly into the NruI site on this large plasmid, we used the following strategy. We digested 2999 with EcoRI and isolated a 1.4-kb fragment containing 814 bp of the MT-I promoter, the NruI cloning site, and 650 bp of the hGH 3' untranslated region. This fragment was then inserted into the EcoRI site of pUC18. To make cloning easier, we modified the plasmid by converting the NruI site to MfeI by inserting a linker (GCAATTGC). The resultant plasmid was dubbed pUC:MT-I:MfeI.

PCR2.1::hCBS was digested with EcoRI and the hCBS fragment was then cloned into the MfeI site of pUC:MT-I:MfeI, creating pLW1. To create a better translation initiation environment, pLW1 was further modified by site-directed mutagenesis to convert the –3 position nucleotide from C to A, creating pLW2. PLW2 was then digested with EcoRI, and this fragment was then cloned into 2999 digested with EcoRI to create pLW3.

Production and Screening of Transgenic Mice
PLW3 was digested with SalI, to drop out bacterial vector sequences, and the mouse-human sequences were isolated using Qiax II Gel Extraction Kit (Qiagen). The recovered DNA was then further purified by extraction 3x with phenol/chloroform and ethanol precipitation. DNA was resuspended in 10 mmol/L Tris, 0.1 mmol/L EDTA, pH 7.3, at 20 ng/mL.

The purified transgene DNA fragment was microinjected into pronuclei of day 0.5 C57B6/C3H F2 embryos from C57B6/C3H F1xC57B6C3H F1 matings. Injected embryos were implanted into the oviducts of day 0.5 pseudopregnant female Swiss Webster mice. Tails from the resulting pups were clipped 2 weeks after birth for genotype analysis. Presence of the transgene was confirmed by PCR amplification with primers 5'AAGAGTTCGGCCTCAAGTGTGAG3' and 5'ATGTAGTTCCGCA-CTGAGTCGGGCAGAATG3', which amplify an 858-bp fragment of human CBS. DNA-positive founders were then crossed to C57B6 animals, and these pups were analyzed for germline transmission of the transgene and were tested for transgene expression as described in Figure 2.

View larger version (38K): [in this window] [in a new window]   Figure 2. A, Zinc (Zn) regulation of Tg-CBS mice. Offspring 4- to 6-weeks old of the indicated founder mice were fed either normal water or water containing 25 mmol/L ZnSO4 for 10 days, after which their livers and kidneys were harvested and total protein was isolated. HA-tagged hCBS (HAhCBS) and endogenous mCBS were detected by immunoblot analysis using anti-human CBS antibody. B, Homogenous expression of HAhCBS. Mice derived from the indicated founders were backcrossed to C57B6 for 3 generations, put on ZnSO4 water, and then had their livers, and in some cases kidneys, harvested and analyzed for CBS expression by immunoblot.

B6.129P2-Cbs ^tm1Unc mice were obtained from the Jackson Laboratory (Bar Harbor, ME). Genotyping for the Cbs^tm1Unc allele was performed using a 3 primer PCR system developed by the Loscalzo Laboratory. The primers used were 5'GGTCTGGAATTCACTATGTAGC3' (forward primer, intron 2), 5'CGGATGACCTGCATTCATCT3' (reverse primer, intron2), and 5'GAGGTCGACGGTATCGATA3' (reverse primer, neo linker). The wild-type allele gives a 300-bp product, whereas the deletion allele gives a 176-bp band product.

Mouse Diets
Mice were fed either the Fox Chase Cancer Center animal facility standard rodent chow (LabDiet 5013) or a special high-methionine, low-folate diet from Harlan Teklad (TD98272) for hyperhomocysteinemia-inducing experiments. This diet contains 5x more methionine (20 g/kg versus 4.1 g/kg) and three-quarters the amount of folate (1.5 mg/kg versus 2.0 mg/kg) per kilogram compared with the standard rodent chow. For transgene induction, ZnSO₄ was added to the water at a concentration of 25 mmol/L.

Immunoblot, Enzyme Analysis, and Amino Acid Analysis of Liver
Mice were euthanized with CO₂, and livers and kidney were harvested and immediately put on ice. The liver was homogenized using a dounce homogenizer in extract buffer [50 mmol/L Tris-HCl, pH 7.8, 25 mmol/L NaCl], to which a protease inhibitor pill (Complete-Mini, Roche) was added. Extracts were then centrifuged at 12 000g at 4°C and the supernatant was retained. Protein concentration was determined by the coomassie blue protein assay reagent (Pierce) using BSA as a standard. For Western blot analysis, 25 µg of extract were run on precast 7% NuPage Tris-acetate sodium dodecyl sulfate gel (Invitrogen) and transferred to polyvinylidene difluoride membrane as described.²² Samples were probed with a 1/5000 dilution of rabbit anti-hCBS serum.¹⁷ Secondary antibody was anti-rabbit IgG coupled to horseradish peroxidase (Amersham). The antibody-antigen complex was visualized on photographic film after treatment with SuperSignal West Dura Extended Duration Substrate (Pierce).

CBS enzyme activity was measured using a Biochrom 30 amino acid analyzer to measure cystathionine formation. Reactions containing 100 µg of liver extract, 100 mmol/L Na-N,N-bis(2-hydroxyethyl)glycine (pH 8.6), 50 µmol/L pyridoxal phosphate, 5 mmol/L serine, 200 µmol/L S-adenosylmethionine, and 5 mmol/LL-homocysteine in a 50 µL volume were incubated for 1 hour at 37°C. Units are expressed as nanomoles cystathionine/mg per hour.

Amino acid pools were analyzed by reducing 300 µg of total liver homogenates with 12% dithiothreitol and then extracting with an equal volume of 10% sulfosalicylic acid followed by centrifugation. The supernatant was then analyzed on a Biochrom 30 amino acid analyzer. Peaks were identified and quantitated by comparing to a known standard.

Serum Thiol Determinations
Mice were bled from the eye socket in a standard Eppendorf tube and immediately put on ice. The samples were then centrifuged at 4°C at 12 000g for 5 minutes and the serum fraction was collected. A total of 25 µL of serum was then analyzed for tHcy, cysteine, cysteinyl-glycine, and GSH levels as described previously,²³ except that the fluorescent thiol-bimane conjugates were resolved on a Luna 5µ C18(2) column (4.6x150 mm) (Phenomenex) using a System 1100 high-performance liquid chromatography-FD (Agilent). In the experiments described in Figure 5, serum homocysteine was measured using a Biochrom 30 amino acid analyzer.

View larger version (23K): [in this window] [in a new window]   Figure 5. tHcy of Tg-CBS Cbstm1Unc /Cbstm1Unc animals with (Zn) and without (–Zn) zinc. Tg-CBS Cbstm1Unc /Cbstm1Unc animals between 2 and 8 months of age on ZnSO4 water had serum collected and were then shifted to regular water for 2 weeks, at which time serum was collected again. All of the animals were derived from founder 25. The squares connected by the filled in lines represent the male animals, whereas the circles connected by the dotted lines represent the female animals.

Statistics
Statistical analysis was done using Statistica for Macintosh (StatSoft). Reported significance values from t tests were all 2-sided.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Transgene Characterization
We constructed a plasmid containing the human CBS cDNA driven by the mMT promoter (Figure 1B). The MT promoter (mMT-I) was chosen because its expression can be regulated by addition of zinc to drinking water, and it is expressed in high levels in liver and kidney, mirroring endogenous CBS expression.²⁴ The HA epitope tag was inserted in the N-terminus of CBS to distinguish between endogenous mouse CBS (mCBS) and the hCBS proteins. Our construct also contained the 5' and 3' LCR of mMT-I to help minimize expression differences attributable to different sites of integration.²¹ From 200 injected C57B6/C3H hybrid embryos implanted into pseudopregnant females, we obtained 35 offspring, of which 6 contained the human CBS transgene. Three of the 6 animals transmitted the transgene to 50% of their offspring. These 3 independent transgene lines were designated 2, 21, and 25.

Initially, we examined expression of the transgene in liver and kidney. Mice from each line were either given regular water or water containing 25 mmol/L ZnSO₄ to induce the MT-I promoter. Livers and kidneys were harvested after 10 days on ZnSO₄, and CBS levels were examined by Western blot using anti-human CBS antiserum. As shown in Figure 2A, the human transgene is tightly regulated by zinc in both the liver and kidney in all 3 lines. In the liver, the presence of zinc results in a large increase in hCBS levels but does not affect the levels of mCBS. In the kidney, zinc induces both the transgene and the endogenous mouse gene. We confirmed that the upper band was HA-tagged hCBS by Western blot with an anti-HA antibody (data not shown). We also performed Western analysis on extracts derived from a variety of other mouse tissues, including brain, skeletal muscle, spleen, lungs, colon, stomach, and adenoids. The only tissues that expressed detectable levels of hCBS were the stomach and colon. This is consistent with previously published expression patterns of transgenes being expressed from the MT-I promoter.²¹

Initially, we saw some variation in hCBS expression between sibling animals within the same line and also between lines (data not shown). However, after 2 generations of backcrossing with C57B6 animals, this variability was greatly reduced (Figure 2B). Thus, the initial variability was probably a result of the segregating genetic background of the hybrid crosses. After backcrossing, expression levels were very similar among the 3 different lines, suggesting that the LCRs were quite effective in controlling position effects on transcription.

We also measured CBS enzyme activity in liver and kidney extracts from transgenic (Tg)–CBS animals and nontransgenic littermates (Table 1). We found that in the absence of zinc, there was no difference in CBS activity levels between transgenic and nontransgenic animals in either the liver or kidney. In the liver, the mean activity of the zinc-treated transgenic animals was 2.2-fold higher than the zinc-treated nontransgenic control animals (2472 U versus 1115; P=0.016). In the kidney, there was 3.5-fold elevation in CBS activity between transgenic and nontransgenic animals (935 U versus 260; P=0.007). We also confirmed that zinc elevates endogenous mouse CBS in the kidney (107 U versus 260 U; P=0.002).

View this table: [in this window] [in a new window]   Table 1. CBS Enzyme Activity

Effects of CBS Overexpression
We next examined how CBS overexpression affects the levels of tHcy and other thiols in transgenic and control animals. We collected serum from 16 transgenic animals and 17 nontransgenic littermates on standard mouse chow and zinc-containing water, which induces MT-controlled hCBS activity. We then shifted these animals to normal water for 2 weeks and re-bled them. Serum was analyzed for tHcy, GSH, cysteine, and cysteinyl-glycine (Figure 3). The mean tHcy (±SEM) for the nontransgenic control animals was 13.0±1.1 µmol/L for animals on normal water and 13.2±1.0 µmol/L on zinc-containing water (paired t test; P=0.99). For the transgenic animals, tHcy was 12±0.7 µmol/L in the absence of zinc but decreased 45% when the animals were put on zinc water (7.2±0.3 µmol/L; paired t test; P<0.000003). Comparing the tHcy levels between zinc-treated control and zinc-treated transgenic animals, there was also a highly significant difference (13.2 versus 7.2 µmol/L; unpaired t test; P<0.0001). We did not observe any difference in the levels of serum GSH between transgenic and nontransgenic animals, although the addition of zinc to the water did lower GSH levels significantly in both control and transgenic animals. Both serum cysteine and cysteinyl-glycine levels were lower in the zinc-treated transgenic animals compared with identically treated control animals, although only in cysteinyl-glycine levels were changes statistically significant (3.6 versus 2.8 µmol/L; P=0.003). Addition of zinc had no effect on either serum cysteine or cysteinyl-glycine levels in control animals. These results show that CBS overexpression can significantly lower serum homocysteine.

View larger version (58K): [in this window] [in a new window]   Figure 3. Thiol-containing compounds in mouse serum. Serum from transgenic mice (n=16) and littermate controls (n=17) was collected before and after withdrawal of ZnSO4 from drinking water and analyzed for the indicated metabolites. A, Total homocysteine. B, Glutathione. C, Total plasma cysteine. D, Cysteinyl-glycine. The mice were both sex- and age-matched with an age range of 13 to 28 weeks in both groups. Eight of the transgenic mice are derived from founder 25, 5 from founder 21, and 4 from founder 2 after at least 3 generations of back-crossing. The error bars indicate the 95% confidence interval for each measurement. Brackets indicate significant differences between the transgenic and nontransgenic animals.

We also examined how CBS overexpression affected tHcy in mice that had abnormally elevated tHcy caused by dietary intervention. Sixteen control and 12 transgenic mice were put on mouse chow containing 5x the level of methionine and 25% less folate than the standard mouse chow in the presence of zinc water. After 3 weeks on this chow, blood was collected and analyzed for tHcy, GSH, cysteine, and cysteinyl-glycine (Figure 4). Total serum homocysteine was 23% lower in the CBS-overexpressing animals compared with control animals (179 versus 242 µmol/L; P<0.02), indicating that elevated CBS activity could help alleviate homocysteine elevations caused by abnormal diet. We did not see any effect of CBS overexpression on GSH or cysteine levels, although cysteinyl-glycine was reduced in CBS-overexpressing animals compared with controls.

View larger version (58K): [in this window] [in a new window]   Figure 4. Thiol-containing compounds in mouse serum from mice on a high-methionine, low-folate diet. Transgenic animals (n=12) and littermate control animals (n=16) were fed a high-methionine, low-folate diet for 4 weeks with ZnSO4 water, and then serum was collected and analyzed. Eight of the transgenic mice are derived from founder 25, 1 from founder 21, and 3 from founder 2 after at least 3 generations of back-crossing. The error bars indicate the 95% confidence interval for each measurement. Brackets indicate significant differences between the transgenic and nontransgenic animals. C-G, cysteinyl-glycine.

At the completion of this experiment, we euthanized 6 transgenic animals and 6 nontransgenic littermates and examined free amino acid pools in total liver homogenates (Table 2) using an amino acid analyzer. The amino acids present at detectable levels were threonine, serine, asparagines, glutamine, glutamic acid, glycine, alanine, valine, homocysteine, methionine, cystathionine, isoleucine, leucine, tyrosine, phenylalanine, lysine, histidine, cysteine, ornithine, glutathionine, urea, taurine, phosphoserine, and -butyric acid. Statistically significant differences were observed in the levels of phenylalanine, valine, leucine, asparagine, isoleucine, -aminobutyrate, and ammonia. In all cases, the pools of these amino acids were low in the transgenic compared with the control animals. Interestingly, none of the changed amino acids were part of the methionine or cysteine metabolic pathway. This suggests that the control of amino acid homeostasis in the liver is extremely complex.

View this table: [in this window] [in a new window]   Table 2. CBS Transgene Effect on Liver Amino Acid Pools

Tg-CBS Rescues Cbs^tm1Unc Animals
Watanabe et al created a knockout allele for CBS (Cbs^tm1Unc) and found that animals homozygous for this allele showed severe homocysteinemia and growth retardation and rarely survived beyond 6 weeks.²⁵ We confirmed these findings in our own colony of Cbs^tm1Unc mice. We found that at the time of genotyping (aged 4 to 6 weeks), only 2 of 258 offspring of Cbs/ Cbs^tm1UncxCbs/Cbs^tm1Unc mating were homozygous for Cbs^tm1Unc. To determine whether our transgene could rescue these effects, we mated our Tg-CBS animals to animals Cbs/ Cbs^tm1Unc and obtained Tg-CBS Cbs/ Cbs^tm1Unc offspring. These animals were then put on zinc water and backcrossed to Cbs/Cbs^tm1Unc mice. Our belief was that if the transgene rescued lethality, we would expect approximately one-eighth (12.5%) of the offspring to be both homozygous for Cbs^tm1Unc and hemizygous for the transgene. Furthermore, we would also expect to see significantly more viable homozygous animals with the transgene than without the transgene. Of 182 offspring born, 21 were homozygous for the knockout allele, and of these, 18 also contained the transgene (9.9% of the total). These results show that the transgene is able to rescue the lethality associated with homozygosity for Cbs^tm1Unc.

We also examined tHcy levels in all 18 Tg-CBS Cbs^tm1Unc/Cbs^tm1Unc animals in both the presence and absence of induction by zinc. As shown in Figure 5, tHcy was significantly elevated when mice were switched from zinc-containing to nonzinc-containing water. The mean tHcy went from 67.3 µmol/L to 190.37 µmol/L (P=0.000015; n=18). Interestingly, we saw a greater effect in female animals than in male animals. In females, mean tHcy increased from 25 µmol/L to 231 µmol/L (P=0.0000078; n=7), whereas in males, tHcy went from 93 µmol/L to 179 µmol/L (P=0.0005; n=11). We hypothesize that the relatively high levels of tHcy observed in the presence of zinc in some animals (especially males) may be attributable to attenuation of zinc response because of the prolonged exposure to zinc. However, despite this possibility, approximately one-third of all the animals had tHcy within the normal range when on zinc and extreme elevations in tHcy when zinc was removed. In summary, our results show that using the Tg-CBS, it is possible to obtain healthy adult animals with extremely elevated tHcy.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Despite the identification of plasma homocysteine as an independent risk factor for vascular disease and of CBS as a key enzyme in homocysteine catabolism, the in vivo feasibility of reducing tHcy by elevating CBS activity was unknown. On the basis of the enzymatic kinetics of CBS and the other enzymes in the pathway, it was unclear that CBS activity would be rate limiting for the clearance of homocysteine. The K_m of CBS for homocysteine is estimated to be 5 mmol/L, whereas the K_m for both methionine synthase and betaine-dependent homocysteine methyltransferase are in the low micromolar range.^26–28 This has led to the view that CBS activity was used only in situations in which there was "homocysteine" overload, such as immediately after a methionine-loaded meal.²⁹ However, we observed that overexpression of CBS lowered plasma homocysteine effectively when animals were maintained on a standard diet. This suggests that even under normal dietary conditions, methionine synthase and betaine-dependent homocysteine methyltransferase are not able to convert homocysteine to methionine fast enough to prevent a substantial buildup of homocysteine to the point at which it could be used by CBS as a substrate. The fact that the percentage lowering was worse in the high methionine diet suggests that under extreme conditions, it may be possible to saturate the transsulfuration pathway such that overexpression of CBS is less effective. Our results are also consistent with work showing that children with Down Syndrome caused by a third copy of chromosome 21 have lower tHcy compared with sibling controls.³⁰

A priori, it might be expected that elevating CBS activity would raise the levels of other serum thiols because they all contain cysteine, which is downstream of CBS. Thus, it was somewhat surprising that neither GSH nor cysteine levels changed significantly in the transgenic animals. Even more unexpected was the fact that serum cysteinyl-glycine levels actually fell in response to elevated CBS activity. This occurred in both animals on a regular diet and on a high-methionine, low-folate diet, suggesting that this observation was not an artifact. Unlike our observation in mice, the decreased tHcy in children with Down Syndrome was accompanied by a statistically significant increase in both plasma cysteine and GSH.³⁰ One possible explanation is that in the mouse -cystathionase, activity might be rate limiting, resulting in a lowering of homocysteine but no increase in cysteine. Another possibility is that there is some sort of negative cross-talk between the transsulfuration pathway and the -glutamyl cycle.

Our analysis of liver amino acid levels indicates that there is complex homoeostasis of amino acid metabolism in mice. Although we found that CBS-overexpressing animals did have reduced levels of liver homocysteine and elevated levels of cystathionine as expected, the most significant changes were in the levels of amino acids that were not directly related to the methionine or cysteine metabolic pathways, such as leucine, isoleucine, asparagine, valine, phenylalanine, and -aminobutyrate. It is not unprecedented that overexpression of a single amino acid biosynthetic pathway can have global consequences. In the yeasts Saccharomyces cerevisiae and Candida albicans starvation for a single amino acid results in the upregulation of a variety of amino acid biosynthetic genes through the action of the transcriptional activator GCN4.³¹ In mammalian cells, the upregulation of the -aminoisobutyric acid transport system by global amino acid starvation can be suppressed by the addition of a single amino acid to the media.³²

Our results also bear on the question of the relative importance of the liver and kidney in the control of plasma homocysteine levels. Unexpectedly, we found that the endogenous mouse CBS gene is induced in the kidney (but not in the liver) with exposure to zinc. However, from our serum homocysteine data, it is clear that nontransgenic animals did not have any difference in their plasma homocysteine levels when exposed to zinc (Figure 3A). This implies that the kidney is not a key player in control of plasma homocysteine levels in the mouse. If this were true as well in humans, then the hyperhomocysteinemia observed in humans with end-stage renal disease may not be caused by the failure of the kidney to metabolize plasma homocysteine but may be attributable to an indirect effect on homocysteine metabolism in the liver.

Other than the above-described metabolic consequences, we did not observe any other differences between control and Tg-CBS mice. The mice exhibited normal growth, normal behavior, and had normal-looking pups. These findings indicate that elevated CBS activity in the liver is essentially benign and suggests that treatments that activate CBS activity could potentially be useful in lowering plasma homocysteine in human patients. One possibility is that gene therapy could be used to deliver either extra copies of CBS gene or CBS protein to the liver. Although in theory a powerful approach, the technical hurdles are still great. A potentially more feasible strategy would be to use small-molecule drugs that could elevate activity of existing CBS protein in the liver. We have shown previously that the C-terminal domain of CBS acts as a negative regulatory domain (ie, deletion of the C terminus results in a protein with significantly elevated CBS activity).¹⁷ It should be possible to design or screen for drugs that bind to this domain in such a way as to cause activation of endogenous CBS. Because we were able to achieve reduction of serum homocysteine levels with a relatively modest 2.2-fold increase in CBS activity, it seems possible that such effects might be possible to achieve by targeting compounds to the regulatory domain. Such compounds could be useful in the treatment of hyperhomocysteinemia in populations, such as end-stage renal disease patients, that are resistant to homocysteine lowering by B-complex vitamin therapy.¹⁶

We also demonstrated that expression of human CBS can functionally complement deletion of mouse Cbs. By crossing in the transgene, we were able to obtain normal-sized, healthy-looking Cbs deletion animals that lived well into adulthood. Plasma homocysteine on these animals was somewhat elevated on average, but approximately one-third of the animals had homocysteine levels that were within the normal range. Thus, we were able to rescue the neonatal lethality defect and at least partially rescue the severe homocysteinemia with the transgene. When zinc was removed, we were able to obtain extremely elevated plasma homocysteine levels as high as that observed in the surviving Cbs homozygotes described by Watanabe et al²⁵ The ability to produce healthy adult animals whose tHcy levels can be modulated by zinc should be extremely useful to investigators interested in the pathophysiology of tHcy.

	Acknowledgments

 
This work was supported by grants HL57299 and core grant CA06927 from the National Institutes of Health and by an appropriation from the Commonwealth of Pennsylvania. We thank the Transgenic Mouse Facility and Matt Schoell of the Laboratory Animal Facility for their assistance and Dr Elizabeth Henske for critical reading of the manuscript.

	Footnotes

 
Original received February 23, 2004; revision received April 7, 2004; accepted April 12, 2004.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Refsum H, Ueland PM, Nygard O, Vollset SE. Homocysteine and cardiovascular disease. Annu Rev Med. 1998; 49: 31–62.[CrossRef][Medline] [Order article via Infotrieve]

2. Robinson K, Gupta A, Dennis V, Arheart K, Chaudhary D, Green R, Vigo P, Mayer EL, Selhub J, Kutner M, Jacobsen DW. Hyperhomocysteinemia confers an independent increased risk of atherosclerosis in end-stage renal disease and is closely linked to plasma folate and pyridoxine concentrations. Circulation. 1996; 94: 2743–2748.[Abstract/Free Full Text]

3. Boushey CJ, Beresford SA, Omenn GS, Motulsky AG. A quantitative assessment of plasma homocysteine as a risk factor for vascular disease. Probable benefits of increasing folic acid intakes. JAMA. 1995; 274: 1049–1057.[Abstract/Free Full Text]

4. Bautista LE, Arenas IA, Penuela A, Martinez LX. Total plasma homocysteine level and risk of cardiovascular disease: a meta-analysis of prospective cohort studies. J Clin Epidemiol. 2002; 55: 882–887.[CrossRef][Medline] [Order article via Infotrieve]

5. Homocysteine Studies Collaboration. Homocysteine and risk of ischemic heart disease and stroke: a meta-analysis. JAMA. 2002; 288: 2015–2022.[Abstract/Free Full Text]

6. Lentz SR, Sobey CG, Piegors DJ, Bhopatkar MY, Faraci FM, Malinow MR, Heistad DD. Vascular dysfunction in monkeys with diet-induced hyperhomocyst(e)inemia. J Clin Invest. 1996; 98: 24–29.[Medline] [Order article via Infotrieve]

7. Dayal S, Bottiglieri T, Arning E, Maeda N, Malinow MR, Sigmund CD, Heistad DD, Faraci FM, Lentz SR. Endothelial dysfunction and elevation of S-adenosylhomocysteine in cystathionine beta-synthase-deficient mice. Circ Res. 2001; 88: 1203–1209.[Abstract/Free Full Text]

8. Weiss N, Heydrick S, Zhang YY, Bierl C, Cap A, Loscalzo J. Cellular redox state and endothelial dysfunction in mildly hyperhomocysteinemic cystathionine beta-synthase-deficient mice. Arterioscler Thromb Vasc Biol. 2002; 22: 34–41.[Abstract/Free Full Text]

9. Werstuck GH, Lentz SR, Dayal S, Hossain GS, Sood SK, Shi YY, Zhou J, Maeda N, Krisans SK, Malinow MR, Austin RC. Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J Clin Invest. 2001; 107: 1263–1273.[Medline] [Order article via Infotrieve]

10. Hossain GS, van Thienen JV, Werstuck GH, Zhou J, Sood SK, Dickhout JG, de Koning AB, Tang D, Wu D, Falk E, Poddar R, Jacobsen DW, Zhang K, Kaufman RJ, Austin RC. TDAG51 is induced by homocysteine, promotes detachment-mediated programmed cell death, and contributes to the development of atherosclerosis in hyperhomocysteinemia. J Biol Chem. 2003; 278: 30317–30327.[Abstract/Free Full Text]

11. Ubbink JB, Vermaak WJ, van der Merwe A, Becker PJ, Delport R, Potgieter HC. Vitamin requirements for the treatment of hyperhomocysteinemia in humans. J Nutr. 1994; 124: 1927–1933.[Abstract/Free Full Text]

12. Malinow MR, Nieto FJ, Kruger WD, Duell PB, Hess DL, Gluckman RA, Block PC, Holzgang CR, Anderson PH, Seltzer D, Upson B, Lin QR. The effects of folic acid supplementation on plasma total homocysteine are modulated by multivitamin use and methylenetetrahydrofolate reductase genotypes. Arterioscler Thromb Vasc Biol. 1997; 17: 1157–1162.[Abstract/Free Full Text]

13. Jacques PF, Selhub J, Bostom AG, Wilson PW, Rosenberg IH. The effect of folic acid fortification on plasma folate and total homocysteine concentrations. N Engl J Med. 1999; 340: 1449–1454.[Abstract/Free Full Text]

14. Malinow MR, Duell PB, Williams MA, Kruger WD, Evans AA, Anderson PH, Block PC, Hess DL, Upson BM, Graf EE, Irvin-Jones A, Wang L. Short-term folic acid supplementation induces variable and paradoxical changes in plasma homocyst(e)ine concentrations. Lipids. 2001; 36 (suppl): S27–S32.[Medline] [Order article via Infotrieve]

15. Kruger WD, Evans AA, Wang L, Malinow MR, Duell PB, Anderson PH, Block PC, Hess DL, Graf EE, Upson B. Polymorphisms in the CBS gene associated with decreased risk of coronary artery disease and increased responsiveness to total homocysteine lowering by folic acid. Mol Genet Metab. 2000; 70: 53–60.[CrossRef][Medline] [Order article via Infotrieve]

16. De Vriese AS, Verbeke F, Schrijvers BF, Lameire NH. Is folate a promising agent in the prevention and treatment of cardiovascular disease in patients with renal failure? Kidney Int. 2002; 61: 1199–1209.[CrossRef][Medline] [Order article via Infotrieve]

17. Shan X, Kruger WD. Correction of disease-causing CBS mutations in yeast. Nat Genet. 1998; 19: 91–93.[CrossRef][Medline] [Order article via Infotrieve]

18. Shan X, Dunbrack RL, Jr., Christopher SA, Kruger WD. Mutations in the regulatory domain of cystathionine beta synthase can functionally suppress patient-derived mutations in cis. Hum Mol Genet. 2001; 10: 635–643.[Abstract/Free Full Text]

19. Kery V, Poneleit L, Kraus JP. Trypsin cleavage of human cystathionine beta-synthase into an evolutionarily conserved active core: structural and functional consequences. Arch Biochem Biophys. 1998; 355: 222–232.[CrossRef][Medline] [Order article via Infotrieve]

20. Kruger WD, Cox DR. A yeast assay for functional detection of mutations in the human cystathionine beta-synthase gene. Hum Mol Genet. 1995; 4: 1155–1161.[Abstract/Free Full Text]

21. Palmiter RD, Sandgren EP, Koeller DM, Brinster RL. Distal regulatory elements from the mouse metallothionein locus stimulate gene expression in transgenic mice. Mol Cell Biol. 1993; 13: 5266–5275.[Abstract/Free Full Text]

22. Christopher SA, Diegelman P, Porter CW, Kruger WD. Methylthioadenosine phosphorylase, a gene frequently codeleted with p16(cdkN2a/ARF), acts as a tumor suppressor in a breast cancer cell line. Cancer Res. 2002; 62: 6639–6644.[Abstract/Free Full Text]

23. Jacobsen DW, Gatautis VJ, Green R, Robinson K, Savon SR, Secic M, Ji J, Otto JM, Taylor LM Jr. Rapid HPLC determination of total homocysteine and other thiols in serum and plasma: sex differences and correlation with cobalamin and folate concentrations in healthy subjects. Clin Chem. 1994; 40: 873–881.[Abstract/Free Full Text]

24. Palmiter RD, Norstedt G, Gelinas RE, Hammer RE, Brinster RL. Metallothionein-human GH fusion genes stimulate growth of mice. Science. 1983; 222: 809–814.[Abstract/Free Full Text]

25. Watanabe M, Osada J, Aratani Y, Kluckman K, Reddick R, Malinow MR, Maeda N. Mice deficient in cystathionine beta-synthase: animal models for mild and severe homocyst(e)inemia. Proc Natl Acad Sci U S A. 1995; 92: 1585–1589.[Abstract/Free Full Text]

26. Taoka S, Ohja S, Shan X, Kruger WD, Banerjee R. Evidence of heme-mediated redox regulation of human cystathionine beta-synthase activity. J Biol Chem. 1998; 273: 25179–25184.[Abstract/Free Full Text]

27. Chen Z, Crippen K, Gulati S, Banerjee R. Purification and kinetic mechanism of a mammalian methionine synthase from pig liver. J Biol Chem. 1994; 269: 27193–27197.[Abstract/Free Full Text]

28. Garrow TA. Purification, kinetic properties, and cDNA cloning of mammalian betaine-homocysteine methyltransferase. J Biol Chem. 1996; 271: 22831–22838.[Abstract/Free Full Text]

29. Finkelstein JD. The metabolism of homocysteine: pathways and regulation. Eur J Pediatr. 1998; 157: S40–S44.[CrossRef][Medline] [Order article via Infotrieve]

30. Pogribna M, Melnyk S, Pogribny I, Chango A, Yi P, James SJ. Homocysteine metabolism in children with Down syndrome: in vitro modulation. Am J Hum Genet. 2001; 69: 88–95.[CrossRef][Medline] [Order article via Infotrieve]

31. Tripathi G, Wiltshire C, Macaskill S, Tournu H, Budge S, Brown AJ. Gcn4 coordinates morphogenetic and metabolic responses to amino acid starvation in Candida albicans. EMBO J. 2002; 21: 5448–5456.[CrossRef][Medline] [Order article via Infotrieve]

32. Heaton JH, Gelehrter TD. Derepression of amino acid transport by amino acid starvation in rat hepatoma cells. J Biol Chem. 1977; 252: 2900–2907.[Abstract/Free Full Text]

This article has been cited by other articles:

				S. Gupta, J. Kuhnisch, A. Mustafa, S. Lhotak, A. Schlachterman, M. J. Slifker, A. Klein-Szanto, K. A. High, R. C. Austin, and W. D. Kruger Mouse models of cystathionine {beta}-synthase deficiency reveal significant threshold effects of hyperhomocysteinemia FASEB J, March 1, 2009; 23(3): 883 - 893. [Abstract] [Full Text] [PDF]

				S. Dayal and S. R. Lentz Murine Models of Hyperhomocysteinemia and Their Vascular Phenotypes Arterioscler Thromb Vasc Biol, September 1, 2008; 28(9): 1596 - 1605. [Abstract] [Full Text] [PDF]

				K. T. Williams and K. L. Schalinske New Insights into the Regulation of Methyl Group and Homocysteine Metabolism J. Nutr., February 1, 2007; 137(2): 311 - 314. [Abstract] [Full Text] [PDF]

				N. Li, L. Chen, R. W. Muh, and P.-L. Li Hyperhomocysteinemia Associated With Decreased Renal Transsulfuration Activity in Dahl S Rats Hypertension, June 1, 2006; 47(6): 1094 - 1100. [Abstract] [Full Text] [PDF]

				L. Wang, X. Chen, B. Tang, X. Hua, A. Klein-Szanto, and W. D. Kruger Expression of mutant human cystathionine {beta}-synthase rescues neonatal lethality but not homocystinuria in a mouse model Hum. Mol. Genet., August 1, 2005; 14(15): 2201 - 2208. [Abstract] [Full Text] [PDF]

				D. J. Shields, S. Lingrell, L. B. Agellon, J. T. Brosnan, and D. E. Vance Localization-independent Regulation of Homocysteine Secretion by Phosphatidylethanolamine N-Methyltransferase J. Biol. Chem., July 22, 2005; 280(29): 27339 - 27344. [Abstract] [Full Text] [PDF]

				X. Chen, K.-H. Jhee, and W. D. Kruger Production of the Neuromodulator H2S by Cystathionine {beta}-Synthase via the Condensation of Cysteine and Homocysteine J. Biol. Chem., December 10, 2004; 279(50): 52082 - 52086. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 94/10/1318    most recent 01.RES.0000129182.46440.4av1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, L. Articles by Kruger, W. D. Search for Related Content PubMed PubMed Citation Articles by Wang, L. Articles by Kruger, W. D. Related Collections Animal models of human disease