| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Department of Pharmacology, Johannes Gutenberg University, Mainz, Germany.
Correspondence to Ellen Ildicho Closs, PhD, Department of Pharmacology, Johannes Gutenberg University, Obere Zahlbacher Str. 67, 55101 Mainz, Germany. E-mail Closs{at}mail.uni-mainz.de
| Abstract |
|---|
|
|
|---|
Key Words: endothelial nitric oxide synthase neutral amino acid transport system N intracellular arginine pool proteasome
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
Human umbilical vein endothelial cells (HUVECs) were isolated in the department of Medicine II (Johannes Gutenberg-University, Mainz, Germany) as previously described.10 Cells were expanded in Earls medium 199 (supplemented with 20% FBS, penicillin, streptomycin, and 5.3 mmol/L glutamine) on fibronectin-coated dishes and used in the third passage. For incubation of cells with amino acids, only the L-isomers were used.
Transfection of ECV304 Cells
ECV304 cells grown to 80% confluence in 6-well plates (35 mm diameter) were given fresh DMEM supplemented with 10% FBS. Cells were then incubated for 8 hours with 50 µL of a transfection mixture containing 5 µg DNA [bovine endothelial nitric oxide synthase (eNOS) in pcDNA311] and 15 µL DOTAP transfection reagent (Roche). Two days after transfection, cells were split into new plates (100 mm in diameter), and stable transfected cell clones were selected in medium containing 1 mg/mL G418 (PAA).
RFL-6 Reporter Cell Assay
All cells were grown to confluence in 6-well plates (diameter 35 mm) and washed twice in Lockes solution (LS; composition: 154 mmol/L NaCl; 5.6 mmol/L KCl; 2 mmol/L CaCl2; 1 mmol/L MgCl2; 10 mmol/L HEPES; 3.6 mmol/L NaHCO3; 5.6 mmol/L glucose). Cells were then preincubated in LS supplemented with the indicated amino acids and for the last 30 minutes with 20 U/mL superoxide dismutase (SOD, Roche Molecular Biochemicals) for 0.25 to 4 hours at 37°C. The solution was renewed 2 (0.25- and 0.5-hour incubations) or 3 (all others) times. For NO measurement, cells were incubated for 2 minutes in the same solution supplemented with 20 U/mL SOD, 0.3 mmol/L 3-isobutyl-1-methylxanthine (IBMX, Serva) and 10 µmol/L calcium-ionophore A23187. The supernatants were then transferred to the RFL-6 cells (that had been washed twice in LS and preincubated in LS supplemented with 0.3 mmol/L IBMX for 30 minutes at 37°C). After the 2 minutes incubation at 37°C, the supernatants were removed from the RFL-6 cells, 1 mL ice-cold sodium acetate buffer (20 mmol/L, pH 4.0) was added, and the cells were rapidly frozen in liquid nitrogen. For repeated measurements, the same EA.hy926 cells were incubated 4 more times with fresh LS containing all supplements (for 2 minutes each time), and the supernatants were transferred each time to new RFL-6 cells. The cGMP content of the RFL-6 cells was determined by radioimmunoassay as described previously.12
Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA was isolated using the RNeasy Mini Kit (Qiagen) and quantified by the absorption of the eluate at 260 nm. One-Step RT-PCR was performed with the QuantiTect RT-PCR Kit (Qiagen) in 25 µL reactions in a 96-well spectrofluorometric thermal cycler (iCycler, Bio-Rad) (dNTPs: 400 µmol/L each). For detection of SN1 by conventional RT-PCR the oligonucleotides TGGCTTCTTGCTGATGACC and TGGTTATCGGCACCTTCC were used as sense and antisense primer, respectively (40 cycles, 95°C 30 seconds, 60°C 30 seconds, 72°C 60 seconds). For real-time RT-PCR (MgCl2: 5.3 mmol/L, 94°C 15 seconds, 60°C 60 seconds), the following oligonucleotides served as sense and antisense primers, respectively: GCTGCCACTTGTCATACAGACC and GTAGCCAAGCTGCCGCAT (human SN1); AGCCTCAAGATCATCAGCAATG and CACGATACCAAAGTTGTCATGGA (human GAPDH). Taqman hybridization probes were double labeled with 6-carboxyfluorescein (FAM) as the reporter fluorophore and carboxytetramethyl-rhodamine (TAMRA) as the quencher: 6FAM-CCTCGGACTGGTACATGAACGGGAACXTp (SN1 probe); 6FAM-CTGCACCACCAACTGCTTAGCACCCXTp (GAPDH probe). Fluorescence was monitored at each 60°C annealing/extension step.
Analysis of the Intracellular Amino Acid Content
EA.hy926 cells grown in 100-mm-diameter cell culture dishes were washed twice with LS and then preincubated for 0.5 or 2 hours in LS supplemented with 1 mmol/L of the amino acids specified in Figure 6. They were then washed 3 times in ice-cold phosphate buffered saline (PBS) and lysed in 1.5 mL ice-cold EtOH (70%). Homoserine was added as internal standard (50 nmol/1.5 mL). After 30 minutes at 4°C, cell debris was sedimented at 14000g for 10 minutes. Supernatants were extracted two times with 0.5 mL petrolether each, and then dried by vacuum centrifugation. Pellets were resuspended in 400 µL borate buffer pH 10. For precolumn derivatization with o-phthaldialdehyde (OPA), 150 µL of the eluate was used (Autosampler L7250 Merck). Amino acid derivatives were separated on a Nova-Pak column (C18, 4 µm 3.9x300 mm, Waters) using a two solvent gradient (acetonitril/50 mmol/L sodium acetate, pH 7.0). The flow rate was 0.8 mL/min. Fluorescence (excitation wavelength, 330 nm; emission wavelength, 450 nm) was monitored with a Shimadzu RF-530 fluorometer and quantified using the analysis program D-7000 HSM (Merck).
|
Statistical Analyses
Statistical analysis was performed using one- or two-way ANOVA analysis of variance with the Bonferroni post hoc test. Values of P<0.001, P<0.01, and P<0.05 were marked by three, two, and one asterisks, respectively. Values of P>0.05 were considered not significant and marked by NS.
| Results |
|---|
|
|
|---|
Glutamine Induces a Partial Depletion of the Intracellular Arginine Pool II in EA.hy926 Cells
Our previous data have shown that the eNOS activity of EA.hy926 endothelial cells is not reduced by a 2-hour incubation in LS containing 1 mmol/L lysine, implying an intracellular arginine pool that is not freely exchangeable with the extracellular space (referred to as pool II). However, in the present study, we noticed a reduction in the eNOS activity of EA.hy926 cells incubated for shorter time periods in lysine-containing buffer (Figure 1A). This suggested a component of the cell culture medium (that is initially present in a sufficient high concentration and either consumed or washed out during the course of the experiment) to account for this difference. As glutamine is the most abundant amino acid in cell culture media, and glutamine has been shown to interfere with eNOS activity in endothelial cells from different sources (see Discussion), we tested if the substrate depletion of EA.hy926 cells was dependent on the presence of glutamine. In fact, when cells were incubated 2 hours before the experiment in DMEM without glutamine, no reduction of the eNOS activity was observed on a 30-minute incubation in lysine-containing buffer (Figure 1B). Likewise, the eNOS activity was still reduced in cells incubated for 2 hours in buffer supplemented with lysine plus glutamine (Figure 1B). Finally, the presence of glutamine during the 30 minutes lysine incubation caused an additional reduction of the eNOS activity (Figure 2). In both, cells treated with lysine alone or in addition with glutamine, the residual eNOS activity was stable on five consecutive measurements, suggesting that the remaining arginine pool was efficiently replenished (Figure 2).
|
|
Part of the Intracellular Arginine Pool II Seems to be a Recycling Pathway
In HUVECs, a reduction in eNOS activity was observed on a 30-minute lysine incubation similar to the one in EA.hy926 cells (compare Figures 3A and 3B, first two columns). This reduction was abolished by citrulline in both endothelial cell types, suggesting that part of the arginine pool II consists in recycling of citrulline to arginine and that citrulline was the limiting factor during the 30-minute lysine incubation (Figures 3A and 3B). Addition of aspartate (the second amino acid needed for the initial recycling step) to the extracellular buffer did not change the eNOS activity. In ECV-NIII-2 cells, a 30-minute incubation in 1 mmol/L lysine led to a more pronounced reduction in the eNOS activity than observed in the endothelial cells. This reduction could not be reversed by citrulline alone or in combination with aspartate (Figure 3C).
|
System N Seems to be Responsible for the Partial Depletion of the Arginine Pool II by Glutamine
The glutamine and citrulline substitution experiments suggested that extracellular glutamine might interfere with the intracellular citrulline pool by an exchange mechanism mediated by a plasma membrane transporter. Glutamine is a substrate for a number of amino acid transport systems, that can be distinguished by their recognition of other neutral and in some cases also cationic amino acids (eg, the Na+-dependent systems N, A, B0/ASC, B0,+ and y+L, and the Na+-independent systems L and b0,+; see review13).
To find out which of these systems might be involved in the downregulation of eNOS activity, we analyzed prototypical substrates for each of these transport systems for their inhibitory action on the eNOS activity in lysine-incubated EA.hy926 cells. As observed for glutamine, eNOS activity was also further inhibited when histidine was present during the 30 minutes preincubation with lysine (Figure 4A). When a second transfer was performed from the same cells (preincubated with lysine plus histidine) but with LS containing arginine or citrulline, the eNOS activity was indistinguishable from cells preincubated with arginine (data not shown). This demonstrates that histidine specifically interfered with the substrate supply of eNOS, eg, by limiting the citrulline store for the recycling reaction. Also like glutamine, histidine prevented the recovery of the eNOS activity during the 2-hour lysine incubation (Figure 4A). Asparagine had a smaller inhibitory effect than histidine and glutamine (data not shown). In contrast,
-(methylamino) isobutyric acid (MeAIB) (the model substrate for system A) and leucine (a substrate for systems B0,+, y+L, L and b0,+) had no influence on the eNOS activity (Figures 4B and 4C). The reduced eNOS activity observed after a 2-hour incubation with leucine plus lysine does not seem to be associated with the arginine supply, as it was also observed when leucine was combined with arginine (data not shown). Also, neither alanine, serine, or threonine (substrates for systems A, B0/ASC, B0,+, and b0,+) nor BCH (the model substrate for system L and y+L) had an impact on the eNOS activity in these experiments (data not shown). Similar results were obtained in HUVECs: histidine, but not MeAIB or leucine, increased the inhibitory effect of a 30 minutes lysine incubation (Figure 5).
|
|
System N Is Expressed in Endothelial Cells
The amino acids that had an influence on the eNOS activity in our experiments match the substrate profile of the system N transporter SN1. Initial experiments using conventional RT-PCR, showed a positive signal in both EA.hy926 cells and HUVECs (online Figure, available in the online data supplement at http://www.circresaha.org). Because so far no SN1 expression had been described in endothelial cells, we examined the SN1 expression by quantitative real-time RT-PCR. A positive signal was detected in RNA from EA.hy926 cells and HUVECs, but not from ECV-NIII-2 cells (online Figure and Table). RNA from liver (the organ with the highest expression of SN114,15) was used as control. When the amount of input liver RNA was correlated with the number of PCR cycles needed to reach the threshold for a positive fluorescence signal (CT values), the resulting straight line had a slope of -3.3, demonstrating an almost 100% efficiency of the RT-PCR (inset of online Figure). Taking the CT values and the amount of input RNA into account, the expression level in EA.hy926 cells and HUVECs was, respectively, about 5000 and 1000 times lower then in liver (Table). In contrast, the expression level of GAPDH (assayed in parallel experiments as a control) was about the same in all RNAs tested (Table). Taken together, these results demonstrate a moderate expression of SN1 in endothelial cells.
|
Glutamine and Citrulline Are Mutually Exchanged in EA.hy926 Cells
To determine if there was indeed an exchange between citrulline and glutamine in EA.hy926 cells, we measured intracellular amino acid concentrations in cells preincubated in arginine, lysine alone, or in combination with citrulline or glutamine. In fact, cells preincubated for 30 minutes in lysine plus citrulline had significant lower glutamine concentrations than cells incubated in lysine (or arginine) alone (Figure 6A). Similarly, cells preincubated for 30 minutes in lysine plus glutamine had lower citrulline concentrations than cells incubated in lysine (or arginine) alone (Figure 6B). The intracellular citrulline concentrations were, however, two orders of magnitude lower than the glutamine concentrations and just at the detection limit. The individual measurements had therefore larger variations and the difference between the experimental groups was not significant. Cells preincubated for 30 minutes in lysine plus citrulline had 6-fold higher intracellular arginine concentrations than cells incubated in lysine alone or in lysine plus glutamine (Figure 6C). These data support our hypothesis that citrulline is the limiting factor for arginine synthesis during the 30-minute lysine incubation, and that the arginine generated from citrulline is not subject to an exchange with extracellular lysine.
Protein Breakdown Is a Major Source for Arginine in Pool II
Even under conditions where the exchangeable arginine was depleted by extracellular lysine and the recycling of citrulline to arginine was inhibited by extracellular substrates of system N, a residual eNOS activity of 30% to 50% was observed in endothelial cells. Besides citrulline recycling, no other biosynthesis pathway for arginine is known. Hence, we wondered, if part of the arginine in pool II might derive from protein breakdown. Indeed, the residual eNOS activity was completely abolished, when cells were incubated in LS containing lysine, glutamine, and the proteasome inhibitor MG132 (Figure 7). This inhibition was completely reversed by addition of extracellular arginine.
|
| Discussion |
|---|
|
|
|---|
A reduction of eNOS activity by glutamine has been described in a number of in vitro and in vivo studies using rabbit aortas, rat cerebral vessels, bovine aortic, and venular and human microvascular endothelial cells.1720 The glutamine inhibition seems therefore a general principal in endothelial cells. However, the other SN1 substrates have not been investigated in these analyses. The initial hypothesis that glutamine inhibited the first recycling step catalyzed by ASS21 was ruled out by later in vitro studies with endothelial lysates showing no interference of glutamine with either of the two consecutive recycling steps.20 The glutamine-mediated inhibition of [14C]arginine formation from extracellularly applied [14C]citrulline, observed in the earlier study,21 can also be explained by an interference of glutamine with [14C]citrulline transport, because no distinction was made between intra- and extracellular citrulline. In fact, Wu and Meininger20 demonstrated that glutamine competes with citrulline uptake in endothelial cells, supporting our current hypothesis that the two amino acids are substrates for the same transporter. The same authors suggested later that glutamine in order to act as an inhibitor needs to be metabolized to glucosamine and reduce intracellular concentrations of NADPH, a cofactor of eNOS.22 However, our observation that histidine exerts the same inhibitory action argues against this hypothesis because histidine does not undergo the same metabolism as glutamine. Also neither glutamine nor histidine had an inhibitory effect on arginine-replete cells in our experiments. This would have to be expected if a co-factor of eNOS was rate limiting. Su and Block23 found that glutamine increased the inhibition of citrulline to arginine recycling in porcine pulmonary artery endothelial cells induced by exposure of the cells to long-term hypoxia (4 to 24 hours). This suggests that glutamine might also have an effect on the stability of the recycling enzymes. However, this should not have played a role in the short time exposure to glutamine and histidine applied to the cells in our experiments.
The effect of the SN1 substrates on the recycling pool IIA are therefore most likely due to an exchange of these substrates against intracellular citrulline thereby accelerating the citrulline efflux, a process termed trans-stimulation. The expression of SN1 in endothelial cells and the mutual exchange of citrulline and glutamine, shown by HPLC analysis, support this hypothesis. For that reason, we hypothesize that it is rather the extracellular than the intracellular glutamine that mediates the inhibitory action on the recycling pathway. How thus can the reduced eNOS activity during the 30 minutes lysine incubation (without additional glutamine) be explained? We found that glutamine (derived from the glutamine-loaded cells) accumulated in the extracellular buffer and thus might have served as trans-stimulator for the intracellular citrulline (data not shown). The free amino group in the side chain of citrulline makes it a candidate substrate for system N. In rat, mouse, and human, SN1 has so far only been described as an influx and efflux transporter for the proteinogenic amino acids glutamine, histidine, and asparagine with preference for glutamine and histidine and a lower affinity to asparagine.14,24 This substrate profile fits very well with the inhibition profile in our experiments. It is different from the substrate profile of all other known glutamine transporters (including SN2 that also transports serine). Although a moderate transport activity of SN1 for alanine has also been described in all three species, our inhibition experiments (that showed no effect of alanine) might not be sensitive enough to detect this activity. Transport studies with overexpressed SN1 will be necessary to proof if citrulline is in fact a substrate for SN1 and if SN1-mediated citrulline transport is subject to trans-stimulation.
For both, pool IIA and IIB, it must be postulated that the arginine-generating enzymes are closely coupled to eNOS, because the generated arginine is not subject to exchange with extracellular lysine in spite of the presence of CAT-1 and 4F2hc/y+LAT2.4,5 In fact, a colocalization of eNOS with the arginine-recycling enzymes argininosuccinate synthetase and lyase (ASS and ASL, respectively) in the plasmalemmal caveolae fraction has recently been shown in bovine aortic endothelial cells.25 The absence of pool II in ECV-NIII-2 cells might thus be explained by a lack of either the arginine-generating enzymes or the coupling of the enzymes to eNOS. Heterologous expression of eNOS in different nonendothelial cells will serve as a useful tool to dissect the arginine generating and the coupling mechanisms.
Our results demonstrate that the substrate supply of eNOS is not only dependent on the activity of transporters for cationic amino acids such as CAT-1 or 4F2hc/y+LAT2, but also on a transporter for neutral amino acids, most likely SN1. The contribution of the different arginine pools as the substrate source for eNOS must be dependent on the amino acid composition of the extracellular fluid. It remains thus to be elucidated which of the substrate pools is used by eNOS under normal and pathophysiological conditions. It is also intriguing to speculate that the phosphorylation status of eNOS, its association with other proteins, or its subcellular localization might influence the usage of the different pools.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Förstermann U, Closs EI, Pollock JS, Nakane M, Schwarz P, Gath I, Kleinert H. Nitric oxide synthase isozymes: characterization, purification, molecular cloning, and functions. Hypertension. 1994; 23: 11211131.
3. Closs EI, Scheld J-S, Sharafi M, Förstermann U. Substrate supply for NO synthase in macrophages and endothelial cells: the role of cationic amino acid transporters (CATs). Mol Pharmacol. 2000; 57: 6874.
4. Gräf P, Förstermann U, Closs EI. The transport activity of the human cationic amino acid transporter hCAT-1 is downregulated by activation of protein kinase C. Br J Pharmacol. 2001; 132: 11931200.[CrossRef][Medline] [Order article via Infotrieve]
5. Sala R, Rotoli BM, Colla E, Visigalli R, Parolari A, Bussolati O, Gazzola GC, DallAsta V. Two-way arginine transport in human endothelial cells: TNF-
stimulation is restricted to system y+. Am J Physiol Cell Physiol. 2002; 282: C134C143.
6. Bröer A, Wagner CA, Lang F, Bröer S. The heterodimeric amino acid transporter 4F2hc/y+LAT2 mediates arginine efflux in exchange with glutamine. Biochem J. 2000; 349: 787795.[Medline] [Order article via Infotrieve]
7. Cooke JP. Does ADMA cause endothelial dysfunction? Arterioscler Thromb Vasc Biol. 2000; 20: 20322037.
8. Kielstein JT, Frölich JC, Haller H, Fliser D. ADMA (asymmetric dimeth-ylarginine): an atherosclerotic disease mediating agent in patients with renal disease? Nephrol Dial Transplant. 2001; 16: 17421745.
9. Leiper J, Vallance P. Biological significance of endogenous methylarginines that inhibit nitric oxide synthases. Cardiovasc Res. 1999; 43: 542548.
10. Lindemann S, Gierer C, Darius H. Prostacyclin inhibits adhesion of polymorphonuclear leukocytes to human vascular endothelial cells due to adhesion molecule independent regulatory mechanisms. Basic Res Cardiol. 2003; 98: 815.[CrossRef][Medline] [Order article via Infotrieve]
11. Liu J, Garcia-Cardena G, Sessa WC. Biosynthesis and palmitoylation of endothelial nitric oxide synthase: mutagenesis of palmitoylation sites, cysteines-15 and/or -26, argues against depalmitoylation-induced translocation of the enzyme. Biochemistry. 1995; 34: 1233312340.[CrossRef][Medline] [Order article via Infotrieve]
12. Ishii K, Sheng H, Warner TD, Förstermann U, Murad F. A simple and sensitive bioassay method for detection of EDRF with RFL-6 rat lung fibroblasts. Am J Physiol. 1991; 261: H598H603.[Medline] [Order article via Infotrieve]
13. Bode BP. Recent molecular advances in mammalian glutamine transport. J Nutr. 2001; 131: 2475S2485S.
14. Chaudhry FA, Reimer RJ, Krizaj D, Barber D, Storm-Mathisen J, Copenhagen DR, Edwards RH. Molecular analysis of system N suggests novel physiological roles in nitrogen metabolism and synaptic transmission. Cell. 1999; 99: 769780.[CrossRef][Medline] [Order article via Infotrieve]
15. Gu S, Roderick HL, Camacho P, Jiang JX. Identification and characterization of an amino acid transporter expressed differentially in liver. Proc Natl Acad Sci U S A. 2000; 97: 32303235.
16. Lee DH, Goldberg AL. Proteasome inhibitors: valuable new tools for cell biologists. Trends Cell Biol. 1998; 8: 397403.[CrossRef][Medline] [Order article via Infotrieve]
17. Swierkosz TA, Mitchell JA, Sessa WC, Hecker M, Vane JR. L-glutamine inhibits the release of endothelium-derived relaxing factor from the rabbit aorta. Biochem Biophys Res Commun. 1990; 172: 143148.[CrossRef][Medline] [Order article via Infotrieve]
18. Okada T, Watanabe Y, Brusilow SW, Traystman RJ, Koehler RC. Interaction of glutamine and arginine on cerebrovascular reactivity to hypercapnia. Am J Physiol Heart Circ Physiol. 2000; 278: H1577H1584.
19. Hecker M, Mitchell JA, Swierkosz TA, Sessa WC, Vane JR. Inhibition by L-glutamine of the release of endothelium-derived relaxing factor from cultured endothelial cells. Br J Pharmacol. 1990; 101: 237239.[Medline] [Order article via Infotrieve]
20. Wu G, Meininger CJ. Regulation of L-arginine synthesis from L-citrulline by L-glutamine in endothelial cells. Am J Physiol. 1993; 265: H1965H1971.[Medline] [Order article via Infotrieve]
21. Sessa WC, Hecker M, Mitchell JA, Vane JR. The metabolism of L-arginine and its significance for the biosynthesis of endothelium-derived relaxing factor: L-glutamine inhibits the generation of L-arginine by cultured endothelial cells. Proc Natl Acad Sci U S A. 1990; 87: 86078611.
22. Wu G, Haynes TE, Li H, Yan W, Meininger CJ. Glutamine metabolism to glucosamine is necessary for glutamine inhibition of endothelial nitric oxide synthesis. Biochem J. 2001; 353: 245252.[CrossRef][Medline] [Order article via Infotrieve]
23. Su Y, Block ER. Hypoxia inhibits L-arginine synthesis from L-citrulline in porcine pulmonary artery endothelial cells. Am J Physiol. 1995; 269: L581L587.[Medline] [Order article via Infotrieve]
24. Fei YJ, Sugawara M, Nakanishi T, Huang W, Wang H, Prasad PD, Leibach FH, Ganapathy V. Primary structure, genomic organization, and functional and electrogenic characteristics of human system N1, a Na+- and H+-coupled glutamine transporter. J Biol Chem. 2000; 275: 2370723717.
25. Flam BR, Hartmann PJ, Harrell-Booth M, Solomonson LP, Eichler DC. Caveolar localization of arginine regeneration enzymes, argininosuccinate synthase, and lyase, with endothelial nitric oxide synthase. Nitric Oxide. 2001; 5: 187197.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
S. Sankaralingam, H. Xu, and S. T. Davidge Arginase contributes to endothelial cell oxidative stress in response to plasma from women with preeclampsia Cardiovasc Res, September 3, 2009; (2009) cvp277v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Santhanam, D. W. Christianson, D. Nyhan, and D. E. Berkowitz Arginase and vascular aging J Appl Physiol, November 1, 2008; 105(5): 1632 - 1642. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Barilli, R. Visigalli, R. Sala, G. C. Gazzola, A. Parolari, E. Tremoli, S. Bonomini, A. Simon, E. I. Closs, V. Dall'Asta, et al. In human endothelial cells rapamycin causes mTORC2 inhibition and impairs cell viability and function Cardiovasc Res, June 1, 2008; 78(3): 563 - 571. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ryoo, G. Gupta, A. Benjo, H. K. Lim, A. Camara, G. Sikka, H. K. Lim, J. Sohi, L. Santhanam, K. Soucy, et al. Endothelial Arginase II: A Novel Target for the Treatment of Atherosclerosis Circ. Res., April 25, 2008; 102(8): 923 - 932. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Lim, H. K. Lim, S. Ryoo, A. Benjo, K. Shuleri, V. Miriel, E. Baraban, A. Camara, K. Soucy, D. Nyhan, et al. Mitochondrial arginase II constrains endothelial NOS-3 activity Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3317 - H3324. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Koeners, E. E. van Faassen, S. Wesseling, M. de Sain-van der Velden, H. A. Koomans, B. Braam, and J. A. Joles Maternal Supplementation With Citrulline Increases Renal Nitric Oxide in Young Spontaneously Hypertensive Rats and Has Long-Term Antihypertensive Effects Hypertension, December 1, 2007; 50(6): 1077 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Morris Jr. Arginine Metabolism: Boundaries of Our Knowledge J. Nutr., June 1, 2007; 137(6): 1602S - 1609S. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. C. Luiking and N. E. P. Deutz Biomarkers of Arginine and Lysine Excess J. Nutr., June 1, 2007; 137(6): 1662S - 1668S. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Cardounel, H. Cui, A. Samouilov, W. Johnson, P. Kearns, A.-L. Tsai, V. Berka, and J. L. Zweier Evidence for the Pathophysiological Role of Endogenous Methylarginines in Regulation of Endothelial NO Production and Vascular Function J. Biol. Chem., January 12, 2007; 282(2): 879 - 887. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. John, B. O. Ibe, and J. Usha Raj Oxygen alters caveolin-1 and nitric oxide synthase-3 functions in ovine fetal and neonatal lung microvascular endothelial cells Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L1079 - L1093. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ryoo, L. Santhanam, D. Nyhan, and D. E. Berkowitz Response to Does Arginase Activity In Vitro Represent That In Vivo? Hypertension, October 1, 2006; 48(4): E15 - E15. [Full Text] [PDF] |
||||
![]() |
G. Topal, A. Brunet, L. Walch, J.-L. Boucher, and M. David-Dufilho Mitochondrial Arginase II Modulates Nitric-Oxide Synthesis through Nonfreely Exchangeable L-Arginine Pools in Human Endothelial Cells J. Pharmacol. Exp. Ther., September 1, 2006; 318(3): 1368 - 1374. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kakoki, H.-S. Kim, C.-J. S. Edgell, N. Maeda, O. Smithies, and D. L. Mattson Amino acids as modulators of endothelium-derived nitric oxide Am J Physiol Renal Physiol, August 1, 2006; 291(2): F297 - F304. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Forstermann and T. Munzel Endothelial Nitric Oxide Synthase in Vascular Disease: From Marvel to Menace Circulation, April 4, 2006; 113(13): 1708 - 1714. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Steppan, S. Ryoo, K. H. Schuleri, C. Gregg, R. K. Hasan, A. R. White, L. J. Bugaj, M. Khan, L. Santhanam, D. Nyhan, et al. Arginase modulates myocardial contractility by a nitric oxide synthase 1-dependent mechanism PNAS, March 21, 2006; 103(12): 4759 - 4764. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M Morris Jr Arginine: beyond protein Am. J. Clinical Nutrition, February 1, 2006; 83(2): 508S - 512S. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rotmann, D. Strand, U. Martine, and E. I. Closs Protein Kinase C Activation Promotes the Internalization of the Human Cationic Amino Acid Transporter hCAT-1: A NEW REGULATORY MECHANISM FOR hCAT-1 ACTIVITY J. Biol. Chem., December 24, 2004; 279(52): 54185 - 54192. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. I. Closs, A. Simon, N. Vekony, and A. Rotmann Plasma Membrane Transporters for Arginine J. Nutr., October 1, 2004; 134(10): 2752S - 2759S. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2003 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |