Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2003;93:e26-e32
Published online before print July 17, 2003, doi: 10.1161/01.RES.0000086943.72932.71
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
93/3/e26    most recent
01.RES.0000086943.72932.71v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MacInnes, A.
Right arrow Articles by Karran, E. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MacInnes, A.
Right arrow Articles by Karran, E. H.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ACETANILIDE
Related Collections
Right arrow Biochemistry and metabolism
Right arrow Energy metabolism
Right arrow Ischemic biology - basic studies
Right arrow Lipid and lipoprotein metabolism
(Circulation Research. 2003;93:e26.)
© 2003 American Heart Association, Inc.


Research Commentary

The Antianginal Agent Trimetazidine Does Not Exert Its Functional Benefit via Inhibition of Mitochondrial Long-Chain 3-Ketoacyl Coenzyme A Thiolase

Alan MacInnes, David A. Fairman, Peter Binding, Jo ann Rhodes, Michael J. Wyatt, Anne Phelan, Peter S. Haddock, Eric H. Karran

From Discovery Biology, Pfizer Global Research and Development, Sandwich, Kent, UK.

Correspondence to Alan MacInnes, Discovery Biology (IPC351), Pfizer Global Research and Development, Ramsgate Road, Sandwich, Kent, CT13 9NJ, UK. E-mail Alan_MacInnes{at}sandwich.pfizer.com

Abstract

Trimetazidine acts as an effective antianginal clinical agent by modulating cardiac energy metabolism. Recent published data support the hypothesis that trimetazidine selectively inhibits long-chain 3-ketoacyl CoA thiolase (LC 3-KAT), thereby reducing fatty acid oxidation resulting in clinical benefit. The aim of this study was to assess whether trimetazidine and ranolazine, which may also act as a metabolic modulator, are specific inhibitors of LC 3-KAT. We have demonstrated that trimetazidine and ranolazine do not inhibit crude and purified rat heart or recombinant human LC 3-KAT by methods that both assess the ability of LC 3-KAT to turnover specific substrate, and LC 3-KAT activity as a functional component of intact cellular ß-oxidation. Furthermore, we have demonstrated that trimetazidine does not inhibit any component of ß-oxidation in an isolated human cardiomyocyte cell line. Ranolazine, however, did demonstrate a partial inhibition of ß-oxidation in a dose-dependent manner (12% at 100 µmol/L and 30% at 300 µmol/L). Both trimetazidine (10 µmol/L) and ranolazine (20 µmol/L) improved the recovery of cardiac function after a period of no flow ischemia in the isolated working rat heart perfused with a buffer containing a relatively high concentration (1.2 mmol/L) of free fatty acid. In summary, both trimetazidine and ranolazine were able to improve ischemic cardiac function but inhibition of LC 3-KAT is not part of their mechanism of action. The full text of this article is available online at http://www.circresaha.org.


Key Words: cardiac • metabolism • ischemia • trimetazidine

Myocardial metabolic modulation is a new approach for the treatment and management of ischemic heart disease (IHD) and angina pectoris. In the healthy heart, fatty acids are the primary fuel source for the generation of ATP,1 with the balance of energy provision coming from glucose and lactate oxidation.

Myocardial ischemia radically alters the balance of cardiac fuel metabolism. The primary consequence of moderate ischemia (ie, a 30% to 60% reduction in coronary blood flow as experienced by stable angina patients) is a reduction in oxygen delivery to the tissue resulting in a decrease in ATP production.1 During ischemia, fatty acid and pyruvate oxidation both decrease as glycolysis becomes the predominant route for ATP production.2 However, as oxygen provision declines, the pyruvate produced from glycolysis cannot be fully oxidized by the tricarboxylic acid (TCA) cycle and is reduced to lactate that can further uncouple glycolysis from pyruvate oxidation.2 Glycolytic regeneration of ATP leads to intracellular acidosis via the production of cytosolic protons3 that in turn activate the sodium-hydrogen exchanger and sodium-calcium exchanger leading to intracellular calcium overload and contractile dysfunction.2 Ischemic injury elevates plasma catecholamine concentrations leading to activation of hormone sensitive lipase (HSL) resulting in an increase in plasma free fatty acid (FFA) concentrations (typically 0.8 to 1.4 mmol/L).4 On reperfusion, fatty acid oxidation becomes the predominant source of ATP production5 and the concomitant increase in reduced nicotinamide adenine dinucleotide (NADH):oxidized nicotinamide adenine dinucleotide (NAD+) and acetyl Coenzyme A (CoA):CoA ratios negatively feedback and inhibit the pyruvate dehydrogenase complex (PDC). This further uncouples glycolysis from pyruvate oxidation2 and exacerbates the intracellular calcium overload and contractile dysfunction.

Hypothetically, therefore, therapeutic benefit in IHD and stable angina may derive from agents that can recouple glycolysis and pyruvate oxidation and hence normalize myocardial metabolism.2,4 Several agents have been discovered that achieve this via different mechanisms: eg, PDC activation using dichloroacetate (DCA),6 modifiers of the mitochondrial acetyl CoA:CoA ratio,7 and carnitine palmitoyltransferase I (CPT-I) inhibitors.8

The most recently discovered group of agents proposed to modulate myocardial metabolism are the substituted piperazine compounds trimetazidine (1-[2,3,4-trimethoxybenzyl] piperazine dihydrochloride) and ranolazine ((±)-N-(2,6-dimethylphenyl)-4-[2-hydroxy-3-(2-methoxyphenoxy)-propyl]-1-piperazineacetamide). Trimetazidine reduces intracellular acidosis during low-flow simulated ischemia9 and is cardioprotective in in vitro models of ischemic injury.10 It has been proposed that these effects derive from inhibition of the mitochondrial LC 3-KAT, consequent inhibition of ß-oxidation and re-coupling of glucose oxidation.11,12 ß-Oxidation consists of four enzymatic steps. An initial acyl CoA dehydrogenase produces substrate for entry into the trifunctional protein complex (TFP). TFP consists of a multimeric {alpha}- and ß-subunit complex. The {alpha}-subunit contains the enoyl CoA hydratase and L-3-hydroxyacyl CoA dehydrogenase activities, whereas the ß-subunit contains the LC 3-KAT activity (Figure 1).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Substrate flux through ß-oxidation as measured in in vitro assays.

Several double-blinded clinical trials have shown a substantial benefit with trimetazidine in patients with stable angina, at least equivalent to propranolol and nifedipine and additive in combination with diltiazem.13–16 The efficacy of trimetazidine is considered different from traditional antianginal therapy in that benefit is achieved without any hemodynamic effects.

Trimetazidine’s mechanism of action remains ill-defined, with (1) direct effects on cardiac sodium current,17 (2) reducing the production of superoxide free radicals,18 (3) synthesis and turnover of complex lipids,19 and (4) binding to a mitochondrial transition pore binding site20 all having been subject to investigation. However, the present view is that trimetazidine directly inhibits LC 3-KAT and acts as a metabolic modulator.12

The antianginal agent ranolazine, described as a partial fatty acid oxidation inhibitor (pFOXi), also appears to act as a metabolic modulator. Ranolazine exerts beneficial effects in reperfused ischemic hearts by stimulating glucose oxidation as a consequence of reducing fatty acid oxidation.21 More recently, ranolazine has demonstrated antianginal efficacy alone22 and in combination with existing therapy,23 without any deleterious alterations in rate pressure product or coronary blood flow. Despite being termed a pFOXi, the exact mechanism of action of ranolazine has yet to be determined.

The purpose of this study was to assess directly whether trimetazidine and ranolazine exert their beneficial effects on mitochondrial substrate oxidation and cardiac function by selectively inhibiting LC 3-KAT. The effects of these agents was assessed on (1) the enzymatic activities of rat LC 3-KAT (purified from tissue) and human recombinant LC 3KAT (expressed and purified), (2) ß-oxidation in a human cardiomyocyte line, and (3) the isolated working heart after a period of no-flow ischemia.

Materials and Methods

Protein Expression, Characterization, and Purification
TFP containing LC 3-KAT was purified from frozen rat heart tissue by a modification of the method described by Carpenter et al24 (Figure 2).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 2. PAGE analysis of purified rat heart TFP. Proteins were purified as described under Materials and Methods and analyzed using a 4% to 20% NuPAGE/MOPS SDS-PAGE system (Invitrogen). Gels were stained using GelCode (Pierce, 24592). Lane 1 contains molecular weight markers (Invitrogen, SeeBlue). Lanes 2 and 3 were loaded with 10 and 15 µg purified rat heart TFP, respectively.

The mature forms of TFP-{alpha} and TFP-ß were amplified by polymerase chain reaction using clones 8123703 and 4767040 (Incyte Corporation), respectively, as templates and the following primer pairs: {alpha}-forward, GGTCGACAAACCAGAACCCATATT, and {alpha}-reverse, TGCTCGAGTCACTGGTAGAACTTCTTGTTAGGGCT; ß-forward, CTCGAGGCTGCCCCAGCTGTCCAGACCAAA, and ß-reverse, CTCGAGTTATTTTGGATAAGCTTCCACTAT. PCR products were sequence validated and cloned into pET bacterial expression vectors (Novagen) to include N-terminal affinity tags; S · tag for TFP-{alpha} (in pET29a) and (His)6 tag for TFP-ß (in pET14b). BL21 (DE3) pLysS cells transformed with the TFP expression constructs were grown in LB medium supplemented with 34 µg/mL chloramphenicol plus 50 µg kanamycin (pET29a_TFP-{alpha} construct) or 50 µg/mL carbenicillin (pET14b_TFP-ß construct). Cells were grown at 37°C on an orbital shaker at 225 rpm, to an OD600 value of 0.6 for soluble protein expression. Isopropyl-ß-D-thiogalactopyranoside (IPTG) was then added to induce protein expression that was allowed to proceed at 23°C for 2 hours. Cells were harvested by centrifugation at 10 700g for 30 minutes at 4°C, and were resuspended in lysis buffer (50 mmol/L Tris-HCl, 150 mmol/L NaCl, 10 mmol/L ß-mercaptoethanol, 1% Tween-20, pH 7.6). After sonication (3x10 seconds, 4°C), insoluble material was pelleted by centrifugation at 27 000g for 30 minutes at 4°C. The supernatant was processed using a single-step batch purification approach according to manufacturers’ instructions. TFP-{alpha} was purified with S · protein resin (Novagen) and TFP-ß with NiNTA agarose (Qiagen). Proteins were exchanged into storage buffer (50 mmol/L Tris-HCl, 150 mmol/L NaCl, 5 mmol/L ß-mercaptoethanol, 0.5% Tween-20, 30% glycerol, pH 7.0) using PD-10 columns (Amersham Biosciences). Expression of TFP subunits was confirmed through analysis using 4% to 20% SDS-PAGE followed by Western analysis using antibodies immunoreactive with the affinity tags. Reconstitution of the recombinant human TFP-{alpha}/ß complex was achieved by mixing equal amounts of each protein and incubation at 4°C overnight.

Biochemical Analysis
The enzymatic activity of LC 3-KAT was assayed using two methods from (1) crude rat heart mitochondrial homogenate (crTFP), (2) purified rat heart trifunctional protein (prTFP), or (3) recombinant human trifunctional protein (rhTFP).

Method 1 assayed the turnover by LC 3-KAT of specific 3-ketoacyl CoA substrate that was produced in situ (Figure 1). Buffer constituents were as described by Wanders et al25 for the determination of thiolase (EC 2.3.1.16) activity without KCl, and at pH 9.0. Reactions were performed in 5-mL batches at 30°C and absorbance changes detected using a Molecular Devices SPECTRAmax PLUS. Palmityl CoA (50 µmol/L) was converted to the trans-{Delta}2-enoyl form using 0.1U/mL acyl CoA oxidase (EC 1.3.3.6) (detected as an increase in absorption at 280 nm). rhTFP-{alpha} subunit was added, and the enoyl CoA hydratase (EC 4.2.1.7) activity measured as a decrease in absorption at 280 nm.26 NAD (2 mmol/L) was added and the L-3-hydroxyacyl CoA dehydrogenase (EC 1.1.1.35) activity measured as an increase in absorbance at 340 nm26 until the change in absorbance became asymptotic (typically equivalent to 40 to 45 µmol/L 3-ketoacyl CoA). The mixture was boiled for 30 seconds to denature proteins and centrifuged (10 minutes at 13 000g) to recover the 3-ketoacyl CoA in the supernatant. Ninety microliters of the supernatant was added to each well of a 96-well plate. Vehicle (10 µL 1% DMSO) or compound (either trimetazidine, ranolazine, or the positive control, acetyl CoA) and 80 µL of pH 7.3 Tris buffer, to bring the pH to 8.2, were added to appropriate wells. Ten microliters of either crTFP, prTFP, or rhTFP were added and allowed to equilibrate for 5 minutes before initiation of the thiolase reaction by the addition of 10 µL 500 µmol/L CoA solution (TFP was titrated to give a CoA-dependent decrease in absorbance of {approx}0.1 OD units in 30 minutes). The CoA-dependent rate of decrease in absorbance at 303 nm was measured, and the effect of compounds determined in a similar way to that described by Kantor et al.12

Method 2 assayed the turnover by purified rat heart LC 3-KAT of "natural" substrate produced via ß-oxidation of palmityl CoA. The assay conditions were as for method 1 except reactions were performed in 96-well plates at pH 7.3 and without the boiling step. Vehicle (10 µL 1% DMSO) or compounds (either trimetazidine, ranolazine, or the positive controls, acetyl CoA or benzotript) were added after plateau of the oxidase reaction. Dehydrogenase activity was allowed to plateau (due to product inhibition) before CoA was added. The increase in dehydrogenase activity induced by the addition of CoA represented LC 3-KAT activity.

All measurements for methods 1 and 2 were made when the rates of change in OD were linear over time.

Whole Cell–Based ß-Oxidation
Cardiomyocytes (Girardi cells: CCL 27) (ECACC) were cultured as described previously27 except that cells were seeded into 12-well plates 72 hours before use and 1 mmol/L L-carnitine was added.28 Plates were washed twice with PBS (with calcium and magnesium). Compounds (either trimetazidine, ranolazine, or oxfenicine) were added and preincubated for 15 minutes before the addition of 13C-palmitate (6 mmol/L in 15% BSA) to give a final concentration of 1.2 mmol/L palmitate. At 60 minutes, the medium was aspirated, 200 µL 0.5 mol/L perchloric acid (PCA) added to each well, and the plates frozen at -80°C until analysis. Acetyl-CoA derived from ß-oxidation of the labeled palmitate is utilized by the cells for citrate synthesis or incorporated into acetyl-L-carnitine.29 The accumulation of 13C-acetyl-L-carnitine was quantitated as a measure of the rate of ß-oxidation. Acetyl-L-carnitine, L-carnitine, and labeled acetyl-L-carnitine were measured in neutralized PCA extracts using a Shimadzu QP8000 single quadruple LCMS. Injections (5 µL) of each sample were analyzed for the corresponding positive parent ions of the three species (m/z 204.1, 162.1, and 206.1, respectively) using single ion monitoring and quantified using the area under the curve for each ion current.

Working Rat Heart
All animal procedures were conducted in accordance with the Animals (Scientific Procedures) Act 1986 and were evaluated by the local ethical review process. Male rats at 325 to 375 g (Charles River, Margate, Kent, UK) were anesthetized with sodium pentobarbitone (Sagatal, Rhône Mérieux) (10 mg/100 g body weight, IP). Hearts were excised, immersed in Krebs (4°C), and cannulated for isolated working heart perfusions.30 Briefly, spontaneously beating hearts were perfused at a 11.5 mm Hg left atrial preload and an 80 mm Hg afterload with a modified Krebs-Henseleit solution containing 2.5 mmol/L calcium, 5.5 mmol/L glucose, 100 µU/mL insulin, and 3% BSA in the presence or absence of 1.2 mmol/L palmitate (pH 7.4), and gassed with 95% O2/5% CO2. Heart rate, aortic pressure, aortic flow, and coronary flow were measured.

Hearts were normally perfused for 20 minutes (37°C) for baseline recording, followed by a 20-minute global no-flow ischemic period (33°C) and a 40-minute reperfusion (37°C) period.31 Hearts (n=8/group) were randomly allocated to be perfused by media containing either (1) 5.5 mmol/L glucose, (2) 5.5 mmol/L glucose and 1.2 mmol/L palmitate, (3) 5.5 mmol/L glucose and 1.2 mmol/L palmitate+10 µmol/L trimetazidine, (4) +20 µmol/L ranolazine, or (5) +1 mmol/L DCA.

Statistical Analysis
All data are presented as the group mean±SEM. For the biochemical analysis, t tests were only performed at the highest compound concentration. For the cell-based assay analysis of variance (ANOVA) was used to compare treatments to vehicle using a blocked experimental design. For the working heart preparation, ANOVA was used to compare treatments while the average of the three baseline values was used as a covariate.

All reagents were purchased from Sigma Aldrich Company Ltd. Trimetazidine, ranolazine, and oxfenicine were supplied by PGRD synthetic services, whereas benzotript was purchased from ICN Biomedicals Inc.

Results

Trimetazidine Does Not Inhibit LC 3-KAT
The TFP of mitochondrial ß-oxidation contains an {alpha} and ß subunit. The enoyl CoA hydratase and L-3 hydroxyacyl CoA dehydrogenase activities are contained in the {alpha}-subunit, whereas the LC 3-KAT activity is contained in the ß-subunit. Our aim was to assess the specific inhibition by agents of LC 3-KAT. Therefore, only fractions of crTFP, prTFP, and rhTFP that demonstrated activity for the long-chain substrate (palmityl CoA) but were devoid of short chain substrate (butyryl CoA) -dependent hydratase, dehydrogenase, and thiolase activity were used (data not shown).

The addition of CoA to a reaction mixture containing 3-ketoacyl CoA and either crTFP, prTFP, or rhTFP caused a decrease in absorbance at 303 nm, representing a thiolase-dependent decrease in 3-ketoacyl CoA (data not shown): the effects of compounds to inhibit LC 3-KAT was expressed as the percentage change in absorbance compared with vehicle control (Figures 3A through 3C). Trimetazidine (0.1 to 100 µmol/L) and ranolazine (0.1 to 100 µmol/L) failed to inhibit any of the preparations of LC 3-KAT. The concentration ranges for trimetazidine and ranolazine were taken from Kantor et al12 who report the IC50 of trimetazidine as 75 nmol/L. In our studies, the highest concentrations used for trimetazidine and ranolazine were limited by their solubility. Acetyl CoA, however, a known inhibitor of LC 3-KAT,32 dose-dependently inhibited all three LC 3-KAT activities with equal potency (P<0.05 at 2 mmol/L).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. Effects of trimetazidine, ranolazine, and acetyl CoA on LC 3-KAT activity from crude rat heart mitochondrial homogenate (A), purified rat heart TFP (B), and recombinant human TFP (C). *P<0.05 vs control; n=3 to 4 for all determinations.

ß-Oxidation is a highly adaptive and tightly regulated process sensitive to small changes in concentrations of all components of the pathway. Because our first experiments focused on the thiolase and final step of the pathway, we also assessed the ability of trimetazidine and ranolazine to inhibit LC 3-KAT as a functional component of intact ß-oxidation (Figure 4). The addition of CoA caused a shift in the equilibrium of the dehydrogenase reaction by removing the product inhibition of 3-ketoacyl CoA on the L-3-hydroxyacyl CoA dehydrogenase enzyme. LC 3-KAT activity was assayed as an increase in dehydrogenase activity, and the effects of compounds expressed as a percentage of the control group. Trimetazidine (0.1 to 100 µmol/L) and ranolazine (0.1 to 100 µmol/L) did not inhibit LC 3-KAT; however, acetyl CoA (0.03 to 2 mmol/L) did significantly inhibit LC 3-KAT in a dose-dependent manner (P<0.05 at 2 mmol/L). Benzotript (0.3 to 2 mmol/L), a known inhibitor of ß-oxidation33 used as a positive control to validate the methodology, dose-dependently inhibited LC 3-KAT (P<0.05 at 2 mmol/L) (Figure 4).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Effect of trimetazidine, ranolazine, and acetyl CoA on LC 3-KAT activity from purified rat heart TFP using method 2. *P<0.05 vs control; n=3 for all determinations.

Trimetazidine Does Not Inhibit ß-Oxidation in Cardiomyocytes
The effects of compounds on flux through ß-oxidation was assessed using intact human cardiomyocytes and quantified by analysis of the 13C-palmitate–dependent accumulation of 13C-acetyl-L-carnitine (Figure 5 and Table 1). The formation of 13C-acetyl-L-carnitine was shown to be solely dependent on 13C-palmitate by demonstrating zero production of 13C-acetyl-L-carntine in the presence of 12C-palmitate (data not shown). The addition of 1.2 mmol/L 13C-palmitate caused an accumulation of 235±6 {rho}g/µL 13C-acetyl-L-carnitine after 60 minutes. Preincubation with trimetazidine (10 to 300 µmol/L) had no effect on the accumulation of 13C-acetyl-L-carnitine. Preincubation with ranolazine (10 to 300 µmol/L), however, caused a dose-dependent inhibition of the accumulation of 13C-acetyl-L-carnitine. Ranolazine (100 µmol/L) reduced ß-oxidation of 13C-palmitate by {approx}12% (P<0.05), whereas 300 µmol/L ranolazine caused a {approx}30% attenuation (P<0.001). The selective CPT-I inhibitor, oxfenicine, shown previously to inhibit ß-oxidation,34 was used as a positive control to validate the assay and detection systems. Oxfenicine (10 µmol/L) significantly attenuated the accumulation of 13C-acetyl-L-carnitine by {approx}67% (P<0.001), confirming that this assay system is sensitive to inhibitors of mitochondrial fatty acid metabolism.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 5. Effect of trimetazidine (TMZ), ranolazine, and oxfenicine (OX) on 13C-acetyl-L-carnitine accumulation in Girardi cells. *P<0.05 vs vehicle; n=9 for vehicle and n=3 for compounds.


View this table:
[in this window]
[in a new window]
 
Table 1. Effects of Trimetazidine, Ranolazine, and Oxfenicine on 13C-Acetyl-L-Carnitine Accumulation in Girardi Cardiomyocytes

Trimetazidine Improves Cardiac Function
Isolated working rat hearts were subjected to a 20-minute period of global no-flow ischemia. The recovery of cardiac function in the presence of trimetazidine (10 µmol/L), ranolazine (20 µmol/L), and DCA (1 mmol/L) was followed during a 40-minute reperfusion period (Figure 6 and Table 2). There was no significant difference (P=0.926) in cardiac function during the preischemic baseline period between any of the treatment groups (data not shown). After a 20-minute period of no-flow ischemia, isolated hearts that were perfused with a buffer containing 5.5 mmol/L glucose recovered to values similar to those before ischemia. However, the addition of 1.2 mmol/L palmitate significantly depressed the postischemic recovery of cardiac function by {approx}70%. None of the compounds significantly changed heart rate, peak systolic pressure, developed pressure, cardiac output, or cardiac work during the preischemic period (data not shown). All three agents, however, significantly improved the recovery of cardiac function during the reperfusion period in the presence of 1.2 mmol/L palmitate (P<0.001 for area under the curve [AUC] values) (Table 2). At the end of the reperfusion period, hearts perfused with trimetazidine, ranolazine, or DCA recovered to a degree that was not significantly different to control hearts perfused in the absence of 1.2 mmol/L palmitate (P>0.05) (Figure 6). These data are in agreement with previous literature for trimetazidine9 and ranolazine35 under similar conditions, confirming that both trimetazidine and ranolazine are cardioprotective after exposure to a period of ischemia even under conditions of high circulating concentrations of FFA.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Effect of 1.2 mmol/L palmitate±trimetazidine/ranolazine/DCA on recovery of cardiac function in isolated working rat heart. Values are mean±SEM with 8 hearts per treatment group. Hearts were subjected to 20-minute global ischemia followed by reperfusion. All compounds had a significant effect (P<0.01) on cardiac work after ischemia compared with the control group glucose+palmitate.


View this table:
[in this window]
[in a new window]
 
Table 2. Effects of Trimetazidine, Ranolazine, and DCA on the Recovery of Cardiac Function in Isolated Working Rat Hearts After a 20-Minute Period of Global Ischemia

Discussion

The effectiveness of trimetazidine as an antianginal agent is undisputed: trimetazidine demonstrates equivalent antianginal efficacy to current therapy and additive efficacy in combination with current antianginal agents. Trimetazidine is also different from traditional antianginal therapy in that efficacy is not associated with any hemodynamic effects.13–16 However, the mechanism of trimetazidine’s action is unresolved. Recently, Kantor et al12 suggested that trimetazidine selectively inhibited LC 3-KAT and thereby reduced fatty acid oxidation. The aim of this study was to assess whether LC 3-KAT is the pharmacological target for trimetazidine, and to ascertain whether ranolazine, also referred to as a metabolic modulator or pFOXi, acts similarly. Importantly, our data demonstrate that trimetazidine and ranolazine are not inhibitors of LC 3-KAT.

We used recombinant human trifunctional protein complex in addition to a crude mitochondrial homogenate and protein isolated and purified from frozen rat heart tissue to assess the ability of these agents to inhibit LC 3-KAT. The assay systems used were confirmed to be measuring LC 3-KAT activity because they were CoA- and 3-ketoacyl CoA–dependent. We were unable to inhibit LC 3-KAT in any form with either trimetazidine or ranolazine over a wide concentration range (Figures 3 and 4Up). All forms of LC 3-KAT were, however, dose-dependently inhibited by acetyl CoA. Acetyl CoA serves as a sensor for the ß-oxidation pathway that will inhibit the continued flux through this system when products are plentiful. Thus, our ability to demonstrate a dose-dependent inhibition of all three forms of LC 3-KAT with acetyl CoA and the fact that this inhibition is dependent on the presence of CoA, confirms the assay is sensitive to agents that inhibit this particular enzyme. Additionally, we were able to detect inhibition of flux through ß-oxidation by using the known inhibitor of ß-oxidation, benzotript, further confirming that our assay system was sensitive to inhibition. Therefore, we have demonstrated (and in more than one species) that neither trimetazidine nor ranolazine exert their cardioprotective effects by selectively inhibiting LC 3-KAT. This directly contrasts with the published findings of Kantor et al.12

We therefore examined whether trimetazidine or ranolazine act to inhibit ß-oxidation via a different mechanism in a whole human cardiomyocyte assay. Girardi human atrial cells preferentially utilize glycolytic substrates. However, by incubating these cells with L-carnitine for 72 hours, we demonstrated, in a similar manner to Molstad et al,28 that substrate preference is shifted from a glycolytic to a fatty acid source. The assay assessed the overall flux through ß-oxidation by monitoring the linear oxidation of 13C-palmitate to 13C-acetyl-L-carnitine over a 60-minute time period. We used the standard CPT-I inhibitor, oxfenicine, to demonstrate the assay system was capable of detecting inhibitors of ß-oxidation. As illustrated in Figure 5 and Table 1, trimetazidine did not inhibit the accumulation of 13C-acetyl-L-carnitine up to concentrations of 300 µmol/L, demonstrating that in addition to not inhibiting LC 3-KAT, trimetazidine was unable to inhibit any other component of the ß-oxidation pathway as present in these cells. The pFOXi ranolazine did, however, demonstrate a partial inhibition of this process in a dose-dependent manner, albeit at higher concentrations than those associated with improvement in cardiac function in isolated organ preparations.36

Having demonstrated a lack of effect in whole cells, we then used the isolated working rat heart model to assess cardiac function in the presence of these agents. By using a modest period of global no-flow ischemia, coupled with a perfusion media that contains a high concentration of FFA (1.2 mmol/L palmitate), we have reproduced key elements of the pathology associated with cardiac ischemia in vivo. As a result, recovery of cardiac function, in this case expressed as cardiac work, was reduced by {approx}70% compared with that of hearts exposed to buffer containing zero FFA. In this model, therefore, cardiac dysfunction is driven by the presence of high concentrations of FFA. As such, it provides an excellent system for investigating agents thought to improve function by affecting fatty acid metabolism. This experimental paradigm was validated by demonstrating that DCA, a metabolic modulator known to increase pyruvate oxidation via activation of PDC, improved the recovery of function to control levels (in the absence of FFA). We have demonstrated that trimetazidine and ranolazine significantly improve the recovery of function to a similar extent as DCA, with no deleterious impact on heart rate or coronary blood flow. These data, therefore, suggest that trimetazidine and ranolazine are exerting their benefit by some mechanism other than causing coronary vasodilatation. It is acknowledged that concentrations of trimetazidine used in our working heart studies were in excess of free plasma concentrations necessary to achieve anti-anginal benefit in the clinic. These concentrations, however, are in agreement with previously published studies.9,35

Our data suggest, therefore, that the clinical efficacy associated with trimetazidine is associated with a mechanism of action unrelated to inhibition of any part of the ß-oxidation pathway, although various hypotheses exist in the literature. For example, others have suggested effects on intracellular calcium homeostasis through binding of trimetazidine to the mitochondrial permeability transition pore,20 although there is very little data to support this.

In summary, we demonstrate that although ranolazine may assist in the recovery of cardiac function after ischemia by acting as a pFOXi, it is not via inhibition of LC 3-KAT. Additionally, and in contrast to the findings of Kantor et al,12 we demonstrate that although trimetazidine does improve the recovery of cardiac function after a period of ischemia, it does not achieve this through inhibition of LC 3-KAT nor does it interfere with any component of ß-oxidation that we have assayed: pure and crude enzyme preparations and whole cell ß-oxidation. Trimetazidine and ranolazine failed to demonstrate inhibitory activity of LC 3-KAT at concentrations 10-fold greater than the concentrations used to demonstrate functional benefit in the working heart model. Further studies will be required to establish molecular targets for the significant antianginal effects of trimetazidine and ranolazine.

Acknowledgments

This work was funded by Pfizer Global Research and Development. The authors are grateful to Dr Bruce Middleton for his helpful, practical advice on purifying the trifunctional protein and discussion about its physiological role, Stephen Ballard for advice with all aspects of the biochemical analysis, Diane Harbison for her assistance with identification of trifunctional protein Incyte clones, David Fox, David Bull, Mel Glossop, and Dannielle Roberts for synthesis of reagents, and to Katrina Todd for her statistical planning and analysis of all experimental data.

Footnotes

Original received January 31, 2003; revision received April 24, 2003; accepted April 25, 2003.

References

1. Stanley WC, Lopaschuk GD, Hall JL, McCormack JG. Regulation of myocardial carbohydrate metabolism under normal and ischaemic conditions: potential for pharmacological interventions. Cardiovasc Res. 1997; 33: 243–257.[Free Full Text]

2. Lopaschuk GD. Optimising cardiac energy metabolism: a new approach to treating ischaemic heart disease. Eur Heart J Suppl. 1999; 1 (suppl): O32–O39.

3. Dennis SC, Gevers W, Opie LH. Protons in ischaemia: where do they come from, where do they go to? J Mol Cell Cardiol. 1991; 23: 1077–1086.[CrossRef][Medline] [Order article via Infotrieve]

4. Lopaschuk GD. Treating ischemic heart disease by pharmacologically improving cardiac energy metabolism. Am J Cardiol. 1998; 82: 14K–17K.[CrossRef][Medline] [Order article via Infotrieve]

5. Saddick M, Lopaschuk GD. Myocardial triglyceride turnover during reperfusion of isolated rat hearts subjected to a transient period of global ischaemia. J Biol Chem. 1992; 267: 3825–3831.[Abstract/Free Full Text]

6. McVeigh JJ, Lopaschuk GD. Dichloroacetate stimulation of glucose oxidation improves recovery of ischemic rat hearts. Am J Physiol. 1990; 29: H1079–H1085.

7. Broderick TL, Quinney HA, Barker CC, Lopaschuk GD. The beneficial effect of carnitine on mechanical recovery of rat hearts reperfused after a transient period of global ischemia is accompanied by a stimulation of glucose oxidation. Circulation. 1993; 87: 972–998.[Abstract/Free Full Text]

8. Lopaschuk GD, Wall SR, Olley PM Davies NJ. Etomoxir, a carnitine palmitoyltransferase I inhibitor, protects hearts from fatty acid-induced ischemic injury independent of changes in long chain acylcarnitine. Circ Res. 1998; 63: 1036–1043.

9. El Banani H, Bernard M, Baetz D, Cabanes E, Cozzone P, Lucien A, Feuvray D. Changes in intracellular sodium and pH during ischaemia-reperfusion are attenuated by trimetazidine: comparison between low- and zero-flow ischaemia. Cardiovasc Res. 2000; 47: 688–696.[Abstract/Free Full Text]

10. Fantini E, Demaison L, Sentex E, Grynberg A, Athias P. Some biochemical aspects of the protective effect of trimetazidine on rat cardiomyocytes during hypoxia and reoxygenation. J Mol Cell Cardiol. 1994; 26: 949–958.[CrossRef][Medline] [Order article via Infotrieve]

11. Lopaschuk GD, Kozak R. Trimetazidine inhibits fatty acid oxidation in the heart. J Mol Cell Cardiol. 1998; 30: A112.Abstract.

12. Kantor PF, Lucien A, Kozak R, Lopaschuk GD. The antianginal drug trimetazidine shifts cardiac energy metabolism from fatty acid oxidation to glucose oxidation by inhibiting mitochondrial long-chain 3-ketoacyl coenzyme A thiolase. Circ Res. 2000; 86: 580–588.[Abstract/Free Full Text]

13. Sellier P. The effects of trimetazidine on ergometric parameters in exercise-induced angina: controlled multicenter double blind versus placebo study. Arch Mal Coeur Vaiss. 1986; 79: 1331–1336.[Medline] [Order article via Infotrieve]

14. Dalla-Volta S, Maraglino G, Della-Vallentina P, Viena P, Desideri A. Comparison of trimetazidine with nifedipine in effort angina: a double blind crossover study. Cardiovasc Drugs Ther. 1990; 4 (suppl 4): 853–859.[CrossRef][Medline] [Order article via Infotrieve]

15. Detry JM, Sellier P, Pennaforte S, Cokkinos D, Dargie H, Mathes P. Trimetazidine: a new concept in the treatment of angina: comparison with propranolol in patients with stable angina. Trimetazidine European Multicentre Study Group. Br J Clin Pharmacol. 1994; 3: 279–288.

16. Manchanda SC, Krishnaswani S. Combination treatment with trimetazidine and diltiazem in stable angina pectoris. Heart. 1997; 78: 353–357.[Abstract/Free Full Text]

17. Coetzee WA, Enous R, Opie LH. Trimetazidine: effects on delayed afterdepolarization (DADs) and upstroke velocity of the action potential. Cardiovasc Drugs Ther. 1990; 4: 806–807.[Medline] [Order article via Infotrieve]

18. Guarnieri C, Muscari C. Beneficial effects of trimetazidine on mitochondrial function and superoxide production in the cardiac muscle. Cardiovasc Drugs Ther. 1990; 4: 814–815.[Medline] [Order article via Infotrieve]

19. Sentex E, Helies-Toussaint C, Rousseau D, Lucien A, Ferrary E, Grynberg A. Influence of trimetazidine on the synthesis of complex lipids in the heart and other target organs. Fund Clin Pharmacol. 2001; 15: 255–264.[CrossRef][Medline] [Order article via Infotrieve]

20. Morin D, Elimadi A, Sapena R, Crevat A, Carrupt PA, Testa B, Tillement JP. Evidence for the existence of [3H]-trimetazidine binding sites involved in the regulation of the mitochondrial permeability transition pore. Br J Pharmacol. 1998; 123: 1385–1394.[CrossRef][Medline] [Order article via Infotrieve]

21. McCormack JG, Barr RL, Wolff AA, Lopaschuk GD. Ranolazine stimulates glucose oxidation in normoxic, ischemic and reperfused ischemic rat hearts. Circulation. 1996; 93: 135–142.[Abstract/Free Full Text]

22. Wolff AA. MARISA: monotherapy assessment of ranolazine in stable angina. J Am Coll Cardiol. 2000; 35 (suppl A): 408A.Abstract.

23. Ferguson JJ III. Meeting highlights: American Heart Association Scientific Sessions 2001. Circulation. 2002; 105: e37–e41.

24. Carpenter K, Pollitt RJ, Middleton B. Human liver long chain 3-hydroxyacyl-coenzyme A dehydrogenase is a multifunctional membrane bound ß-oxidation enzyme of mitochondria. Biochem Biophys Res Commun. 1992; 183: 443–448.[CrossRef][Medline] [Order article via Infotrieve]

25. Wanders RJA, IJlst L, Poggi F, Bonnefont JP, Munnich A, Brivet M. Human trifunctional protein deficiency: a new disorder of mitochondrial fatty acid ß-oxidation. Biochem Biophys Res Commun. 1992; 188: 1139–1145.[CrossRef][Medline] [Order article via Infotrieve]

26. Osumi T, Hashimoto T. Purification and properties of mitochondrial and peroxisomal 3-hydroxyacyl-CoA dehydrogenase from rat liver. Arch Biochem Biophys. 1980; 203: 372–383.[CrossRef][Medline] [Order article via Infotrieve]

27. Bohmer T, Eiklid K, Jonson J. Carnitine uptake into human heart cells in culture. Biochim Biophys Acta. 1977; 465: 627–633.[Medline] [Order article via Infotrieve]

28. Molstad P, Bohmer T, Hovig T. Carnitine-induced uptake of L-carnitine into cells from an established cell line from human heart (CCL 27). Biochem Biophys Acta. 1978; 512: 557–565.[Medline] [Order article via Infotrieve]

29. Abdel-aleem S, Nada MA, Sayed-Ahmed M, Hendrickson SC, St Louis J, Walthall HP Lowe JE. Regulation of fatty acid oxidation by acetyl-CoA generated from glucose utilization in isolated myocytes. J Mol Cell Cardiol. 1996; 28: 825–833.[CrossRef][Medline] [Order article via Infotrieve]

30. Lopaschuck GD, Wambolt RB, Barr RL. An imbalance between glycolysis and glucose oxidation is a possible explanation for the detrimental effects of high levels of fatty acids during aerobic perfusion of ischemic hearts. J Pharmacol Exp Ther. 1993; 264: 135–144.[Abstract/Free Full Text]

31. Liu Q, Docherty JC, Rendell JCT, Clanachan AS. Lopaschuck G. High levels of fatty acids delay the recovery of intracellular pH and cardiac efficiency in post-ischemic hearts by inhibiting glucose oxidation. J Am Coll Cardiol. 2002; 39: 718–725.[Abstract/Free Full Text]

32. Eaton S, Middleton B, Bartlett K. Control of mitochondrial ß-oxidation: sensitivity of the trifunctional protein to [NAD+]/[NADH] and [acetyl-CoA]/[CoA]. Biochem Biophys Acta. 1998; 1429: 230–238.[CrossRef][Medline] [Order article via Infotrieve]

33. Hashimoto T, Shindo Y, Souri , M Baldwin G. A new inhibitor of fatty acid oxidation. J Biochem. 1996; 119: 1196–1201.[Abstract/Free Full Text]

34. Kong J, Rabkin S. Palmitate-induced apoptosis is mediated through CPT-1 but not influenced by glucose and insulin. Am J Physiol. 2002; 282: H717–H725.

35. McCormack JG, Stanley WC, Wolff AA. Ranolazine: a novel metabolic modulator for the treatment of angina. Gen Pharmacol. 1998; 30: 639–645.[Medline] [Order article via Infotrieve]

36. Gralinski MR, Black SC, Kilgore KS, Chou AY, McCormack JG, Lucchesi BR. Cardioprotective effects of ranolazine (RS-43285) in the isolated perfused rabbit heart. Cardiovasc Res. 1994; 28: 1231–1237.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
P. Wang, H. Fraser, S. G. Lloyd, J. J. McVeigh, L. Belardinelli, and J. C. Chatham
A Comparison between Ranolazine and CVT-4325, a Novel Inhibitor of Fatty Acid Oxidation, on Cardiac Metabolism and Left Ventricular Function in Rat Isolated Perfused Heart during Ischemia and Reperfusion
J. Pharmacol. Exp. Ther., April 1, 2007; 321(1): 213 - 220.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
L Belardinelli, J C Shryock, and H Fraser
Inhibition of the late sodium current as a potential cardioprotective principle: effects of the late sodium current inhibitor ranolazine
Heart, July 1, 2006; 92(suppl_4): iv6 - iv14.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
G. Fragasso, G. Perseghin, F. De Cobelli, A. Esposito, A. Palloshi, G. Lattuada, P. Scifo, G. Calori, A. Del Maschio, and A. Margonato
Effects of metabolic modulation by trimetazidine on left ventricular function and phosphocreatine/adenosine triphosphate ratio in patients with heart failure
Eur. Heart J., April 2, 2006; 27(8): 942 - 948.
[Abstract] [Full Text] [PDF]


Home page
J CARDIOVASC PHARMACOL THERHome page
P. Parang, B. Singh, and R. Arora
Metabolic Modulators for Chronic Cardiac Ischemia
Journal of Cardiovascular Pharmacology and Therapeutics, October 1, 2005; 10(4): 217 - 223.
[Abstract] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Saeedi, M. Grist, R. B. Wambolt, A. Bescond-Jacquet, A. Lucien, and M. F. Allard
Trimetazidine Normalizes Postischemic Function of Hypertrophied Rat Hearts
J. Pharmacol. Exp. Ther., July 1, 2005; 314(1): 446 - 454.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
L. Lee, J. Horowitz, and M. Frenneaux
Metabolic manipulation in ischaemic heart disease, a novel approach to treatment
Eur. Heart J., April 2, 2004; 25(8): 634 - 641.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
93/3/e26    most recent
01.RES.0000086943.72932.71v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MacInnes, A.
Right arrow Articles by Karran, E. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MacInnes, A.
Right arrow Articles by Karran, E. H.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ACETANILIDE
Related Collections
Right arrow Biochemistry and metabolism
Right arrow Energy metabolism
Right arrow Ischemic biology - basic studies
Right arrow Lipid and lipoprotein metabolism