Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2003;93:207-212
Published online before print July 17, 2003, doi: 10.1161/01.RES.0000086942.13523.88
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
93/3/207    most recent
01.RES.0000086942.13523.88v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lemarié, C. A.
Right arrow Articles by Lehoux, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lemarié, C. A.
Right arrow Articles by Lehoux, S.
Related Collections
Right arrow Remodeling
Right arrow Animal models of human disease
Right arrow Cell signalling/signal transduction
Right arrow Hypertension - basic studies
(Circulation Research. 2003;93:207.)
© 2003 American Heart Association, Inc.


Molecular Medicine

Pressure-Induced Vascular Activation of Nuclear Factor-{kappa}B

Role in Cell Survival

Catherine A. Lemarié, Bruno Esposito, Alain Tedgui, Stéphanie Lehoux

From Inserm U541, Hôpital Lariboisière, Paris, France.

Correspondence to Dr Stéphanie Lehoux, Inserm U541, Hôpital Lariboisière, 41, Boulevard de la Chapelle, 75010 Paris. E-mail lehoux{at}larib.inserm.fr


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The effects of mechanical factors on nuclear factor (NF)-{kappa}B activation and its potential functional roles have been very little explored in the intact vessel. Thus, we chose to study the regulation of NF-{kappa}B by intraluminal pressure using an organ culture model of mouse carotid arteries maintained at 80 or 150 mm Hg during 24 hours. Gel shift analysis revealed an increase in the DNA-binding capacity of NF-{kappa}B in vessels at high pressure compared with vessels at normal pressure (304±49%; P<0.001). This coincided with reduced levels of the endogenous NF-{kappa}B inhibitor I{kappa}B{alpha} in arteries at 150 mm Hg (52±7%; P<0.001), as detected by Western blot. To study the functional role of the pressure-induced activation of NF-{kappa}B, we evaluated the rate of apoptosis (TUNEL method) in carotid arteries cultured with or without an inhibitor peptide blocking nuclear translocation of NF-{kappa}B. No apoptosis was detected in control arteries either at 80 or 150 mm Hg. However, in the presence of the NF-{kappa}B inhibitor peptide, we observed apoptosis in vessels at 80 mm Hg (5±1%; P<0.001 versus untreated controls), which was markedly increased in vessels at 150 mm Hg (14±2%; P<0.001). These results were corroborated by immunohistochemical analysis showing positive staining for cleaved caspase 3 in vessels at 80 mm Hg treated with the NF-{kappa}B inhibitor peptide, which was additionally enhanced in treated vessels at 150 mm Hg. Our findings demonstrate that high intraluminal pressure activates NF-{kappa}B in arteries. Moreover, the activation of NF-{kappa}B seems to play a key role in preventing apoptosis in vascular cells, especially when vessels are exposed to high intraluminal pressure.


Key Words: mechanical stress • stretch • hypertension • vascular remodeling • apoptosis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mechanical forces are important regulators of blood vessel structure and function. The degree of stretch imposed on vascular smooth muscle cells (VSMCs), of which blood pressure is the major determinant, plays a key role in governing vessel wall shape and composition, such that any chronic alteration in stretch instigates adaptive responses leading to vascular remodeling. This process occurs as vascular stretch, sensed by VSMCs via cell-surface receptors, and initiates multiple intracellular pathways leading to gene transcription.1 There is strong evidence that the mitogen-activated protein kinases are activated in overstretched vessels and in hypertensive animals,2,3 but these pathways may not account for all vascular changes observed in hypertension.

Several reports indicate that the transcription factor nuclear factor (NF)-{kappa}B, which resides inactive and bound to the inhibitory protein I{kappa}B in the cytoplasm, is activated in vessels of hypertensive animals.4–10 Because most of these in vivo studies were carried out in animals made hypertensive by treatments bringing about high circulating levels of angiotensin II (Ang II), it is not known whether vascular NF-{kappa}B activation was attributable to the direct effect of elevated intraluminal pressure or resulted from the effect of Ang II. A direct pressure-dependent activation of NF-{kappa}B has been previously suggested by a study showing that cyclic stretch activates NF-{kappa}B in human coronary VSMCs in culture.11 However, the phenotype of VSMCs in culture is profoundly altered and differs markedly from that in vivo.12 The aim of the present study was therefore to investigate the effect of pressure on vascular NF-{kappa}B activation by using an organ culture model that reproduces in vivo mechanical conditions of hypertension and maintains VSMC phenotype.13 We also investigated downstream effects of stretch-induced NF-{kappa}B on cell survival.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Organ Culture
Male C57BL/6 mice between 8 and 10 weeks of age were euthanized by a lethal injection of sodium pentobarbital (50 mg/kg IP). Left and right carotid arteries were isolated, cannulated at both extremities, and immersed in an organ culture bath filled with DMEM (GIBCO BRL) containing antibiotics (100 UI/L penicillin, 100 mg/L streptomycin, and 10 µg/L fungizone) and supplemented with 5% FCS (Boehringer-Mannheim). Each arterial segment was connected to a closed-perfusion circuit described previously,14 consisting of a 3-port reservoir, a peristaltic pump (Alitea), and a pressure chamber allowing for the application of a controlled intraluminal hydrostatic pressure. Vessels were perfused from the proximal to the distal end at a flow set to renew the medium within the intraluminal space while creating minimal shear forces (0.5 dyne/cm2). Organ culture of the carotid segments was carried out under sterile conditions in an incubator containing 5% CO2 at 37°C.

Arterial segments were kept for 1 hour at an intraluminal pressure of 80 mm Hg for stabilization after surgery. Thereafter, the pressure was maintained at 80 mm Hg or reset to 150 mm Hg (corresponding to a 23% increase in vessel diameter) for 15 minutes to 24 hours. Some segments were treated with an NF-{kappa}B inhibitor peptide (AAVALLPAVLLALLP-VQRKRQKLMP, 50 µg/mL, Upstate Biotechnology) that binds the nuclear localization sequence on NF-{kappa}B and prevents its nuclear translocation. The inhibitor was added to the culture medium at the onset of the equilibration period. After organ culture, the arterial segments were removed from the organ culture bath and processed as described below.

Electrophoretic Mobility Shift Assay
Vessel segments were ground in ice-cold lysis buffer A containing 20 mmol/L HEPES (pH 7.9), 10 mmol/L KCl, 1 mmol/L EDTA, 0.2% NP-40, and 10% glycerol and protease inhibitors. Samples were centrifuged, and the nuclear pellets were extracted in 40 µL of buffer B containing 20 mmol/L HEPES (pH 7.9), 10 mmol/L KCl, 1 mmol/L EDTA, 0.35 mmol/L NaCl, and 10% glycerol and protease inhibitor.

A double-stranded oligonucleotide containing the consensus sequence AGTTGAGGGGACTTTCCCAGGC (Invitrogen Life Technologies) was end-labeled using [{gamma}-32P] ATP and T4 polynucleotide kinase (New England BioLabs). Probes were purified using centri-step spin columns (QIAquick Nucleotide Removal Kit, Qiagen). DNA binding reactions were performed using 1 µg protein and labeled oligonucleotide in the presence of incubation buffer (10 mmol/L HEPES [pH 8], 100 µmol/L EDTA, 0.05 mol/L NaCl, 0.05 mol/L KCl, 5 mmol/L MgCl2, 4 mmol/L spermidine, 2 mmol/L DTT, 0.1 mg/mL BSA, 5% glycerol, 8% Ficoll-400, and 1 µg/µL DidC) for 30 minutes on ice. Protein-DNA complexes were resolved in 6% acrylamide gels.

Western Blot
Vessel segments were ground in ice-cold lysis buffer containing 20 mmol/L Tris-HCl (pH 7.5), 5 mmol/L EGTA, 150 mmol/L NaCl, 20 mmol/L glycerophosphate, 10 mmol/L NaF, 1 mmol/L sodium orthovanadate, 1% Triton X-100, and 0.1% Tween 20 and protease inhibitors (Boehringer Mannheim). Detergent-soluble fractions were retained, and protein concentrations in samples were equalized using a Bradford protein assay (Bio-Rad). For Western blot analysis, lysates containing 10 µg of protein were electrophoresed on polyacrylamide gels and transferred to nitrocellulose membranes (Amersham ECL). Membranes were incubated with anti-I{kappa}B{alpha} or anti-I{kappa} polyclonal antibodies (Santa Cruz) overnight at 4°C. A polyclonal anti-actin antibody (Santa Cruz) was used to reprobe blots to confirm equal loading in lanes. For immunoprecipitation experiments, 30 µg of protein was incubated overnight at 4°C with 25 µL anti-phospho serine 536 NF-{kappa}B p65 antibody (Cell Signaling Technology) cross-linked to protein A-Sepharose (Amersham). Immunoprecipitated proteins were resolved as described above and blots incubated with anti-NF-{kappa}B p65 (Santa Cruz). An enhanced chemiluminescence system was used as the detection method (ECL+, Amersham).

Immunohistochemical Analysis
Arterial segments were embedded vertically in Tissu-tek (Sakura), and serial 15-µm sections were cut. DNA cleavage, a characteristic of apoptosis, was detected by the TUNEL method (TdT-mediated dUTP nick-end labeling) with ApopDetek kits (Enzo Diagnostic) according to the manufacturer’s instructions. Briefly, vessels sections were permeabilized and incubated with a TUNEL reaction mixture containing biotinylated-dUTP and TdT. After washing, slides were incubated with a mix of streptavidin, biotin, and peroxidase, and peroxidase was revealed by 3-amino-9-ethylcarbazol.

Caspases were detected using a polyclonal anticleaved caspase-3 antibody (Cell Signaling Technology) or a polyclonal caspase-3 antibody (Santa Cruz). Immunostains were visualized with the use of avidin-biotin horseradish peroxidase visualization systems (Vectastain ABC kit, Vector Laboratories).

Statistics
Data are presented as mean±SEM. A one-way ANOVA was constructed with data from Western blots and electrophoretic mobility shift assays, obtained by band density analysis using Image Gauge software (Fuji). Comparisons between segments originating from the same animal were performed by Student’s paired t test. A value of P<0.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Pressure Induces Degradation of I{kappa}B{alpha} but not I{kappa}
One of the key steps in the activation of the NF-{kappa}B pathway involves its translocation to the nucleus. In resting cells, NF-{kappa}B is bound in the cytoplasm by its inhibitor I{kappa}B, which masks the nuclear localization sequence on the transcription factor. Release and translocation of NF-{kappa}B first require phosphorylation and subsequent degradation of its inhibitor I{kappa}B.15 Thus, I{kappa}B degradation is a marker of NF-{kappa}B pathway activation.

We evaluated the protein levels of two common I{kappa}B isoforms, I{kappa}B{alpha} and I{kappa}Bß, in vessels maintained 24 hours in organ culture at 80 or 150 mm Hg. In arteries at high pressure, levels of I{kappa}B{alpha} were considerably reduced (52±7%; P<0.001) compared with levels found in vessels kept at physiological pressure (100%) (Figure 1A). This coincided with translocation of NF-{kappa}B from the cytoplasm to the nucleus, illustrated in Figure 1B, by increased protein content of the transcription factor in nuclear extracts from arteries at 150 mm Hg, as opposed to arteries at 80 mm Hg, whose NF-{kappa}B content was detected almost exclusively in the cytoplasmic extracts. In comparison, we observed no significant differences in protein levels of I{kappa}Bß between vessels maintained at normal and at high pressure (Figure 1A). It therefore appears that long-term regulation of vascular NF-{kappa}B activity by intraluminal pressure is predominantly attributable to decreased I{kappa}B{alpha} levels.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 1. Degradation of I{kappa}B{alpha} but not I{kappa}Bß is sufficient for nuclear translocation of NF-{kappa}B in vessels at high pressure during 24 hours. A, Representative Western blot showing reduced I{kappa}B{alpha} protein in carotid arteries kept at 150 mm Hg compared with arteries at 80 mm Hg (left). In contrast, protein levels of I{kappa}Bß do not differ significantly between arteries cultured at different pressures. Equal loading in lanes is verified by actin staining. Quantifications indicate mean±SEM for 11 experiments. ***P<0.001 vs 80 mm Hg. B, Protein levels of NF-{kappa}B p65 are greater in nuclear extracts from vessels at 150 mm Hg compared with vessels at 80 mm Hg, consistent with pressure-dependent translocation of NF-{kappa}B. Western blot is representative of 3 separate experiments.

Increased Phosphorylation and DNA Binding Capacity of NF-{kappa}B in Vessels at High Pressure
Degradation of I{kappa}B{alpha} is sufficient to cause translocation of NF-{kappa}B into the nucleus, but phosphorylation of NF-{kappa}B can also influence its transcriptional activity. Our data (Figure 2A) show that phosphorylation of serine 536 on the p65 subunit of NF-{kappa}B was induced in arteries at an intraluminal pressure of 150 mm Hg, compared with 80 mm Hg, by 320±74% (P<0.001).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Phosphorylation and DNA binding capacity of NF-{kappa}B is enhanced in carotid arteries maintained at high intraluminal pressure during 24 hours. A, Phosphorylation of the p65 subunit of NF-{kappa}B at serine 536 is enhanced in vessels in organ culture at 150 mm Hg compared with 80 mm Hg. Total protein content of p65 is not altered by pressure. B, Representative electrophoretic mobility shift assay shows enhanced binding of NF-{kappa}B to radiolabeled oligonucleotide probes as described in Materials and Methods. Histograms represent mean±SEM of 10 experiments. ***P<0.001 vs 80 mm Hg.

Furthermore, using electrophoretic mobility shift assay, we investigated the capacity of proteins from vessel nuclear extracts to interact with oligonucleotides containing a consensus binding sequence for NF-{kappa}B. We found that after 24 hours of organ culture at 150 mm Hg, the DNA-binding capacity of NF-{kappa}B from arterial extracts was significantly increased (304±49%; P<0.001) compared with extracts from vessels at 80 mm Hg (100%) (Figure 2B).

Kinetics of NF-{kappa}B Activation
Most known inducers of NF-{kappa}B cause rapid activation of the pathway in vitro. To verify whether the same holds true in whole vessels, a time course for pressure-induced NF-{kappa}B was established. After a 1-hour equilibration period at 80 mm Hg, vessel intraluminal pressure was maintained at 80 mm Hg or raised to 150 mm Hg for 15 minutes to 6 hours. High intraluminal pressure resulted in rapid degradation of I{kappa}B{alpha}, apparent within 15 minutes. Thereafter, I{kappa}B{alpha} levels rose, returning to control level at 1 hour before dropping again from 3 hours on (Figure 3A). In parallel, phosphorylation of NF-{kappa}B p65 on serine 536 peaked at 15 and 30 minutes after high-pressure onset, reaching levels equivalent to that observed at 24 hours (329±49% [P<0.01] and 315±71% [P<0.05], respectively). NF-{kappa}B phosphorylation abated at 1 hour but increased again subsequently (Figure 3B). Neither I{kappa}B{alpha} levels nor p65 phosphorylation was modified over the 6-hour time course in vessels maintained at 80 mm Hg (data not shown). These results indicate that NF-{kappa}B pathway induction is biphasic, characterized by a brief rapid peak terminating within 1 hour and a second more prolonged activation lasting at least 24 hours.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 3. Intraluminal pressure–induced NF-{kappa}B pathway activation is biphasic. A, Protein levels of I{kappa}B{alpha} are reduced within 15 minutes of high-pressure onset and remain low at 30 minutes. I{kappa}B{alpha} levels return to baseline at 1 hour but are reduced again thereafter. Equal loading in lanes is revealed by actin. B, Phosphorylation kinetics of the p65 subunit of NF-{kappa}B at serine 536 show an acute increase in phosphorylation at 15 minutes, maintained at 30 minutes, which becomes null at 1 hour but is reactivated at 3 and 6 hours. Blots and data (mean±SEM) are representative of 3 to 5 experiments. *P<0.05 and **P<0.01 vs 80 mm Hg (0 minutes).

Functional Role of NF-{kappa}B Activation
To assess the functional role of NF-{kappa}B activation, carotid arteries were cultured with or without an inhibitor peptide that binds to the nuclear localization sequence of NF-{kappa}B, preventing its translocation to the nucleus. TUNEL staining was used to reveal apoptotic nuclei in histological sections of vessels. No staining was detected in untreated vessels, independently of the intraluminal pressure at which they were kept (Figure 4). However, in arteries treated with the NF-{kappa}B inhibitor, we observed a significant level of TUNEL-positive staining; apoptosis was detected in 5±1% cells from vessels at 80 mm Hg (P<0.001 compared with untreated arteries) and rose to 14±2% cells in vessels at 150 mm Hg (P<0.001 compared with untreated arteries, P<0.001 compared with arteries at 80 mm Hg with NF-{kappa}B inhibitor) (Figure 4). Both endothelial cells and VSMCs showed signs of apoptosis at either pressure level (Figure 4). To confirm these findings, we performed immunohistochemical analysis to detect cleaved caspase 3, the active form of the proapoptotic enzyme caspase 3, in vessels treated with or without the NF-{kappa}B inhibitor peptide. In parallel with observations made in the TUNEL assay, there was no visible cleaved caspase 3 staining in untreated arteries, but staining was positive and pressure dependent in NF-{kappa}B inhibitor peptide-treated vessels, being moderate at 80 mm Hg and more pronounced at 150 mm Hg (Figure 5). Staining for the uncleaved form of caspase 3 was equivalent for all vessels regardless of intraluminal pressure level or inhibitor peptide treatment (online Figure 1, available at http://www.circresaha.org). Hence, NF-{kappa}B seems to be a protective factor for vascular cells both in physiological conditions and, even more markedly so, under conditions of high intraluminal pressure.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. NF-{kappa}B protects vascular cells from apoptosis. Carotid arteries were maintained in culture at 80 or 150 mm Hg, with or without treatment with an NF-{kappa}B inhibitor peptide blocking the nuclear translocation of NF-{kappa}B. Apoptosis was revealed in histological vessel sections using the TUNEL method. Positive staining for apoptotic cells was detected in endothelial cells (arrow) and VSMCs (arrowheads) of vessels cultured with the NF-{kappa}B inhibitor peptide at both levels of intraluminal pressure. No staining was observed in control vessels, cultured without the NF-{kappa}B inhibitor peptide. Histograms show a significant increase in the rate of apoptosis in vessels treated with the NF-{kappa}B inhibitor peptide and maintained at 80 or 150 mm Hg. Results are mean±SEM for 6 experiments. ***P<0.001 with vs without NF-{kappa}B inhibitor peptide at equivalent pressure level. §§§P<0.001, 80 vs 150 mm Hg, both with inhibitor peptide. Original magnification x90.



View larger version (90K):
[in this window]
[in a new window]
 
Figure 5. NF-{kappa}B prevents caspase 3 activation. Histological sections were obtained from carotid arteries maintained in culture at 80 or 150 mm Hg with or without an NF-{kappa}B inhibitor peptide. In arteries cultured without the peptide, no staining for cleaved caspase 3 was detected, irrespective of intraluminal pressure level. However, positive staining for cleaved caspase 3 appeared in vessels treated with the NF-{kappa}B inhibitor peptide, and staining intensity was enhanced in sections from arteries maintained at 150 mm Hg compared with 80 mm Hg. Original magnification x90.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The present study reveals that vessel overstretch induces NF-{kappa}B activation. Indeed, imposing a high intraluminal pressure (150 mm Hg) in carotid artery segments was associated with I{kappa}B{alpha} degradation and nuclear translocation of NF-{kappa}B, characterized by a rise in the DNA-binding capacity of the transcription factor. Furthermore, we show that NF-{kappa}B is essential to cell survival in conditions of normal pressure and even more so in vessels at high intraluminal pressure.

Multiple stimuli are known to activate NF-{kappa}B in the context of inflammation or apoptosis, such as cytokines, radical oxygen species, and vasoactive agonists. In comparison, little is known about the activation of NF-{kappa}B induced by mechanical stress, and most studies concern shear-induced rather than stretch-induced activation of NF-{kappa}B. Nevertheless, recent reports indicate that pulsatile stretch can activate NF-{kappa}B both in VSMCs11,16 and in endothelial cells.17,18 The present study differs from those reports in two crucial aspects. First, unlike our model consisting of whole vessel preparations, all previous works deal with cultured cells. Yet studying signal transduction of stretch in the whole vessel is particularly relevant because extracellular matrix composition is a key determinant of cell response1,19,20 and vascular cell phenotype, particularly differentiation state, is likely to influence cellular signaling and transcription factor activity.21,22 Second, this is the first report of NF-{kappa}B activation by mechanical stimuli that reproduces in vivo hypertensive conditions (steady elevated intraluminal pressure rather than cyclic stretch).

Vascular cell NF-{kappa}B activity has been shown to be increased in animal models of hypertension, induced by Ang II infusion, NG-nitro-L-arginine administration, deoxycorticosterone acetate salt treatment, or human renin and angiotensinogen expression or in cells from spontaneously hypertensive rats.4–10,23 However, these models used are characterized by high circulating levels of Ang II, itself a known activator of NF-{kappa}B, which could disguise a potential effect of pressure alone. This concept was in fact verified in Ang II–treated rats, where NF-{kappa}B activity was found to be equally high in the presence or absence of pressure-regulating cotreatment with hydralazine.5 Our results are thus unique because they demonstrate the effect of steady elevated pressure on the activation of NF-{kappa}B in isolated arteries, having differentiated cells in their native multicellular and matrix environment, and independent of external hormonal influences. A role for Ang II in the activation of NF-{kappa}B at 24 hours in our model remains possible, because high intraluminal pressure induces tissular release of Ang II in cultured arteries,24 but it is unlikely to contribute in the early onset of NF-{kappa}B activation observed at 15 and 30 minutes.

In resting cells, NF-{kappa}B is sequestered in the cytoplasm in an inactive complex bound to an inhibitor protein, I{kappa}B. Degradation of I{kappa}B allows translocation of NF-{kappa}B to the nucleus, where it is active. All known inducers of NF-{kappa}B cause degradation of I{kappa}B{alpha}, but in some cell types only a restricted number of inducers affect I{kappa}Bß.25 Furthermore, rapid and transient inducers of NF-{kappa}B tend to induce I{kappa}B{alpha}, consistent with our observations in acute experiments, whereas persistent activators of NF-{kappa}B induce both types.26 Activation of the NF-{kappa}B pathway by cyclic mechanical strain in cardiomyocytes was shown to be inhibited by a dominant-negative mutant of I{kappa}B{alpha}, but the eventual role of I{kappa}Bß was not explored.27 In the present study, we found that in vascular cells, 24-hour steady stretch–induced NF-{kappa}B activation coincided with degradation of I{kappa}B{alpha} but not I{kappa}Bß. Clearly, this was sufficient to release NF-{kappa}B from inhibitory constraint and allow its translocation from the cytoplasm to the nucleus. To our knowledge, this is the first report showing differential regulation of these I{kappa}B isoforms by stretch in vascular cells.

Translocation of NF-{kappa}B is a recognized step leading to its transcriptional activity, but phosphorylation of NF-{kappa}B may also regulate this factor. Indeed, there are several reports of NF-{kappa}B being phosphorylated in response to activating stimuli,15 and this course of action seems to increase the transcriptional activity of NF-{kappa}B by strengthening its interaction with the transcriptional coactivator CBP/p300 in the nucleus.28 In cultured vessels, we detected a pressure-dependent increase in the phosphorylation levels of the p65 subunit of NF-{kappa}B, both in the early phase of activation and in long-term experiments. These results therefore identify an additional process whereby stretch induces the NF-{kappa}B pathway in vascular cells.

NF-{kappa}B induces the transcription of a large range of genes implicated in inflammation but also genes related to apoptosis repression. Activation of NF-{kappa}B/Rel has been demonstrated to block apoptosis induced by cytokines, cytotoxic drugs, and radiation in different cell types both in vitro and in vivo.29 We found that in arteries treated with a peptide inhibitor of NF-{kappa}B, the rate of apoptosis rose from 5% at 80 mm Hg to 14% at 150 mm Hg. Concurrently, we found that immunostaining for active caspase 3 was positive in vessels treated with the inhibitor but negative in untreated segments. Thus, it seems that NF-{kappa}B plays a fundamental role in protecting VSMCs against apoptosis both in physiological conditions and in conditions of exaggerated vessel stretch and that this protective pathway is associated with caspase 3 inhibition.

Interestingly, in hypertension, the vascular wall remodels to adapt to the mechanical environment of elevated tensile stress. VSMCs undergo hypertrophy and hyperplasia and synthesize key extracellular matrix proteins to increase wall thickness and normalize this stress.1 In this context, NF-{kappa}B activation might be a protective mechanism that sustains VSMCs so that they may participate in the remodeling process.

In summary, this work shows that high pressure is able to activate the NF-{kappa}B pathway by degrading I{kappa}B{alpha} proteins, allowing for the nuclear translocation of NF-{kappa}B as well as inducing phosphorylation of the p65 subunit of the transcription factor. Pressure-induced activation of NF-{kappa}B may play a major role in vascular remodeling induced by hypertension that is basically aimed at adapting the vascular wall to altered mechanical stresses.


*    Acknowledgments
 
C.L. is the recipient of a scholarship from Servier International through the Groupe Paris Nord de Recherche en Pathologie Vasculaire.


*    Footnotes
 
Original received February 24, 2003; resubmission received June 23, 2003; accepted July 8, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 

  1. Lehoux S, Tedgui A. Signal transduction of mechanical stresses in the vascular wall. Hypertension. 1998; 32: 338–345.[Abstract/Free Full Text]
  2. Birukov KG, Lehoux S, Birukova AA, Merval R, Tkachuk VA, Tedgui A. Increased pressure induces sustained PKC-independent herbimycin A-sensitive activation of extracellular signal-regulated kinase 1/2 in the rabbit aorta in organ culture. Circ Res. 1997; 81: 895–903.[Abstract/Free Full Text]
  3. Xu QB, Liu YS, Gorospe M, Udelsman R, Holbrook NJ. Acute hypertension activates mitogen-activated protein kinases arterial wall. J Clin Invest. 1996; 97: 508–514.[Medline] [Order article via Infotrieve]
  4. Ammarguellat FZ, Gannon PO, Amiri F, Schiffrin EL. Fibrosis, matrix metalloproteinases, and inflammation in the heart of DOCA-salt hypertensive rats: role of ETA receptors. Hypertension. 2002; 39: 679–684.[Abstract/Free Full Text]
  5. Diep QN, El Mabrouk M, Cohn JS, Endemann D, Amiri F, Virdis A, Neves MF, Schiffrin EL. Structure, endothelial function, cell growth, and inflammation in blood vessels of angiotensin II–infused rats: role of peroxisome proliferator-activated receptor-{gamma}. Circulation. 2002; 105: 2296–2302.[Abstract/Free Full Text]
  6. Gonzalez W, Fontaine V, Pueyo ME, Laquay N, Messika-Zeitoun D, Philippe M, Arnal JF, Jacob MP, Michel JB. Molecular plasticity of vascular wall during NG-nitro-L-arginine methyl ester-induced hypertension: modulation of proinflammatory signals. Hypertension. 2000; 36: 103–109.[Abstract/Free Full Text]
  7. Kitamoto S, Egashira K, Kataoka C, Koyanagi M, Katoh M, Shimokawa H, Morishita R, Kaneda Y, Sueishi K, Takeshita A. Increased activity of nuclear factor-{kappa}B participates in cardiovascular remodeling induced by chronic inhibition of nitric oxide synthesis in rats. Circulation. 2000; 102: 806–812.[Abstract/Free Full Text]
  8. Muller C, Reddert A, Wassmann S, Strehlow K, Bohm M, Nickenig G. Insulin-like growth factor induces up-regulation of AT1-receptor gene expression in vascular smooth muscle cells. J Renin Angiotensin Aldosterone Syst. 2000; 1: 273–277.[Medline] [Order article via Infotrieve]
  9. Tummala PE, Chen XL, Sundell CL, Laursen JB, Hammes CP, Alexander RW, Harrison DG, Medford RM. Angiotensin II induces vascular cell adhesion molecule-1 expression in rat vasculature: a potential link between the renin-angiotensin system and atherosclerosis. Circulation. 1999; 100: 1223–1229.[Abstract/Free Full Text]
  10. Wu L, Juurlink BH. Increased methylglyoxal and oxidative stress in hypertensive rat vascular smooth muscle cells. Hypertension. 2002; 39: 809–814.[Abstract/Free Full Text]
  11. Hishikawa K, Oemar BS, Yang Z, Luscher TF. Pulsatile stretch stimulates superoxide production and activates nuclear factor-{kappa}B in human coronary smooth muscle. Circ Res. 1997; 81: 797–803.[Abstract/Free Full Text]
  12. Berk BC. Vascular smooth muscle growth: autocrine growth mechanisms. Physiol Rev. 2001; 81: 999–1030.[Abstract/Free Full Text]
  13. Birukov KG, Bardy N, Lehoux S, Merval R, Shirinsky VP, Tedgui A. Intraluminal pressure is essential for the maintenance of smooth muscle caldesmon and filamin content in aortic organ culture. Arterioscler Thromb Vasc Biol. 1998; 18: 922–927.[Abstract/Free Full Text]
  14. Bardy N, Karillon GJ, Merval R, Samuel J-L, Tedgui A. Differential effects of pressure and flow on DNA and protein synthesis, and on fibronectin expression by arteries in a novel organ culture system. Circ Res. 1995; 77: 684–694.[Abstract/Free Full Text]
  15. Karin M, Ben-Neriah Y. Phosphorylation meets ubiquitination: the control of NF-{kappa}B activity. Annu Rev Immunol. 2000; 18: 621–663.[CrossRef][Medline] [Order article via Infotrieve]
  16. Chaqour B, Howard PS, Richards CF, Macarak EJ. Mechanical stretch induces platelet-activating factor receptor gene expression through the NF-{kappa}B transcription factor. J Mol Cell Cardiol. 1999; 31: 1345–1355.[CrossRef][Medline] [Order article via Infotrieve]
  17. Du W, Mills I, Sumpio BE. Cyclic strain causes heterogeneous induction of transcription factors, AP-1, CRE binding protein and NF-{kappa}B, in endothelial cells: species and vascular bed diversity. J Biomech. 1995; 28: 1485–1491.[CrossRef][Medline] [Order article via Infotrieve]
  18. Matsushita H, Lee KK, Tsao PS. Cyclic strain induces reactive oxygen species production via an endothelial NAD(P)H oxidase. J Cell Biochem. 2001; 81: 99–106.[CrossRef]
  19. Reusch P, Wagdy H, Reusch R, Wilson E, Ives HE. Mechanical strain increases smooth muscle and decreases nonmuscle myosin expression in rat vascular smooth muscle cells. Circ Res. 1996; 79: 1046–1053.[Abstract/Free Full Text]
  20. Wilson E, Sudhir K, Ives HE. Mechanical strain of rat vascular smooth muscle cells is sensed by specific extracellular matrix/integrin interactions. J Clin Invest. 1995; 96: 2364–2372.[Medline] [Order article via Infotrieve]
  21. Thum T, Haverich A, Borlak J. Cellular dedifferentiation of endothelium is linked to activation and silencing of certain nuclear transcription factors: implications for endothelial dysfunction and vascular biology. FASEB J. 2000; 14: 740–751.[Abstract/Free Full Text]
  22. Lindner V. The NF-{kappa}B and I{kappa}B system in injured arteries. Pathobiology. 1998; 66: 311–320.[CrossRef][Medline] [Order article via Infotrieve]
  23. Ruiz-Ortega M, Lorenzo O, Ruperez M, Blanco J, Egido J. Systemic infusion of angiotensin II into normal rats activates nuclear factor-{kappa}B and AP-1 in the kidney: role of AT1 and AT2 receptors. Am J Pathol. 2001; 158: 1743–1756.[Abstract/Free Full Text]
  24. Bardy N, Merval R, Benessiano J, Samuel J-L, Tedgui A. Pressure and angiotensin II synergistically induce aortic fibronectin expression in organ culture model of rabbit aorta: evidence for a pressure-induced tissue renin-angiotensin system. Circ Res. 1996; 79: 70–78.[Abstract/Free Full Text]
  25. Ghosh S, May MJ, Kopp EB. NF-{kappa}B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol. 1998; 16: 225–260.[CrossRef][Medline] [Order article via Infotrieve]
  26. Thompson JE, Phillips RJ, Erdjument-Bromage H, Tempst P, Ghosh S. I{kappa}B-ß regulates the persistent response in a biphasic activation of NF-{kappa}B. Cell. 1995; 80: 573–582.[CrossRef][Medline] [Order article via Infotrieve]
  27. Yamamoto K, Dang QN, Kennedy SP, Osathanondh R, Kelly RA, Lee RT. Induction of tenascin-C in cardiac myocytes by mechanical deformation: role of reactive oxygen species. J Biol Chem. 1999; 274: 21840–21846.[Abstract/Free Full Text]
  28. Zhong H, Su Yang H, Erdjument-Bromage H, Tempst P, Ghosh S. The transcriptional activity of NF-{kappa}B is regulated by the I{kappa}B-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell. 1997; 89: 413–424.[CrossRef][Medline] [Order article via Infotrieve]
  29. Karin M, Lin A. NF-{kappa}B at the crossroads of life and death. Nat Immunol. 2002; 3: 221–227.[CrossRef][Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
A. Billon, S. Lehoux, L. Lam Shang Leen, H. Laurell, C. Filipe, V. Benouaich, L. Brouchet, C. Dessy, P. Gourdy, A.-P. Gadeau, et al.
The Estrogen Effects on Endothelial Repair and Mitogen-Activated Protein Kinase Activation Are Abolished in Endothelial Nitric-Oxide (NO) Synthase Knockout Mice, but Not by NO Synthase Inhibition by N-Nitro-L-arginine Methyl Ester
Am. J. Pathol., March 1, 2008; 172(3): 830 - 838.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Riou, B. Mees, B. Esposito, R. Merval, J. Vilar, D. Stengel, E. Ninio, R. van Haperen, R. de Crom, A. Tedgui, et al.
High Pressure Promotes Monocyte Adhesion to the Vascular Wall
Circ. Res., April 27, 2007; 100(8): 1226 - 1233.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. Ohtani, K. Egashira, K. Nakano, G. Zhao, K. Funakoshi, Y. Ihara, S. Kimura, R. Tominaga, R. Morishita, and K. Sunagawa
Stent-Based Local Delivery of Nuclear Factor-{kappa}B Decoy Attenuates In-Stent Restenosis in Hypercholesterolemic Rabbits
Circulation, December 19, 2006; 114(25): 2773 - 2779.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. M. Kouri and O. Eickelberg
Transforming Growth Factor-{alpha}, a Novel Mediator of Strain-Induced Vascular Remodeling
Circ. Res., August 18, 2006; 99(4): 348 - 350.
[Full Text] [PDF]


Home page
Circ. Res.Home page
C. A. Lemarie, P.-L. Tharaux, B. Esposito, A. Tedgui, and S. Lehoux
Transforming Growth Factor-{alpha} Mediates Nuclear Factor {kappa}B Activation in Strained Arteries
Circ. Res., August 18, 2006; 99(4): 434 - 441.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
V. de Waard, E. K. Arkenbout, M. Vos, A. I.M. Mocking, H. W.M. Niessen, W. Stooker, B. A.J.M. de Mol, P. H.A. Quax, E. N.T.P. Bakker, E. VanBavel, et al.
TR3 Nuclear Orphan Receptor Prevents Cyclic Stretch-Induced Proliferation of Venous Smooth Muscle Cells
Am. J. Pathol., June 1, 2006; 168(6): 2027 - 2035.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Douillette, A. Bibeau-Poirier, S.-P. Gravel, J.-F. Clement, V. Chenard, P. Moreau, and M. J. Servant
The Proinflammatory Actions of Angiotensin II Are Dependent on p65 Phosphorylation by the I{kappa}B Kinase Complex
J. Biol. Chem., May 12, 2006; 281(19): 13275 - 13284.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. Tedgui and Z. Mallat
Cytokines in Atherosclerosis: Pathogenic and Regulatory Pathways
Physiol Rev, April 1, 2006; 86(2): 515 - 581.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Csiszar, K. E. Smith, A. Koller, G. Kaley, J. G. Edwards, and Z. Ungvari
Regulation of Bone Morphogenetic Protein-2 Expression in Endothelial Cells: Role of Nuclear Factor-{kappa}B Activation by Tumor Necrosis Factor-{alpha}, H2O2, and High Intravascular Pressure
Circulation, May 10, 2005; 111(18): 2364 - 2372.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. Lehoux, B. Esposito, R. Merval, and A. Tedgui
Differential Regulation of Vascular Focal Adhesion Kinase by Steady Stretch and Pulsatility
Circulation, February 8, 2005; 111(5): 643 - 649.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. Tedgui and Z. Mallat
Hypertension: A Novel Regulator of Adaptive Immunity in Atherosclerosis?
Hypertension, September 1, 2004; 44(3): 257 - 258.
[Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Huang, R. D. Kamm, and R. T. Lee
Cell mechanics and mechanotransduction: pathways, probes, and physiology
Am J Physiol Cell Physiol, July 1, 2004; 287(1): C1 - C11.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. W. Raines, K. J. Garton, and N. Ferri
Beyond the Endothelium: NF-{kappa}B Regulation of Smooth Muscle Function
Circ. Res., April 2, 2004; 94(6): 706 - 708.
[Full Text] [PDF]


Home page
CirculationHome page
S. Lehoux, C. A. Lemarie, B. Esposito, H. R. Lijnen, and A. Tedgui
Pressure-Induced Matrix Metalloproteinase-9 Contributes to Early Hypertensive Remodeling
Circulation, March 2, 2004; 109(8): 1041 - 1047.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
F. Aoudjit and J. Sevigny
P21Waf1/Cip1 in endothelial cell survival
Cardiovasc Res, March 1, 2004; 61(4): 648 - 650.
[Full Text] [PDF]


Home page
Circ. Res.Home page
S. Lehoux and A. Tedgui
All Strain, No Gain: Stretch Keeps Proliferation at Bay via the NF-{kappa}B Response Gene iex-1
Circ. Res., December 12, 2003; 93(12): 1139 - 1141.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
93/3/207    most recent
01.RES.0000086942.13523.88v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
<