Published online before print June 12, 2003, doi: 10.1161/01.RES.0000080933.82105.29
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2003 American Heart Association, Inc.
Molecular Medicine |
Shear Stress–Mediated Chromatin Remodeling Provides Molecular Basis for Flow-Dependent Regulation of Gene Expression
From Laboratorio di Biologia Vascolare e Terapia Genica (B.I.), Centro Cardiologico Fondazione "I. Monzino," IRCCS, Milan; Centro Cardiologico Fondazione "I. Monzino" (B.I., P.B.), IRCCS, Milan; Laboratorio di Oncogenesi Molecolare (S.N, A.F.), Istituto Regina Elena, Rome; Laboratorio di Patologia Vascolare (A.S., M.C.C., C.G.), Istituto Dermopatico dell’Immacolata, IRCCS, Rome; and Istituto di Neurobiologia e Medicina Molecolare (A.F.), CNR, Rome, Italy.
Correspondence to Carlo Gaetano, MD, Laboratorio di Patologia Vascolare, IDI-IRCCS, Via dei Monti di Creta 104, 00167 Rome, Italy. E-mail gaetano{at}idi.it
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Shear stress (SS), the tangential component of hemodynamic forces, modulates the expression of several genes in endothelial cells. However, no information is available about its effect on chromatin structure, which plays a key role in gene transcription. In this study, a link between SS and chromatin remodeling was established in human umbilical vein endothelial cells (HUVECs). HUVECs were exposed to SS of 10 dyne/cm2 per second, in the presence or absence of the histone deacetylase inhibitor trichostatin A, and assayed for histone H3 and histone H4 modifications. SS induced histone H3 serine phosphorylation at position 10 (S10) and lysine acetylation at position 14 (K14) but required trichostatin A to induce H3 phosphoacetylation and H4 acetylation. The phosphatidylinositol 3-kinase inhibitor wortmannin and the mitogen-activated protein kinase inhibitor PD98059 decreased SS-dependent histone H3 phosphorylation, without affecting its acetylation; the p38 inhibitor SB203580 reduced both H3 phosphorylation and acetylation, whereas the protein kinase A inhibitor PKI-tide reduced histone H3 acetylation. Remarkably, the abrogation of histone acetylation inhibited SS-dependent c-fos expression. SS also activated ribosomal S6 kinase-2 and mitogen- and stress-activated kinase-1 protein kinases and promoted the formation of a cAMP-responsive element–binding protein (CREB)/CREB-binding protein complex, providing the molecular basis for the increase in histone acetyltransferase activity observed in HUVECs exposed to SS. Finally, the effect of SS on chromatin remodeling was examined. In HUVECs exposed to SS, chromatin within c-fos and c-jun promoters was specifically immunoprecipitated by an antibody against acetylated histone H3 on K14. These results indicate that SS induces posttransduction modifications of histones; this is an early step toward the flow-dependent regulation of gene expression.
Key Words: gene expression • histone acetylation • histone phosphorylation • chromatin • endothelial cells
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Shear stress (SS) modulates endothelial cell (EC) function through mechanosensors, which activate intracellular signaling pathways, leading to the transcription of specific genes. Vascular endothelial growth factor (VEGF) receptor-2, focal adhesion kinase, and the integrins
vß1, ß3, and ß5 have been identified as important components of the SS mechanotransduction machinery.1–3 In response to SS, the intracellular protein kinases src and focal adhesion kinase become activated and interact with docking proteins grb-2, shc, and paxillin,4 stimulating downstream mitogen-activated protein kinases (MAPKs).5 MAPKs modulate the function of transcription factors (TFs)6 and lead to the transcriptional induction of immediate-early genes.1,7 Activated TFs interact with specific SS response elements, which are present in the promoter region of many SS-responsive genes modulating their expression.8 In fact, SS activates nuclear factor-
B,9,10 the cAMP-responsive element–binding protein (CREB)11 and activator protein-1,9,12 regulating the expression of many endothelial genes. Moreover, Smad proteins have been recently identified as a novel class of SS-dependent TFs, but their role in flow-regulated gene expression remains unclear.13,14 Transcriptional regulation of gene expression is primarily modulated by the accessibility of chromatin to TFs, and recent observations indicate that modifications in the chromatin structure are required for the expression of several genes.15 Chromatin structure depends on the activity of histone-modifying enzymes, including histone acetyltransferases (HATs) and histone deacetylases (HDACs).15,16 HATs catalyze the addition of acetyl groups to specific lysines (K) present in the histone tails, disrupting nucleosome interactions and allowing the transcriptional machinery to access DNA. Yeast GCN5, mammalian CREB-binding protein (CBP)/p300 and P/CAF, and some important component of the basal transcription machinery, as well as the TBP-associated factor II 250, belong to this family and exhibit intrinsic HAT activity.15,16 Conversely, gene silencing is provided by histone deacetylation and methylation. HDACs and histone methyltransferases, like the yeast suppressor of variegation [Su(var)] group,15 catalyze, respectively, the substraction of acetyl groups and the addition of methyl groups to histones, switching DNA from a euchromatic to an etherochromatic state in which TFs do not recognize their cognate response elements on target promoters.16 Recently, histone phosphorylation has been identified as an additional chromatin modification involved in the transcriptional control of gene expression. This activity is, at least in part, dependent on the function of the ribosomal S6 kinase-2 (RSK-2), a member of the pp90rsk family of kinases, which is known to regulate gene expression in response to mitogens,17,18 and on mitogen- and stress-activated kinase-1 (MSK-1), making histones susceptible to hyperacetylation by HATs.19 Although a number of physiological and pharmacological stimuli17,19,20 are known to regulate histone modifications, no prior studies have examined the effect of mechanical forces on chromatin remodeling. The present study shows that SS induces histone H3 acetylation and phosphorylation and cooperates with the HDAC inhibitor trichostatin A (TSA) to enhance histone H3 phosphoacetylation and histone H4 acetylation. These changes at the level of histones provide the molecular basis for those chromatin modifications required for DNA unwinding and may play a fundamental role in the SS-dependent regulation of gene expression.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell Culture, Treatments, and SS Exposure
Human umbilical vein ECs (HUVECs) were grown in endothelial growth medium-2 (EGM-2, Clonetics). TSA (32 nmol/L) and 10 ng/mL of recombinant VEGF and fibroblast growth factor (FGF)-2 or an equal amount of control solvent were added to complete medium, and the cells were immediately exposed to SS in a cone-plate apparatus2 or kept in a static condition (ST). Wortmannin (50 nmol/L), PD98059 (50 µmol/L), SB203580 (5 µmol/L), and PKI-tide (5 µmol/L, a protein kinase A inhibitor) or equal amount of control solvent were added 30 minutes before SS exposure to endothelial basal medium-2 (EBM-2, Clonetics) supplemented with 2% FBS after an overnight starvation of cells in EBM-2 supplemented with 0.5% FBS.
Western Blots
Total protein extracts were obtained by lysing cells with 1x Laemmli buffer. Modified histones were detected with anti–acetylated histone H3K14, anti–acetylated histone H4, anti–phosphohistone H3S10, anti–phosphoS10-acetylK14 histone H3 (Upstate Biotechnology), anti–c-fos (Santa Cruz), anti–phospho-RSK-2(Ser380), and anti–phospho-MSK1(Ser376) (Cell Signaling) antibodies, according to the manufacturer’s instructions. Normalization of protein loading was obtained using an anti–GRB-2 antibody (Santa Cruz), anti-histone H1 antibody (Upstate Biotechnology), and anti–RSK-2 and anti-MSK-1 antibodies (Cell Signaling). For detailed protocol, see online data supplement (available at http://www.circresaha.org).
Pull-Down Assay
Cells were exposed to SS for 1 hour or kept in ST. Nuclear extracts were obtained as previously described21 and incubated with 5'-biotinylated oligonucleotides containing a CREB site (see online supplemental data for detailed protocol).
Oligonucleotide sequences were as follows: AGAGATTGCCTGACGTCAGAGAGCTAG and CTAGCTCTCTGACGTCAGGCAATCTCT. Bound complexes were boiled in 1x Laemmli buffer and detected with anti-CREB and anti-CBP antibodies (Santa Cruz), according to manufacturer’s instructions.
In Vitro Acetylation Assay
Whole-cell extracts were obtained as described.2 HAT activity was detected using the HAT-check activity assay kit (Pierce) according to the manufacturer’s instructions. The amount of radiolabeled H4 peptide was measured using a liquid scintillation counter (TRI-CARB, Packard). See online supplemental data for detailed protocol.
ChIp Assay
HUVECs (3x107 cells) were starved overnight in EBM-2 supplemented with 0.5% FBS. The day after, medium was replaced with EBM-2 supplemented with 2% FBS, and HUVECs were exposed to SS for 60 minutes or kept in ST. Chromatin immunoprecipitation (ChIp) was performed as described.22 A primer pair, GGGTTGACTGGTAGCAGATAAGTGTTGAG and TCTGGGCAGTTAGAGAGAAGGTGAAAAG, was used to amplify a 200-bp promoter fragment of c-jun. Another primer pair, GCAGCCGGGCGGCCGCAGAA and GTCTCGACCCATCCTCGTGCC, was used to amplify a 216-bp promoter fragment of c-fos.
Statistical Analysis
Results were analyzed by 1-way ANOVA. Post hoc tests according to the Student-Newman-Keuls method were used to assess statistically significant differences among different groups. A value of P<0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
SS Induces Phosphorylation of Histone H3 and Acetylation of Histones H3 and H4
The effect of SS on histone modifications was examined by Western blot analyses using protein extracts obtained from HUVECs exposed to a laminar SS of 10 dyne/cm2 per second for 30 to 240 minutes or kept in ST, either in the presence or absence of TSA. The pattern of histone H3 phosphorylation was first evaluated because histone H3 phosphorylation and phosphoacetylation account for chromatin modifications in response to extracellular stimuli.15 In the presence of SS, histone H3 became phosphorylated within 30 minutes (Figure 1A). Surprisingly, in cells treated with TSA, the level of phosphorylation was weaker (Figure 1A, right). It has been reported that in case of multiple modifications, the epitope recognized by the anti–phospho H3 antibody at position 10 (S10) may be masked by the acetyl group at position 14 (K14), making antibody binding to the phosphorylated epitope less efficient.19 To verify whether in our experimental conditions histone H3 was simultaneously phosphorylated on S10 and acetylated on K14, we performed Western blot analyses using an anti–phospho-acetyl histone H3 antibody. We found that this histone became both phosphorylated and acetylated in HUVECs treated with TSA and exposed to SS (Figure 1B). Phosphorylation and acetylation of histones are regulated by coordinated but independent mechanisms23; therefore, the level of histone H3 acetylation alone was also analyzed. SS stimulated histone H3 acetylation on K14 with a peak between 60 and 120 minutes, and this phenomenon was further increased in the presence of TSA (Figure 1C). In addition, the acetylation level of the histone H4, which, together with H3, constitutes the inner scaffold of nucleosomes, was evaluated.16 Notably, in ECs treated with TSA, histone H4 resulted acetylated in ST and SS further enhanced this modification at all time points (Figure 1D).
|
These data indicate that SS enhances histone H3 acetylation and phosphorylation, whereas it requires the inhibition of HDAC activity to increase H3 phosphoacetylation and H4 acetylation, suggesting that distinct molecular mechanisms may underlie these processes. Similar modifications, although occurring with a different temporal pattern, were observed in cells treated with growth factors (GFs) (see online data supplement), indicating that, at least in part, SS and GFs rely on common signaling pathways.
Because histone H3 phosphorylation and acetylation observed under SS conditions were independent of TSA administration, they were examined in greater detail.
ERK 1/2, p38, and PKA Play Distinct Roles in SS-Dependent Histone Modification: Effect on c-fos Gene Expression
SS activates multiple signal transduction molecules, such as the ras/extracellular signal–regulated kinase (ERK 1/2),5 phosphatidylinositol 3-kinase (PI3K)/Akt,24 and p38 MAPK25 and induces the expression of a number of early genes, including the proto-oncogene c-fos.6,7 To characterize those signaling pathways responsible for histone modifications, we used specific kinase inhibitors and evaluated their effect on the modulation of SS-dependent histone H3 phosphorylation and acetylation. During these experiments, c-fos protein levels were assessed to investigate the effect of kinase inhibitors on early gene expression. All experiments were performed at the 120-minute time point, and GRB-2 was used to normalize protein loading. The PI3K-inhibitor wortmannin (Figure 2A) and the ERK 1/2 inhibitor PD98059 (Figure 2B) reduced 
2-fold the SS-dependent enhancement of histone H3 phosphorylation without affecting either its acetylation or c-fos expression. In contrast, the p38 inhibitor SB203580 diminished 3-fold the histone H3 phosphorylation, and this phenomenon was paralleled by a c-fos downregulation of 4-fold (Figure 2C). These results are in agreement with previous data demonstrating that histone H3 phosphorylation and c-fos induction may depend on the activity of different classes of MAPKs. Remarkably, histone H3 acetylation was strongly diminished (3-fold) in HUVECs treated either with SB203580 (Figure 2C) or the PKA inhibitor PKI-tide (Figure 2C). PKA inhibition had no effect on H3 phosphorylation but reduced (3-fold) c-fos expression (Figure 2D).
|
These data suggest that SS-dependent phosphorylation and acetylation of histones are independently regulated by different signaling pathways.23
RSK-2 and MSK-1 Are Activated by SS
Phosphorylation of histone H3 on S10 depends on RSK-2 and/or MSK-1 kinase activity.17,26 Moreover, MSK-1 may mediate CREB activation,27 which, recruiting CBP, could enhance histone acetylation. Phosphorylation of RSK-2 depends on ERK 1/2 signaling, whereas the phosphorylation of MSK-1 relies either on ERK 1/2 or p38 kinase activity.26 Because in our experiments the p38 inhibitor SB203580 interfered either with H3 phosphorylation or acetylation, experiments were performed in the presence of SB203580 to evaluate RSK-2 and MSK-1 activation in HUVECs exposed to SS or kept in ST. Western blot analysis indicates that after 30 minutes of SS, RSK-2 and MSK-1 became phosphorylated at serine residues 380 and 376, respectively. This event was transient, and the signal rapidly decreased between 30 and 60 minutes. As expected, inhibition of p38 activity by SB203580 treatment did not alter RSK-2 activation in the presence of SS (Figure 3A), whereas MSK-1 phosphorylation at serine residue 376 was completely abolished. Phosphorylation of MSK-1 and RSK-2 in the presence of SS was apparently limited to serines 376 and 380, respectively, inasmuch as no detectable signals were obtained from other serine and threonine residues known as phosphorylation targets in these molecules (not shown). These results suggest that although the ERK 1/2 pathway may regulate H3 phosphorylation via RSK-2 activation, p38 and MSK-1 could be mainly involved in H3 phosphorylation and acetylation.
|
SS Stimulates Formation of CREB/CBP Transcriptional Complex and Enhances HAT Activity in ECs
The expression of c-fos depends on CREB transcriptional activity,28 which is activated by PKA. Because we observed that inhibition of PKA activity strongly interfered with c-fos expression (Figure 2D), we reasoned that CREB transcriptional complexes could be activated by SS. To demonstrate this hypothesis, we performed a pull-down assay on nuclear extracts derived from HUVECs exposed to SS or kept in ST. Figure 4 shows that in the presence of SS, CREB recruits the CREB-binding protein CBP and this complex binds to a synthetic cAMP response element (CRE). This result indicates that SS induces the formation of transcriptional complexes potentially carrying HAT activity on specific DNA target sequences. To verify the hypothesis that an increased HAT activity could account for histone H3 acetylation in response to SS, an acetylation assay was performed in vitro using whole-cell extracts obtained from ECs exposed to SS. Figure 5 shows that the level of acetylation of a biotinylated histone H4 peptide used as a substrate was 2-fold higher in the presence of protein extracts obtained from ECs exposed to SS than those kept in ST.
|
|
These data suggest that SS may increase the intracellular level of HAT activity in ECs, providing the molecular basis for the histone acetylation described in the present study.
SS Mediates Chromatin Remodeling Within c-fos and c-jun Promoters
To correlate SS-dependent expression of early genes with histone H3 acetylation on K14, we performed a ChIp assay and amplified by polymerase chain reaction a 200-bp region of the c-fos and c-jun promoters. As shown in Figure 6, left, the c-fos promoter was specifically immunoprecipitated after 30 and 60 minutes of SS exposure by an anti-H3AcK14 antibody. In the same condition, a barely detectable and not modulated signal was detected in chromatin precipitated using an anti-H4AcK12 antibody. A similar result was obtained with a promoter fragment of c-jun, another early gene induced by SS6,9 (Figure 6, right).
|
These data demonstrate that SS is able to remodel chromatin into an "opened" state, thus providing the molecular basis for its effect on gene expression.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ECs exposed to SS undergo a series of modifications in gene expression,29 leading to morphological changes,30 growth arrest,31 NO production,32,33 and survival in proapoptotic conditions.34,35 Gene expression is controlled by a coordinated sequence of molecular events in which posttransduction modification of histones represents one of the earliest steps necessary for the unwinding of chromatin, allowing the interaction of TFs with target DNA sequences.16,36 The present study shows that SS modifies core histones H3 and H4 and that this event may be required for SS-dependent expression of early genes. Western blot analyses revealed that in ECs exposed to SS, both histone H3 acetylation and phosphorylation were increased. This phenomenon was similar to that observed in other systems in which the phosphorylation of histone H3 on S10 was coupled to acetylation on K14 and to the transcriptional activation of immediate-early response genes.19,23 Specifically, phosphoacetylation of histone H3 has been related to the transcriptional activation of the c-fos promoter after treatment of mouse fibroblasts with epithelial growth factor.19 Because VEGF and FGF-2 provide potent proliferation and differentiation stimuli to ECs, we investigated whether these GFs could have effects similar to those of SS on histone H3. We found that VEGF enhanced both phosphorylation and acetylation of histone H3 but with a kinetic different from that observed under SS conditions. FGF-2 showed a transient induction of H3 phosphorylation without affecting its acetylation (see online data supplement). Conversely, SS activation of ECs was able to generate a more enhanced and prolonged effect on histone H3 acetylation and phosphorylation than that induced by GFs alone. Therefore, SS and GFs, although probably sharing common signaling pathways, may have distinct effects on histones. However, further experiments are required to elucidate this point.
SS-dependent histone H3 phosphorylation and acetylation appeared linked to the activation of distinct signaling pathways, controlled respectively by PI3K and by ERK and p38 or p38 and PKA. Blocking the MAPK/ERK pathway and H3 phosphorylation did not alter the acetylation of K14 on histone H3, indicating that these events may be independently regulated.23 In fact, ERKs and p38 may differentially regulate distinct downstream kinases involved in DNA structure modification. The MAPK/ERK pathway activates RSK-2, and this kinase, when released from its interaction with CBP, can phosphorylate histone H3 on S10. This dissociative event may lead, in turn, to the acetylation of K14 on the same core histone.18 However, phosphorylation of histone H3 can also be regulated by MSK-1, via p38 MAPK.26,27 In this regard, inhibiting p38 function resulted in a marked reduction of both histone H3 phosphorylation and acetylation during SS, indicating that the nuclear kinase MSK-1 is important for the SS effect on the posttransductional modification of core histones.
Recent data suggest that PKA may be activated by SS.37 PKA is a well-known activator of CREB and CBP/p300,38,39 and in our experiments, SS apparently stimulates the formation of CREB/CBP complexes, which may ultimately tether HAT activity on target DNA regions. This observation is supported by the evidence that histone H3 acetylation on K14 decreased on PKA inhibition. The formation of transcriptional complexes containing HAT molecules, which coordinate and integrate multiple signaling pathways with the transcriptional machinery,16 and the increase in intracellular acetylation activity occurring in the presence of SS may provide the molecular basis for the effect of flow on gene expression. A growing body of evidence points out that changes in the folding of chromatin are required as a preliminary step toward the expression of target genes in presence of specific stimuli.15 ChIp experiments clearly show that in the presence of SS, acetylated histone H3 is present within c-fos and c-jun promoter sequences, indicating that SS may contribute to the remodeling of chromatin, which acquires an "opened" structure within the promoter region of specific genes. However, the status of chromatin acetylation results from the balance of HAT and HDAC activity,15 and to elucidate this aspect in the context of SS requires further and thorough investigation. In the present report, it is, in fact, noteworthy that other SS-dependent modifications on histone H3 and H4 were detected in presence of TSA. This evidence suggests possible additional mechanisms of regulation that may not be directly controlled by SS. TSA, in fact, is known, per se, to alter biological responses in different biological systems,40,41 eg, anticipating the timing of gene expression during embryo development.42 It is then possible that certain modifications of chromatin occurring in the presence of HDAC inhibitors, as described for the smooth muscle–specific SM22 gene locus in 10T1/2 cells,43 may not be related to the effect of physiological stimuli.
In conclusion, the present study describes the effect of laminar SS on histone modification and on chromatin structure, providing the molecular basis for SS-mediated gene regulation in ECs (see Figure 7 for summary).
|
|
Acknowledgments |
|---|
This study has been partially supported by Ministero della Salute "Progetti di Ricerca Finalizzata" ICS 120.1, 1/RF00208, ICS 120.4/RA00-90, and "Ricerca Corrente" RC 2002-4.5. Simona Nanni is supported by the "Fondazione Italiana per la Ricerca sul Cancro" (FIRC).
|
Footnotes |
|---|
Original received January 9, 2003; revision received May 29, 2003; accepted May 30, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Chen KD, Li YS, Kim M, Li S, Yan S, Chien S, Shyy YJJ. Mechanotransduction in response to shear stress. J Biol Chem. 1999; 274: 18393–18400.
2. Shay-Salit A, Shushy M, Wolfovitz E, Yahav H, Breviario F, Dejana E, Resnick N. VEGF receptor 2 and the adherens junction as a mechanical transducer in vascular endothelial cells. Proc Natl Acad Sci U S A. 2002; 99: 9462–9467.
3. Li S, Kim M, Hu YL, Jalali S, Schlaepfer DD, Hunter T, Chien S, Shyy YJJ. Fluid shear stress activation of focal adhesion kinase. J Biol Chem. 1997; 272: 30455–30462.
4. Kano Y, Katoh K, Masuda M, Fujiwara K. Macromolecular composition of stress fiber–plasma membrane attachment sites in endothelial cells in situ. Circ Res. 1996; 79: 1000–1006.
5. Jalali S, Li YS, Sotoudeh M, Yuan S, Li S, Chien S, Shyy YJJ. Shear stress activates p60src-Ras-MAPK signaling pathway in vascular endothelial cells. Arterioscler Thromb Vasc Biol. 1998; 18: 227–234.
6. Nagel T, Resnick N, Dewey CF Jr, Gimbrone MA Jr. Vascular endothelial cells respond to spatial gradients in fluid shear stress by enhanced activation of transcription factors. Arterioscler Thromb Vasc Biol. 1999; 19: 1825–1834.
7. Hsieh HJ, Li NQ, Frangos JA. Pulsatile and steady flow induces c-fos expression in human endothelial cells. J Cell Physiol. 1993; 154: 143–151.[CrossRef][Medline] [Order article via Infotrieve]
8. Resnick N, Gimbrone MA Jr. Hemodynamic forces are complex regulators of endothelial gene expression. FASEB J. 1995; 9: 874–882.[Abstract]
9. Lan Q, Mercurius KO, Davies PF. Stimulation of transcription factors NF-B and AP-1 in endothelial cells subjected to shear stress. Biochem Biophys Res Commun. 1994; 20: 950–956.
10. Khachigian LM, Resnick N, Gimbrone MA Jr, Collins T. Nuclear factor-B interacts functionally with the platelet-derived growth factor B-chain shear stress response element in vascular endothelial cells exposed to fluid shear stress. J Clin Invest. 1995; 96: 1169–1175.[Medline]
[Order article via Infotrieve]
11. De Nigris F, Lerman LO, Ignarro SW, Sica G, Lerman A, Palinski W, Ignarro LJ, Napoli C. Beneficial effects of antioxidants and L-arginine on oxidation-sensitive gene expression and endothelial NO synthase activity at sites of disturbed shear stress. Proc Natl Acad Sci U S A. 2003; 100: 1420–1425.
12. Korenaga R, Ando J, Kosaki K, Isshiki M, Takada Y, Kamiya A. Negative transcriptional regulation of the VCAM-1 gene by fluid shear stress in murine endothelial cells. Am J Physiol. 1997; 273: C1506–C1515.[Medline] [Order article via Infotrieve]
13. Topper JN, Cai J, Qiu Y, Anderson KR, Xu YY, Deeds JD, Feeley R, Gimeno CJ, Woolf EA, Tayber O, Mays GG, Sampson BA, Schoen FJ, Gimbrone MA Jr, Falb D. Vascular MADs: two novel MAD-related genes selectively inducible by flow in human vascular endothelium. Proc Natl Acad Sci U S A. 1997; 94: 9314–9319.
14. Brown JD, DiChiara MR, Anderson KR, Gimbrone MA Jr, Topper JN. MEKK-1, a component of the stress (stress-activated protein kinase/c-jun N-terminal kinase) pathway, can selectively activate Smad-2-mediated transcriptional activation in endothelial cells. J Biol Chem. 1999; 274: 8797–8805.
15. Jenuwein T, Allis CD. Translating the histone code. Science. 2001; 293: 1074–1079.
16. Chen H, Tini M, Evans RM. HATs on and beyond chromatin. Curr Opin Cell Biol. 2001; 13: 218–224.[CrossRef][Medline] [Order article via Infotrieve]
17. Sassone Corsi P, Mizzen CA, Cheung P, Crosio C, Monaco L, Jacquot S, Hanauer A, Allis CD. Requirement of Rsk-2 for epidermal growth factor-activated phosphorylation of histone H3. Science. 1999; 285: 886–891.
18. Merienne K, Pannetier S, Harel-Bellan A, Sassone-Corsi P. Mitogen-regulated Rsk2-CBP interaction controls their kinase and acetylase activity. Mol Cell Biol. 2001; 21: 7089–7096.
19. Clayton AL, Rose S, Barrat MJ, Mahadevan LC. Phosphoacetylation of histone H3 on c-fos and c-jun associated nucleosomes upon gene activation. EMBO J. 2000; 19: 3714–3726.[CrossRef][Medline] [Order article via Infotrieve]
20. Cheung P, Tanner KG, Cheung WL, Sassone-Corsi P, Denu JM, Allis CD. Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal growth factor stimulation. Mol Cell. 2000; 5: 905–915.[CrossRef][Medline] [Order article via Infotrieve]
21. Schreiber E, Matthias P, Muller MM, Shaffner W. Rapid detection of octamer binding proteins with "mini-extracts," prepared from a small number of cells. Nucleic Acids Res. 1998; 17: 6419.
22. Nanni S, Narducci M, Della Pietra L, Moretti F, Grasselli A, De Carli P, Sacchi A, Pontecorvi A, Farsetti A. Signaling through estrogen receptors modulates telomerase activity in human prostate cancer. J Clin Invest. 2002; 110: 219–227.[CrossRef][Medline] [Order article via Infotrieve]
23. Thomson S, Clayton AL, Mahadevan LC. Independent dynamic regulation of histone phosphorylation and acetylation during immediate-early gene induction. Mol Cell. 2001; 8: 1231–1241.[CrossRef][Medline] [Order article via Infotrieve]
24. Fisslthaler B, Dimmeler S, Hermann C, Busse R, Fleming I. Phosphorylation and activation of the endothelial nitric oxide synthase by fluid shear stress. Acta Physiol Scand. 2000; 168: 81–88.[CrossRef][Medline] [Order article via Infotrieve]
25. Surapisitchat J, Hoefen RJ, Pi X, Yoshizumi M, Yan C, Berk BC. Fluid shear stress inhibits TNF- activation of JNK but not ERK 1/2 or p38 in human umbilical vein endothelial cells: inhibitory crosstalk among MAPK family members. Proc Natl Acad Sci U S A. 2002; 98: 6476–6481.
26. Thomson S, Clayton AL, Hazzalin CA, Rose S, Barrat M, Mahadevan LC. The nucleosomal response associated with immediate-early gene induction is mediated via alternative MAP kinase cascades: MSK1 as a potential histone H3/HMG-14 kinase. EMBO J. 1999; 17: 4779–4793.[CrossRef]
27. Deak M, Clifton AD, Lucocq JM, Alessi DR. Mitogen- and stress-activated protein kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38, and may mediate activation of CREB. EMBO J. 1998; 15: 4426–4441.[CrossRef]
28. Dwarki VJ, Montminy M, Verma IM. Both the basic region and the "leucine zipper" domain of the cyclic AMP response element binding (CREB) protein are essential for transcriptional activation. EMBO J. 1990; 9: 225–232.[Medline] [Order article via Infotrieve]
29. Garcia-Cardena G, Comander J, Anderson KR, Blackman BR, Gimbrone MA Jr. Biomechanical activation of vascular endothelium as a determinant of its functional phenotype. Proc Natl Acad Sci U S A. 2001; 98: 4478–4485.
30. Li S, Hen BPC, Azuma N, Hu YL, Wu SZ, Sumpio BE, Shyy YJJ, Chien S. Distinct roles for the small GTPases Cdc42 and Rho in endothelial response to shear stress. J Clin Invest. 1999; 103: 1141–1150.[Medline] [Order article via Infotrieve]
31. Lin K, Hsu PP, Chen BP, Yuan S, Usami S, Shyy YJJ, Li YS, Chien S. Molecular mechanism of endothelial growth arrest by laminar shear stress. Proc Natl Acad Sci U S A. 2000; 97: 9385–9389.
32. Davis ME, Cai H, Drummond GR, Harrison DG. Shear stress regulates endothelial nitric oxide synthase expression through c-src by divergent signaling pathways. Circ Res. 2001; 89: 1073–1080.
33. Go YM, Boo YC, Park H, Maland MC, Patel R, Pritchard KA, Fujio Y, Walsh K, Darley-Usmar V, Jo H. Protein kinase B/Akt activates c-jun NH2-terminal kinase by increasing NO production in response to shear stress. J Appl Physiol. 2001; 91: 1574–1581.
34. Bartling B, Tostlebe H, Darmer D, Holtz J, Silber RE, Morawietz H. Shear stress-dependent expression of apoptosis-regulating genes in endothelial cells. Biochem Biophys Res Commun. 2000; 278: 740–746.[CrossRef][Medline] [Order article via Infotrieve]
35. Urbich C, Walter DH, Zeiher A, Dimmeler S. Laminar shear stress upregulates integrin expression: role in endothelial cell adhesion and apoptosis. Circ Res. 2000; 87: 683–689.
36. Narlikar GJ, Fan HI, Kingston RE. Cooperation between complexes that regulate chromatin structure and transcription. Cell. 2002; 108: 475–487.[CrossRef][Medline] [Order article via Infotrieve]
37. Boo YC, Sorescu G, Boyd N, Shiojima I, Walsh K, Du J, Jo H. Shear stress stimulates phosphorylation of endothelial nitric oxide synthase at ser1179 by Akt-independent mechanisms: role of protein kinase A. J Biol Chem. 2002; 27: 3388–3396.
38. Liu JS, Park EA, Gurney AL, Roesler WJ, Hanson RW. Cyclic AMP induction of phosphoenolpyruvate carboxykinase (GTP) gene transcription is mediated by multiple promoter elements. J Biol Chem. 1991; 266: 19095–190102.
39. Parker D, Jhala US, Radhakrishnan I, Yakke MB, Reyes C, Shulman AI, Cantley LC, Wright PE, Montminy M. Analysis of an activator: coactivator complex reveals an essential role for secondary structure in transcriptional activation. Mol Cell. 1998; 2: 353–359.[CrossRef][Medline] [Order article via Infotrieve]
40. Rossig L, Li H, Fisslthaler B, Urbich C, Fleming I, Forstermann U, Zehier AM, Dimmeler S. Inhibitors of histone deacetylation downregulate the expression of endothelial nitric oxide synthase and compromise endothelial cell function in vasorelaxation and angiogenesis. Circ Res. 2002; 91: 837–844.
41. Kim MS, Kwon HJ, Lee YM, Baek JH, Jang JE, Lee SW, Moon EJ, Kim HS, Lee SK, Chung HY, Kim CW, Kim KW. Histone deacetylases induce angiogenesis by negative regulation of tumor suppressor genes. Nat Med. 2001; 7: 437–443.[CrossRef][Medline] [Order article via Infotrieve]
42. Iezzi S, Cossu G, Nervi C, Sartorelli V, Puri PL. Stage-specific modulation of skeletal myogenesis by inhibitors of nuclear deacetylases. Proc Natl Acad Sci U S A. 2002; 99: 7757–7762.
43. Ping Q, Li L. Histone acetylation and recruitment of serum responsive factor and CREB-binding protein onto SM22 promoter during SM22 gene expression. Circ Res. 2002; 90: 858–865.
This article has been cited by other articles:
 |
|
 |
|
  S. S. Shaik, T. D. Soltau, G. Chaturvedi, B. Totapally, J. S. Hagood, W. W. Andrews, M. Athar, N. N. Voitenok, C. R. Killingsworth, R. P. Patel, et al. Low Intensity Shear Stress Increases Endothelial ELR+ CXC Chemokine Production via a Focal Adhesion Kinase-p38{beta} MAPK-NF-{kappa}B Pathway J. Biol. Chem., February 27, 2009; 284(9): 5945 - 5955. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Kinney, U. M. Chandrasekharan, L. Yang, J. Shen, M. Kinter, M. S. McDermott, and P. E. DiCorleto Histone H3 as a novel substrate for MAP kinase phosphatase-1 Am J Physiol Cell Physiol, February 1, 2009; 296(2): C242 - C249. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. le Noble, C. Klein, A. Tintu, A. Pries, and I. Buschmann Neural guidance molecules, tip cells, and mechanical factors in vascular development Cardiovasc Res, May 1, 2008; 78(2): 232 - 241. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. C. Matouk and P. A. Marsden Epigenetic Regulation of Vascular Endothelial Gene Expression Circ. Res., April 25, 2008; 102(8): 873 - 887. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Illi, C. D. Russo, C. Colussi, J. Rosati, M. Pallaoro, F. Spallotta, D. Rotili, S. Valente, G. Ragone, F. Martelli, et al. Nitric Oxide Modulates Chromatin Folding in Human Endothelial Cells via Protein Phosphatase 2A Activation and Class II Histone Deacetylases Nuclear Shuttling Circ. Res., January 4, 2008; 102(1): 51 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Potente, L. Ghaeni, D. Baldessari, R. Mostoslavsky, L. Rossig, F. Dequiedt, J. Haendeler, M. Mione, E. Dejana, F. W. Alt, et al. SIRT1 controls endothelial angiogenic functions during vascular growth Genes & Dev., October 15, 2007; 21(20): 2644 - 2658. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. F. Kramer and L. J. Goodyear Exercise, MAPK, and NF-{kappa}B signaling in skeletal muscle J Appl Physiol, July 1, 2007; 103(1): 388 - 395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. D'Arcangelo, V. Ambrosino, M. Giannuzzo, C. Gaetano, and M. C. Capogrossi Axl receptor activation mediates laminar shear stress anti-apoptotic effects in human endothelial cells Cardiovasc Res, September 1, 2006; 71(4): 754 - 763. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Mattiussi, K. Matsumoto, B. Illi, F. Martelli, M. C. Capogrossi, and C. Gaetano Papilloma protein E6 abrogates shear stress-dependent survival in human endothelial cells: Evidence for specialized functions of paxillin Cardiovasc Res, June 1, 2006; 70(3): 578 - 588. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Lucchinetti, J. Feng, R. d. Silva, G. V. Tolstonog, M. C. Schaub, G. G. Schumann, and M. Zaugg Inhibition of LINE-1 expression in the heart decreases ischemic damage by activation of Akt/PKB signaling Physiol Genomics, April 13, 2006; 25(2): 314 - 324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Illi, C. Gaetano, and M. C. Capogrossi How Senescent Vascular Cells Lose Their Clock Age-Dependent Impairment of Circadian Rhythmicity in Smooth Muscle Cells Circ. Res., March 3, 2006; 98(4): 450 - 452. [Full Text] [PDF]
|
|
|
|
|
|
J. P. Huddleson, N. Ahmad, S. Srinivasan, and J. B Lingrel Induction of KLF2 by Fluid Shear Stress Requires a Novel Promoter Element Activated by a Phosphatidylinositol 3-Kinase-dependent Chromatin-remodeling Pathway J. Biol. Chem., June 17, 2005; 280(24): 23371 - 23379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Illi, A. Scopece, S. Nanni, A. Farsetti, L. Morgante, P. Biglioli, M. C. Capogrossi, and C. Gaetano Epigenetic Histone Modification and Cardiovascular Lineage Programming in Mouse Embryonic Stem Cells Exposed to Laminar Shear Stress Circ. Res., March 18, 2005; 96(5): 501 - 508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Arnholdt-Schmitt Stress-Induced Cell Reprogramming. A Role for Global Genome Regulation? Plant Physiology, September 1, 2004; 136(1): 2579 - 2586. [Full Text] [PDF]
|
|
|
|
|
|
P. Yang, O. Agapova, A. Parker, W. Shannon, P. Pecen, J. Duncan, M. Salvador-Silva, and M. R. Hernandez DNA microarray analysis of gene expression in human optic nerve head astrocytes in response to hydrostatic pressure Physiol Genomics, April 13, 2004; 17(2): 157 - 169. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||