Published online before print April 10, 2003, doi: 10.1161/01.RES.0000071355.82009.43
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2003 American Heart Association, Inc.
Molecular Medicine |
Identification of a Nuclear Orphan Receptor (Ear2) as a Negative Regulator of Renin Gene Transcription
From the Departments of Internal Medicine and Physiology and Biophysics, University of Iowa, Iowa City, Iowa.
Correspondence to Curt D. Sigmund, PhD, Department of Internal Medicine, 3181B MEBRF, Roy J. and Lucille A. Carver College of Medicine, University of Iowa, Iowa City, Iowa 52242. E-mail curt-sigmund{at}uiowa.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A potent transcriptional enhancer was previously identified upstream of the mouse renin gene. Within the enhancer is a TGACCT direct-repeat motif, required for enhancer activity, that is the consensus sequence recognized by members of the thyroid hormone subfamily of steroid hormone receptors. We previously reported that RAR/RXR bind to this sequence and mediate the induction of renin promoter activity by retinoids. However, gel mobility shift assays clearly show that other as yet unidentified factors also bind to this motif. In order to identify some of these TGACCT binding factors, we screened a yeast one-hybrid cDNA library derived from mouse As4.1 cells. One of these encoded the orphan nuclear receptor Ear2. Recombinant Ear2 was purified from Escherichia coli and an antipeptide antisera was generated. EMSA showed that purified recombinant Ear2 specifically binds the TGACCT direct-repeat motif. Transfection assays showed that Ear2 potently decreases both baseline and retinoid-induced mouse renin promoter activity in a dose-dependent, enhancer-dependent, and sequence-specific manner. Mutations in Ear2, which abolish its binding to the TGACCT motif, also abolish transcriptional repression. Ear2 was identified as a nuclear protein in As4.1 cells, is one of the proteins binding to the TGACCT repeat motif, and its overexpression can repress transcription of the endogenous renin gene in As4.1 cells. These data suggest that Ear2 is a negative modulator of renin gene transcription in As4.1 cells, and that the renin enhancer may actually encode a complex positive and negative regulator of transcription.
Key Words: transcription • transfection • gel shift • repression • nuclear receptor
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Renin is synthesized in the kidney and is known to play a pivotal role in blood pressure and extracellular fluid regulation. As the rate-limiting enzyme in the renin-angiotensin cascade leading to production of angiotensin II, understanding its regulation of expression and secretion has been the focus of many investigators. Renin is regulated at the transcriptional level, although posttranscriptional regulation has also been reported.1 Among the transcriptional elements proposed to regulate renin expression are promoter proximal response elements for cAMP and Pit-12,3 and the Abd-class of Hox genes.4 Further upstream is a nonclassical binding site for LXR
termed the CNRE, which has been reported to play a role in cAMP-mediated induction of the renin promoter.5 Upstream of the NRE is a classical enhancer of transcription, which lies at approximately -2.6 kb upstream of the mouse renin gene and at -12 kb upstream of the human renin gene.6–8 This transcriptional enhancer contains at least 5 different transcription factor binding sites that have both stimulatory and inhibitory activities.9–11 Two of these binding sites match the consensus sequence for members of the steroid hormone family of transcription factors (TGACCT) but contain a spacer sequence (DR10), which does not conform to any previously identified steroid hormone receptor response element. This sequence is necessary for enhancer activity and can substitute for the other transcriptional elements when concatemerized. We previously reported that this sequence binds RAR/RXR, mediates the induction of renin promoter activity by retinoic acid, and may therefore act as a RAR response element (RARE).9 In addition, this sequence may also be responsible for the downregulation of renin promoter activity mediated by vitamin D3 observed by us and others.9,12 Despite these observations, gel shift studies reveal that at least 3 other proteins may form a complex with the RARE. To identify these proteins and determine their role in the regulation of renin expression, we used the yeast one-hybrid system to isolate RARE binding proteins. One orphan nuclear receptor, Ear2, a member of the COUP-TF group belonging to the thyroid receptor subfamily was identified and cloned. Although much progress has been made in understanding the biochemical characterization and function of other COUP-TF members,13,14 little is known regarding the importance of Ear2. In the present study, we show that Ear2 may be an endogenous negative regulator of renin promoter activity through its interaction with the renin enhancer.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Yeast One-Hybrid Analysis
The yeast one-hybrid system was used to isolate cDNAs encoding proteins binding to the RARE (MATCHMAKER, Clontech). Two bait sequences were generated in pHISi, pHISi-1, and pLacZi, consisting of (1) 4-tandem copies of element-B, and (2) 2-tandem copies of element-B and -C separated by the native DR10 sequence found in the enhancer. The sequence of the top-strand oligonucleotides were CTCTGACCTCTCTCTGACCTCTCTCTGACCTCTCT- CTGACCT and CAGATGGTGACCTGGCTGTACTCTGACCTCTCAGATGGTGACCTGGCTGTACTCTGACCT (TGACCT motifs underlined). Upstream EcoRI and downstream MluI or SalI sites were added for cloning. A custom cDNA library was generated from As4.1 cells15 consisting of 2.0x106 independent clones (insert size ranging from 0.4 to 4.0 kb and averaging 2.0 kb) in pGAD10. One million clones were screened, and cDNA from positive colonies was sequenced, reconfirmed by one-hybrid analysis in yeast cells, and identified by BLAST (Table).
|
Ear2 Constructs
Ear2 cDNA was PCR cloned into pcDNA3.1 (Invitrogen) and pQE30 (Qiagen). To prepare mutants, DNA fragments were obtained with splicing overlap extension by PCR and similarly subcloned. The primers were designed to change the amino acid sequence from 74-CEGCKS-79 (wild type) to 74-CESCIV-79 (mutant) and from 93-CRSNRDCQ-100 (wild type) to 93-CGVNRLCQ-100 (mutant). These mutations were in the zinc finger DNA binding domain.16
Purification, Identification, and Expression of Ear2 From Escherichia coli
E coli M15 containing pQE-Ear2 plasmid was cultured, induced with IPTG (1.0 mmol/L) for 4 hours, pelleted, lysed in 50 mmol/L NaPO4 (pH 8.0), 300 mmol/L NaCl, and 10 mmol/L imidazole, and Ear2 was purified by Ni-agarose column. The lysate were separated by electrophoresis on 10% SDS polyacrylamide gel, transferred to nitrocellulose, and proteins were detected with His-tag antisera or Ear2 antisera. Ear2 antisera was generated in rabbits against the peptide TSDAEPGDEERP based on previous generation of a homologous human Ear2 antisera17 (Biosynthesis).
Whole cell proteins was prepared by sonicating cells in lysis buffer [10 mmol/L HEPES (pH 7.8), 10 mmol/L KCl, 2 mmol/L MgCl2, 0.1 mmol/L EDTA, 1% NP40]. For nuclear proteins, cells were resuspended in hypotonic buffer on ice, detergent was added to 0.5%, nuclei were pelleted, then suspended in nuclear protein extract buffer [50 mmol/L HEPES (pH 7.8), 300 mmol/L NaCl, 50 mmol/L KCl, 0.1 mmol/L EDTA, 10% (v/v) glycerol] on ice for 30 minutes, and spun with the supernatant saved. Cytoplasmic and membrane proteins were obtained by suspending cells in lysis buffer without detergent, sonication on ice, and spun at 120 000g for 30 minutes. The supernatant (cytoplasmic proteins) was saved. The pellet was resuspended in lysis buffer with 1% detergent, sonicated on ice, and pelleted; the supernatant is membrane proteins.
Immunohistochemistry of As4.1 Cells
As4.1 cells were plated at 2x105 cells/well in a 6-well plate with 22x22 mm cover glass one day before the experiment. Cells were washed 3x with PBS to remove growth media, fixed with 4% paraformaldehyde with triton X-100 for 15 minutes, rinsed, and then blocked with 5% Donkey Serum/1% BSA in PBS overnight at 4C. Ear2 antisera at 1:100 dilution in block solution was added for 2 hours. Cells were washed with PBS, and the secondary antisera was added for 1 hour. Cells were rinsed and stained with DAPI and mounted with Vectashield.
Electrophoretic Mobility Shift Assays
Nuclear proteins (5 µg) from As4.1 cells or 0.5 µg purified recombinant Ear2, 10 fmol/L oligonucleotide probe containing elements b and c of the renin enhancer (5'-GAT CCCAGATGGTGA- CCTGGCTGTACTCTGACCTCTGGATC-3') end labeled with 32P-ATP (NEN Life Science Products) were incubated in 20 µL binding reaction on ice for 20 minutes as described.9 In supershift assays, 1 to 2 µL antisera was added to reactions 15 minutes before loading gel. Unlabeled oligonucleotides were used for competition analysis. Each reaction was directly loaded onto 5% native polyacrylamide gel, and DNA/Protein complexes were resolved.
Cell Culture, Transient Transfection, and Luciferase Assay
As4.1 cells (American Type Culture Collection CRL2193) were maintained in DMEM (Life Technologies) supplemented with 10% FBS, penicillin (100 U/mL), and streptomycin (100 mg/mL). Cells (2x105/well) were plated on 6-well culture plates 24 hours before transfection in DMEM containing 10% fetal bovine serum. Cells were cotransfected with Ear2 expression vector and luciferase reporter vector by Fugen-6 (Roche). Forty to 48 hours after transfection, the cells were harvested and lysed using the luciferase kit. Luciferase activity was determined and normalized to total cellular protein in the lysate. Each luciferase assay was performed in duplicate to get an n=1. To determine the effects of Ear2 on endogenous renin expression, As4.1 cells were transfected with pcDNA3.1 or Ear2 expression vector. RNA was harvested from cells 30 hours after transfection and renin mRNA was quantified by RNase protection.18 Quantification was performed using the IMAGEQuant software on a STORM 820 PhosphorImager.
Statistical Analysis
Transfection results were compared by ANOVA using SigmaStat. A value of P<0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The renin gene enhancer is a complex regulatory element consisting of the binding sites for a number of transcription factors including NF-Y, RAR
/RXR, CREB, CREM, USF-1, and USF-2 (Figure 1A).9–11 One of these binding sites consists of a direct repeat of the canonical TGACCT motif recognized by members of the steroid hormone nuclear receptor superfamily, but containing an atypical spacer (DR10). We previously showed that the TGACCT-DR10-TGACCT motif acts as a retinoic response element (RARE), and is both required for retinoic acid–mediated induction of the renin promoter, and for baseline (retinoic acid–independent) activity of the enhancer. Electrophoretic mobility shift assays suggest that at least 4 proteins complex with the RARE. We hypothesize that one of these interactions may account for baseline enhancer activity. Therefore, in order to identify other transcription factors that bind to this site, we performed a yeast one-hybrid screen of 106 colonies from a mouse As4.1 cell cDNA library using two different TGACCT combinations (see Materials and Methods) as bait. Mouse As4.1 cells express renin and are thought to represent the best model of a renal juxtaglomerular cell in culture.15 Two rounds of screening yielded 21 positive clones that were subjected to BLAST search of nucleotide and EST databases (Table). Ear2 attracted immediate attention as it was found most frequently (4 of 21 clones), was replicated in two different screens, gave a positive signal when transfected on its own into yeast with two different bait plasmids, and is an orphan member of the same subfamily of nuclear hormone receptors as RAR.19
|
In order to determine if Ear2 has a role in regulating renin expression, we first cloned its full-length cDNA into expression vectors for purification of a 6XHis-tagged protein in bacteria and for transfection analysis in As4.1 cells. We also generated Ear2 antisera using a homologous peptide to one used previously to make human Ear2 antisera.17 A 45-kDa protein purified from bacteria was recognized by both anti-His and anti-Ear2 antisera (Figure 2A). Two different molecular weight forms of Ear2 were identified in As4.1 cells (Figure 2B). Two forms of Ear2 were previously detected by Zhu et al16 in transfected CV1 cells. The 45-kDa form comigrated with His-tagged Ear2 purified from bacteria. Immunofluorescence studies revealed primarily nuclear localization of Ear2 in As4.1 cells (Figures 2D through 2F). Interestingly, cell fractionation revealed that both forms are present in the nucleus, whereas the lower molecular weight form is predominantly associated with membranes (Figure 2C). This may be consistent with the membrane localization of other nuclear hormone receptors such as the estrogen receptor.20,21
|
The ability of Ear2 to bind the RARE was next tested by gel shift assay. As expected based on its selection using the RARE as bait, purified recombinant Ear2 protein was able to alter the mobility of the RARE in EMSA, and both anti-His and anti-Ear2 antisera supershifted the complex (Figure 3A). The specificity of Ear2 binding was confirmed in competition experiments (Figure 3B). Wild-type RARE was an effective competitor, whereas sequences mutated in either of the RARE TGACCT half sites (µb or µc) were less effective. A RARE mutated in both half sites (µbc) was unable to compete for Ear2 binding.
|
To examine the function of Ear2 as a regulator of renin gene transcription, we performed cotransfection experiments with a reporter vector containing 4.1 kb of Ren-1 5'-flanking DNA fused to luciferase in As4.1 cells. This reporter vector contains the enhancer in its native location and stimulates promoter activity 100-fold when compared with a basal promoter containing only 117 bp of the renin promoter.6,11 Surprisingly, Ear2 caused a dose-dependent inhibition of renin promoter activity (Figure 4A). Moreover, Ear2 attenuated the increase in renin promoter activity caused by retinoic acid (Figure 4B). This repression was sequence-specific as reporter vectors lacking the enhancer did not respond to Ear2 (data not shown). To ensure that Ear2 was repressing renin promoter activity by binding to the RARE in the enhancer, we examined transcriptional activity of a minimal renin promoter (117 bp) fused to either 3 tandem copies of the RARE (3X RARE) or the minimal 241-bp renin enhancer (mE). Ear2 caused a 3-fold decrease in renin promoter activity in both constructs (Figure 4C). This data suggests that other sequences are not required for Ear2-mediated downregulation of renin promoter activity. However, whereas Ear2 was effective in lowing transcription of these constructs, it was more effective in downregulating the 4.1K construct. This suggests that in the 4.1K construct, Ear2 binding may bind to other RARE half sites to further repress transcription, and indeed, there are two other TGACCT motifs and one other AGGTCA motif in that sequence.
|
To further determine the effect of Ear2 on the renin gene transcription, mutations were introduced into the DNA binding domain of Ear2 (Figure 1B). One mutation (M1) was made within the P-box of the first zinc finger, and the second mutation (M2) was made in the D-box of the second zinc finger. Wild-type and mutant 6XHis-Ear2 proteins were purified in equal amounts from E coli (Figure 5A). The DNA binding properties of these mutants were tested in EMSA. Whereas the wild-type protein formed a complex with the RARE, neither mutant had any detectable DNA/protein complex activity (Figure 5B). The ability of these mutant proteins to act on the renin promoter was examined in a cotransfection experiment. Mutation M1 markedly attenuated the ability of Ear2 to inhibit the activity of the renin promoter, whereas mutant M2 abolished transcriptional repression (Figure 5C).
|
As reported previously, As4.1 nuclear extract forms four DNA/protein complexes (a, b, c, and d) on the RARE that can all be equally competed with cold RARE or RARE half sites (Figure 6A). Recombinant Ear2 comigrates with either complex-b or complex-c. In order to formally identify which complex contains Ear2, we performed supershift analysis using Ear2 antisera. As anticipated, the His-antisera supershifted the complex formed with recombinant Ear2, but did not supershift any of the complexes formed with As4.1 nuclear extract (Figure 6B). On the contrary, in 3 independent experiments, Ear2 antisera caused a loss of complex-c (compare lane 2 or 3 to lane 5 in Figure 6B). There was also an enhancement of complex-a that is unlikely due to supershift of complex-c as the supershift position of recombinant Ear2 is at a higher molecular weight (lane 10). Ear2 antisera was unable to cause any mobility shift in the absence of nuclear extract.
|
Finally, we determined if Ear2 could regulate expression of the endogenous mouse renin gene expressed in As4.1 cells. We therefore transiently transfected As4.1 cells with either an empty expression vector (pcDNA3.1) or an expression vector containing Ear2. Cotransfection studies using an eGFP expression vector indicted that approximately 90% of the cells detected with DAPI stain also expressed eGFP (data not shown). RNase protection assay revealed that steady state renin mRNA levels were lower in cells transfected with the Ear2 expression vector (Figure 7A). Two independent experiments, each performed in duplicate, revealed a reduction of renin mRNA to 36% of control (Figure 7B).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Renin gene transcription is regulated in response to a complex series of physiological cues. Some estimates suggest that the range of renin mRNA expression can be as high as 100-fold depending on the physiological status of the organism.22 Studies of the renin 5'-flanking sequence has identified a number of transcription factor binding sites both proximal to the promoter and further upstream. Transcription factor binding sites close to the promoter include CREB, Pit-1,2,3 and an atypical binding site for the transcription factor LXR
.5 Mutagenesis experiments suggest that all three of these sites are required for stimulation of renin expression by cAMP. The LXR binding site, termed the CNRE (for cAMP responsive element–negative regulatory element), has also been implicated in the gene-specific regulation of mouse renin in submandibular gland.23 This notion has been challenged by experiments examining renin expression in wild-derived mice24 and by comparative sequence analysis.25 Recently, Gross and colleagues4 have reported that the Abd-class of Hox genes also binds to this region and plays a major role in regulating the renin gene. Like other targets of Hox transcription factors, expression of renin exhibits a very specific temporal and spatial profile during fetal development.26,27
Approximately 2.6 to 2.8 kb distal to the transcription start site of the renin gene is a classical enhancer of transcription. This enhancer functions in an orientation- and position-independent manner, but requires additional sequences between the enhancer and the promoter to confer both cell and promoter specificity.6 A sequence with 80% homology is present upstream of the human renin gene.7,8 Interestingly, the human renin enhancer is located 10 kb further upstream than in the mouse. The physiological significance of this observation remains unknown. Extensive mutagenesis, electrophoretic mobility shift, and supershift assays has revealed the binding sites for numerous transcription factors in the enhancer including NF-Y, RAR, RXR, USF-1, USF-2, CREM, and CREB. Each site is required for enhancer-mediated transcriptional induction, suggesting a complex interaction between these factors and the cofactors they recruit. Many of these sites are conserved in the human renin enhancer, suggesting it should function similarly.
One of the conserved sequences contains a direct repeat of the consensus binding site for members of steroid hormone receptor superfamily of transcription factors, but with an atypical spacer sequence (DR10). Both half sites of the binding site are required for baseline activity of the enhancer, and concatemerization of the sequence can transactivate the renin promoter to the same extent as the entire enhancer.9 Luciferase constructs containing this sequence can be further induced by treatment with retinoic acid (but not vitamin D3 or thyroid hormone), and both RAR and RXR specifically bind to this sequence. We have therefore termed this sequence a retinoic acid response element (RARE). Despite the induction with retinoic acid, gel mobility shift and supershift studies revealed that at least four different proteins bind to the RARE, of which only a minor component is RAR and RXR. We therefore performed a yeast one-hybrid screen to identify other RARE binding proteins.
Herein, we demonstrated that Ear2, an orphan member of the nuclear hormone superfamily, is present in As4.1 cells, serves to repress both endogenous renin expression and transfected renin promoter constructs, attenuates the transcriptional response to retinoic acid, binds to the same site as RAR/RXR with the same sequence specificity, and acts through the RARE. Given the robust transactivation function provided by the enhancer, we were initially surprised that Ear2 would act to oppose transcription. In agreement with this, however, are reports that Ear2 is a negative coregulator of thyroid hormone receptor (T3R) function16 and inhibits transcription of the luteinizing hormone receptor and a number of other genes.14,17 Studies of T3R function suggest that Ear2 binds to T3R, preventing its binding to the TRE.16 Ear2 is a member of COUP-TF family. In addition to retinoid receptors, a number of orphan receptors, including COUP-TF have been implicated in the regulation of the retinoid response.28–30 COUP-TF has been reported to repress transcription induced by RARs, as well as T3R and vitamin D receptor.31–34 In contrast, COUP-TF can also function as positive regulators for many different genes.35–38
Given the inhibitory effect of Ear2 on renin transcription, it is interesting to note that in the context of the renin enhancer, NF-Y, which normally is a transcriptional inducer, acts as a negative regulator. Mechanistically, NF-Y inhibits enhancer-mediated transactivation because its binding site overlaps with one of the RARE half sites and prevents the binding of transcription factors to that site.10 Increasing the spacing between the NF-Y binding site and the RARE eliminates the inhibitory influence of NF-Y. We propose that Ear2 acts by binding either directly to transcription factor(s), thus preventing their binding to the renin enhancer RARE, or by binding to the RARE and thus hindering the binding of other stimulatory factors. Functionally therefore, although they may act through different mechanisms, Ear2 and NF-Y may both prevent the binding of transcription factors to the RARE. Moreover, these two proteins may not be the only negative modulators of renin enhancer function. Recent studies suggest that vitamin D3 is also a negative regulator of renin expression, and although the mechanism by which this occurs has yet to be established, vitamin D3 receptor and RAR both share the same core binding site and heterodimerize with RXR.12,39 Clearly therefore, the enhancer is a complex regulatory element responding to both stimulatory and inhibitory stimuli.
Despite the effort aimed at characterizing the renin enhancer sequence, we have yet to determine its functional relevance in vivo. Transgenic mice containing the renin 5'-flanking region, including the enhancer fused to either SV40 T antigen or eGFP, correctly express the gene in fetal development and in adults, and the transgene responds to physiological cues known to regulate the renin gene.40,41 Alternatively, transgenic mice containing a construct lacking the enhancer are inappropriately expressed.42 Similarly, fusions between the human renin promoter and several different reporter genes that lack the enhancer are poorly expressed and regulated, whereas large genomic transgenes derived from P1 artificial chromosomes containing the enhancer are tightly regulated.18,43–45 Despite this suggestive evidence, experiments designed specifically to test the in vivo significance of the enhancer or one of its transcription factor binding sites has yet to be reported. Using homologous recombination in bacteria, we have recently modified a PAC clone containing the human renin gene by substitution of the enhancer sequence with a loxP511 site.46 Transgenic mice have been generated and a comparison of renin expression will be performed between mice containing the wild-type18 and mutant constructs. These and additional experiments in which individual transcription factor binding sites are mutated should provide, for the first time, a model system to link physiological cues with specific transcriptional events.
|
Acknowledgments |
|---|
The work described herein was funded by grants from the NIH (HL58048, HL61446, and HL55006). DNA sequencing was performed at the University of Iowa DNA Core Facility. We would like to thank Debbie Davis and Xiaoji Zhang for their excellent technical assistance. We would like to thank Kenneth W. Gross (Roswell Park Cancer Institute, Buffalo, NY) for the gift of reagents used in this study. We gratefully acknowledge the generous support of the Roy J. Carver Trust.
Received December 6, 2002; revision received March 31, 2003; accepted April 1, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Sinn PL, Sigmund CD. Human renin mRNA stability is increased in response to cAMP in Calu-6 cells. Hypertension. 1999; 33: 900–905.
2. Ying L, Morris BJ, Sigmund CD. Transactivation of the human renin promoter by the cyclic AMP/protein kinase A pathway is mediated by both CREB-dependent and CREB-independent mechanisms in Calu-6 cells. J Biol Chem. 1997; 272: 2412–2420.
3. Gilbert MT, Sun J, Yan Y, Oddoux C, Lazarus A, Tansey WP, Lavin TN, Catanzaro DF. Renin gene promoter activity in GC cells is regulated by cAMP and thyroid hormone through Pit-1–dependent mechanisms. J Biol Chem. 1994; 269: 1–6.
4. Pan L, Xie Y, Black TA, Jones CA, Pruitt SC, Gross KW. An Abd-B class HOX. PBX recognition sequence is required for expression from the mouse Ren-1c gene. J Biol Chem. 2001; 276: 32489–32494.
5. Tamura K, Chen YE, Horiuchi M, Chen Q, Daviet L, Yang Z, Lopez-Ilasaca M, Mu H, Pratt RE, Dzau VJ. LXR functions as a cAMP-responsive transcriptional regulator of gene expression. Proc Natl Acad Sci U S A. 2000; 97: 8513–8518.
6. Petrovic N, Black TA, Fabian JR, Kane CM, Jones CA, Loudon JA, Abonia JP, Sigmund CD, Gross KW. Role of proximal promoter elements in regulation of renin gene transcription. J Biol Chem. 1996; 271: 22499–22505.
7. Yan Y, Jones CA, Sigmund CD, Gross KW, Catanzaro DF. Conserved enhancer elements in human and mouse renin genes have different transcriptional effects in As4.1 cells. Circ Res. 1997; 81: 558–566.
8. Shi Q, Black TA, Gross KW, Sigmund CD. Species-specific differences in positive, and negative regulatory elements in the renin gene enhancer. Circ Res. 1999; 85: 479–488.
9. Shi Q, Gross KW, Sigmund CD. Retinoic acid-mediated activation of the mouse renin enhancer. J Biol Chem. 2001; 276: 3597–3603.
10. Shi Q, Gross KW, Sigmund CD. NF-Y antagonizes renin enhancer function by blocking stimulatory transcription factors. Hypertension. 2001; 38: 332–336.
11. Pan L, Black TA, Shi Q, Jones CA, Petrovic N, Loudon J, Kane C, Sigmund CD, Gross KW. Critical roles of a cyclic AMP responsive element and an E-box in regulation of mouse renin gene expression. J Biol Chem. 2001; 276: 45530–45538.
12. Li YC, Kong J, Wei M, Chen Z-F, Liu SQ, Cao L-P. 1,25-Dihydroxyvitamin D3 is a negative endocrine regulator of the renin-angiotensin system. J Clin Invest. 2002; 110: 229–238.[CrossRef][Medline] [Order article via Infotrieve]
13. Willson TM, Moore JT. Minireview: genomics versus orphan nuclear receptors-a half-time report. Mol Endocrinol. 2002; 16: 1135–1144.
14. Tsai SY, Tsai MJ. Chick ovalbumin upstream promoter-transcription factors (COUP-TFs): coming of age. Endocr Rev. 1997; 18: 229–240.
15. Sigmund CD, Okuyama K, Ingelfinger J, Jones CA, Mullins JJ, Kim U, Kane-Haas C, Wu C, Kenney L, Rustum Y, Dzau V, Gross KW. Isolation and characterization of renin expressing cell lines from transgenic mice containing a renin promoter viral oncogene fusion construct. J Biol Chem. 1990; 265: 19916–19922.
16. Zhu XG, Park KS, Kaneshige M, Bhat MK, Zhu Q, Mariash CN, McPhie P, Cheng SY. The orphan nuclear receptor Ear-2 is a negative coregulator for thyroid hormone nuclear receptor function. Mol Cell Biol. 2000; 20: 2604–2618.
17. Zhang Y, Dufau ML. Nuclear orphan receptors regulate transcription of the gene for the human luteinizing hormone receptor. J Biol Chem. 2000; 275: 2763–2770.
18. Sinn PL, Davis DR, Sigmund CD. Highly regulated cell-type restricted expression of human renin in mice containing 140 Kb or 160 Kb P1 phage artificial chromosome transgenes. J Biol Chem. 1999; 274: 35785–35793.
19. Barnhart KM, Mellon PL. The sequence of a murine cDNA encoding Ear-2, a nuclear orphan receptor. Gene. 1994; 142: 313–314.[CrossRef][Medline] [Order article via Infotrieve]
20. Chambliss KL, Yuhanna IS, Mineo C, Liu P, German Z, Sherman TS, Mendelsohn ME, Anderson RG, Shaul PW. Estrogen receptor and endothelial nitric oxide synthase are organized into a functional signaling module in caveolae. Circ Res. 2000; 87: e44–e52.[Medline]
[Order article via Infotrieve]
21. Razandi M, Alton G, Pedram A, Ghonshani S, Webb P, Levin ER. Identification of a structural determinant necessary for the localization and function of estrogen receptor at the plasma membrane. Mol Cell Biol. 2003; 23: 1633–1646.
22. Dene H, McIlwain C, Rapp JP. Quantitation of renal renin and renin mRNA in Dahl rats in response to provocative stimuli. Clin Exp Hypertens A. 1989; 11: 1585–1594.[Medline] [Order article via Infotrieve]
23. Barrett G, Horiuchi M, Paul M, Pratt RE, Nakamura N, Dzau VJ. Identification of a negative regulatory element involved in tissue-specific expression of mouse renin genes. Proc Natl Acad Sci U S A. 1992; 89: 885–889.
24. Abel KJ, Howles PN, Gross KW. DNA insertions distinguish the duplicated renin genes of DBA/2 and M. hortulanus mice. Mamm Gen. 1992; 2: 32–40.[CrossRef][Medline] [Order article via Infotrieve]
25. Abonia JP, Howles PN, Abel KJ, Black TA, Jones CA, Gross KW. Evaluating a model of an NRE mediated tissue-specific expression of murine renin genes. Hypertension. 2001; 37: 105–109.
26. Jones CA, Sigmund CD, McGowan R, Kane-Haas C, Gross KW. Temporal and spatial expression of the murine renin genes during fetal development. Mol Endocrinol. 1990; 4: 375–383.
27. Gomez RA. Molecular biology of components of the renin-angiotensin system during development. Pediatr Nephrol. 1990; 4: 421–423.[CrossRef][Medline] [Order article via Infotrieve]
28. Kastner P, Mark M, Chambon P. Nonsteroid nuclear receptors: what are genetic studies telling us about their role in real life? Cell. 1995; 83: 859–869.[CrossRef][Medline] [Order article via Infotrieve]
29. Mangelsdorf DJ, Evans RM. The RXR heterodimers and orphan receptors. Cell. 1995; 83: 841–850.[CrossRef][Medline] [Order article via Infotrieve]
30. Leng X, Cooney AJ, Tsai SY, Tsai MJ. Molecular mechanisms of COUP-TF–mediated transcriptional repression: evidence for transrepression and active repression. Mol Cell Biol. 1996; 16: 2332–2340.[Abstract]
31. Cooney AJ, Tsai SY, O’Malley BW, Tsai MJ. Chicken ovalbumin upstream promoter transcription factor (COUP-TF) dimers bind to different GGTCA response elements, allowing COUP-TF to repress hormonal induction of the vitamin D3, thyroid hormone, and retinoic acid receptors. Mol Cell Biol. 1992; 12: 4153–4163.
32. Lee MO, Liu Y, Zhang XK. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene. Mol Cell Biol. 1995; 15: 4194–4207.[Abstract]
33. Tran P, Zhang XK, Salbert G, Hermann T, Lehmann JM, Pfahl M. COUP orphan receptors are negative regulators of retinoic acid response pathways. Mol Cell Biol. 1992; 12: 4666–4676.
34. Widom RL, Rhee M, Karathanasis SK. Repression by ARP-1 sensitizes apolipoprotein AI gene responsiveness to RXR and retinoic acid. Mol Cell Biol. 1992; 12: 3380–3389.
35. Lu XP, Salbert G, Pfahl M. An evolutionary conserved COUP-TF binding element in a neural-specific gene and COUP-TF expression patterns support a major role for COUP-TF in neural development. Mol Endocrinol. 1994; 8: 1774–1788.
36. Hall RK, Sladek FM, Granner DK. The orphan receptors COUP-TF and HNF-4 serve as accessory factors required for induction of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Proc Natl Acad Sci U S A. 1995; 92: 412–416.
37. Power SC, Cereghini S. Positive regulation of the vHNF1 promoter by the orphan receptors COUP-TF1/Ear3 and COUP-TFII/Arp1. Mol Cell Biol. 1996; 16: 778–791.[Abstract]
38. Rohr O, Aunis D, Schaeffer E. COUP-TF and Sp1 interact and cooperate in the transcriptional activation of the human immunodeficiency virus type 1 long terminal repeat in human microglial cells. J Biol Chem. 1997; 272: 31149–31155.
39. Sigmund CD. Regulation of renin expression and blood pressure by vitamin D3. J Clin Invest. 2002; 110: 155–156.[CrossRef][Medline] [Order article via Infotrieve]
40. Jones CA, Hurley MI, Black TA, Kane CM, Pan L, Pruitt SC, Gross KW. Expression of a renin-green fluorescent protein transgene in mouse embryonic, extra-embryonic and adult tissues. Physiol Genomics. 2000; 4: 75–81.
41. Sigmund CD, Jones CA, Fabian JR, Mullins JJ, Gross KW. Tissue and cell-specific expression of a renin promoter-T antigen reporter gene construct in transgenic mice. Biochem Biophys Res Commun. 1990; 170: 344–350.[CrossRef][Medline] [Order article via Infotrieve]
42. Sola C, Tronik D, Dreyfus M, Babinet C, Rougeon F. Renin-promoter SV40 large T-antigen transgenes induce tumors irrespective of normal cellular expression of renin genes. Oncogene Res. 1989; 5: 149–153.[Medline] [Order article via Infotrieve]
43. Sinn PL, Sigmund CD. Transgenic models as tools for studying the regulation of human renin expression. Regul Pept. 2000; 86: 77–82.[CrossRef][Medline] [Order article via Infotrieve]
44. Sinn PL, Zhang X, Sigmund CD. Juxtaglomerular cell expression and partial regulation of a human renin genomic transgene driven by a minimal renin promoter. Am J Physiol. 1999; 277: F634–F642.[Medline] [Order article via Infotrieve]
45. Yan Y, Chen R, Pitarresi T, Sigmund CD, Gross KW, Sealey JE, Laragh JH, Catanzaro DF. Kidney is the only source of human plasma renin in 45-kb human renin transgenic mice. Circ Res. 1998; 83: 1279–1288.
46. Nistala R, Sigmund CD. A reliable and efficient method for deleting operational sequences in PACs and BACs. Nucleic Acids Res. 2002; 30: e41.
This article has been cited by other articles:
 |
|
 |
|
  G. Mittler, F. Butter, and M. Mann A SILAC-based DNA protein interaction screen that identifies candidate binding proteins to functional DNA elements Genome Res., February 1, 2009; 19(2): 284 - 293. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. T. Glenn, C. A. Jones, L. Pan, and K. W. Gross In vivo analysis of key elements within the renin regulatory region Physiol Genomics, November 12, 2008; 35(3): 243 - 253. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. T. Todorov, M. Desch, T. Schubert, and A. Kurtz The Pal3 Promoter Sequence Is Critical for the Regulation of Human Renin Gene Transcription by Peroxisome Proliferator-Activated Receptor-{gamma} Endocrinology, September 1, 2008; 149(9): 4647 - 4657. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhou, E. T. Weatherford, X. Liu, E. Born, H. L. Keen, and C. D. Sigmund Dysregulated human renin expression in transgenic mice carrying truncated genomic constructs: evidence supporting the presence of insulators at the renin locus Am J Physiol Renal Physiol, September 1, 2008; 295(3): F642 - F653. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Kuipers, P. van der Harst, G. Navis, L. van Genne, F. Morello, W. H. van Gilst, D. J. van Veldhuisen, and R. A. de Boer Nuclear Hormone Receptors as Regulators of the Renin-Angiotensin-Aldosterone System Hypertension, June 1, 2008; 51(6): 1442 - 1448. [Full Text] [PDF]
|
|
|
|
 |
|
 W. Yuan, W. Pan, J. Kong, W. Zheng, F. L. Szeto, K. E. Wong, R. Cohen, A. Klopot, Z. Zhang, and Y. C. Li 1,25-Dihydroxyvitamin D3 Suppresses Renin Gene Transcription by Blocking the Activity of the Cyclic AMP Response Element in the Renin Gene Promoter J. Biol. Chem., October 12, 2007; 282(41): 29821 - 29830. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Sakhinia, C. Glennie, J. A. Hoyland, L. P. Menasce, G. Brady, C. Miller, J. A. Radford, and R. J. Byers Clinical quantitation of diagnostic and predictive gene expression levels in follicular and diffuse large B-cell lymphoma by RT-PCR gene expression profiling Blood, May 1, 2007; 109(9): 3922 - 3928. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. A. Itani, X. Liu, J. H. Pratt, and C. D. Sigmund Functional Characterization of Polymorphisms in the Kidney Enhancer of the Human Renin Gene Endocrinology, March 1, 2007; 148(3): 1424 - 1430. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al. International Union of Pharmacology. LXVI. Orphan Nuclear Receptors Pharmacol. Rev., December 1, 2006; 58(4): 798 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Liu, Q. Shi, and C. D. Sigmund Interleukin-1{beta} Attenuates Renin Gene Expression Via a Mitogen-Activated Protein Kinase Kinase-Extracellular Signal-Regulated Kinase and Signal Transducer and Activator of Transcription 3-Dependent Mechanism in As4.1 Cells Endocrinology, December 1, 2006; 147(12): 6011 - 6018. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhoux, D. R. Davis, and C. D. Sigmund The Human Renin Kidney Enhancer Is Required to Maintain Base-line Renin Expression but Is Dispensable for Tissue-specific, Cell-specific, and Regulated Expression J. Biol. Chem., November 17, 2006; 281(46): 35296 - 35304. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Riggs, N. S. Wickramasinghe, R. K. Cochrum, M. B. Watts, and C. M. Klinge Decreased Chicken Ovalbumin Upstream Promoter Transcription Factor II Expression in Tamoxifen-Resistant Breast Cancer Cells. Cancer Res., October 15, 2006; 66(20): 10188 - 10198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Klar, M. Sigl, B. Obermayer, F. Schweda, B. K. Kramer, and A. Kurtz Calcium Inhibits Renin Gene Expression by Transcriptional and Posttranscriptional Mechanisms Hypertension, December 1, 2005; 46(6): 1340 - 1346. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. T. Todorov, S. Volkl, J. Friedrich, L. A. Kunz-Schughart, T. Hehlgans, L. Vermeulen, G. Haegeman, M. L. Schmitz, and A. Kurtz Role of CREB1 and NF{kappa}B-p65 in the Down-regulation of Renin Gene Expression by Tumor Necrosis Factor {alpha} J. Biol. Chem., July 1, 2005; 280(26): 24356 - 24362. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pan, Y. Wang, C. A. Jones, S. T. Glenn, H. Baumann, and K. W. Gross Enhancer-dependent inhibition of mouse renin transcription by inflammatory cytokines Am J Physiol Renal Physiol, January 1, 2005; 288(1): F117 - F124. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pan and K. W. Gross Transcriptional Regulation of Renin: An Update Hypertension, January 1, 2005; 45(1): 3 - 8. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pan, C. A. Jones, S. T. Glenn, and K. W. Gross Identification of a novel region in the proximal promoter of the mouse renin gene critical for expression Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1107 - F1115. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. G. Li, D. Gavrila, X. Liu, L. Wang, S. Gunnlaugsson, L. L. Stoll, M. L. McCormick, C. D. Sigmund, C. Tang, and N. L. Weintraub Ghrelin Inhibits Proinflammatory Responses and Nuclear Factor-{kappa}B Activation in Human Endothelial Cells Circulation, May 11, 2004; 109(18): 2221 - 2226. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Nistala, X. Zhang, and C. D. Sigmund Differential expression of the closely linked KISS1, REN, and FLJ10761 genes in transgenic mice Physiol Genomics, March 12, 2004; 17(1): 4 - 10. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. T. Todorov, S. Volkl, M. Muller, A. Bohla, J. Klar, L. A. Kunz-Schughart, T. Hehlgans, and A. Kurtz Tumor Necrosis Factor-{alpha} Activates NF{kappa}B to Inhibit Renin Transcription by Targeting cAMP-responsive Element J. Biol. Chem., January 9, 2004; 279(2): 1458 - 1467. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||