Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2003;92:856-864
Published online before print March 27, 2003, doi: 10.1161/01.RES.0000068405.49081.09
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
92/8/856    most recent
01.RES.0000068405.49081.09v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshida, T.
Right arrow Articles by Owens, G. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, T.
Right arrow Articles by Owens, G. K.
Related Collections
Right arrow Gene regulation
Right arrow Smooth muscle proliferation and differentiation
(Circulation Research. 2003;92:856.)
© 2003 American Heart Association, Inc.


Molecular Medicine

Myocardin Is a Key Regulator of CArG-Dependent Transcription of Multiple Smooth Muscle Marker Genes

Tadashi Yoshida, Sanjay Sinha, Frédéric Dandré, Brian R. Wamhoff, Mark H. Hoofnagle, Brandon E. Kremer, Da-Zhi Wang, Eric N. Olson, Gary K. Owens

From the Departments of Molecular Physiology and Biological Physics (T.Y., S.S., F.D., B.R.W., M.H.H., G.K.O.) and Microbiology (B.E.K.), University of Virginia, Charlottesville, Va; and the Department of Molecular Biology (D.-Z.W., E.N.O.), University of Texas Southwestern Medical Center, Dallas, Tex.

Correspondence to Gary K. Owens, PhD, Department of Molecular Physiology and Biological Physics, University of Virginia, PO Box 800736, Charlottesville, VA 22908-0736. E-mail gko{at}virginia.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The interactions between serum response factor (SRF) and CArG elements are critical for smooth muscle cell (SMC) marker gene transcription. However, the mechanisms whereby SRF, which is expressed ubiquitously, contributes to SMC-specific transcription are unknown. Myocardin was recently cloned as a coactivator of SRF in the heart, but its role in regulating CArG-dependent expression of SMC differentiation marker genes has not been clearly elucidated. In this study, we examined the expression and the function of myocardin in SMCs. In adult mice, myocardin mRNA was expressed in multiple smooth muscle (SM) tissues including the aorta, bladder, stomach, intestine, and colon, as well as the heart. Myocardin was also expressed in cultured rat aortic SMCs and A404 SMC precursor cells. Of particular interest, expression of myocardin was induced during differentiation of A404 cells, although it was not expressed in parental P19 cells from which A404 cells were derived. Cotransfection studies in SMCs revealed that myocardin induced the activity of multiple SMC marker gene promoters including SM {alpha}-actin, SM-myosin heavy chain, and SM22{alpha} by 9- to 60-fold in a CArG-dependent manner, whereas myocardin short interfering RNA markedly decreased activity of these promoters. Moreover, adenovirus-mediated overexpression of a dominant-negative form of myocardin significantly suppressed expression of endogenous SMC marker genes, whereas adenovirus-mediated overexpression of wild-type myocardin increased expression. Taken together, results provide compelling evidence that myocardin plays a key role as a transcriptional coactivator of SMC marker genes through CArG-dependent mechanisms.


Key Words: smooth muscle cells • transcriptional coactivator • serum response factor • CArG element


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Phenotypic modulation of vascular smooth muscle cells (SMCs) is a key factor in the development of atherosclerosis and restenosis after balloon angioplasty.1 Dedifferentiated SMCs in the intima show a more proliferative and synthetic phenotype than differentiated medial SMCs, which are highly specialized for contraction.2 To fully understand the control of SMC differentiation, it is important to elucidate the molecular mechanisms that control the transcription of genes encoding proteins necessary for the differentiated function of SMCs.

Smooth muscle (SM) {alpha}-actin, SM-myosin heavy chain (MHC), and SM22{alpha} are useful markers for studying the control of SMC differentiation.2 Their expression levels are high in differentiated medial SMCs, whereas they are low in dedifferentiated intimal SMCs.2 These SMC-selective genes have a conserved DNA recognition element known as a CArG element, which has the general sequence motif, CC(A/T-rich)6GG.3 The CArG element was first identified as the core sequence of the serum response element (SRE) within the early-response gene, c-fos.3 Whereas there is only one SRE/CArG element in the c-fos gene, each of the SMC marker genes contains at least two CArG elements located in the 5' promoter region and the first intron.4–7 Previous studies from our laboratory and others have demonstrated that multiple CArG elements are required for SMC marker expression in vivo.6,8,9 The binding factor for CArG elements is the MADS box transcription factor, serum response factor (SRF).10 Although SRF is expressed in a wide variety of cells and controls gene expression in response to growth and differentiation signals, Landerholm et al11 have shown that SRF is required for differentiation of SMCs in an in vitro proepicardial cell model of coronary SMC differentiation. Our laboratory also recently showed that in SMCs, SRF is bound to CArG-containing regions in multiple SMC marker genes within intact chromatin.12

Despite overwhelming evidence indicating that CArG-SRF interactions are critical for expression of virtually all SMC-specific/-selective differentiation marker genes, the mechanisms by which a ubiquitously expressed transcription factor, SRF, contributes to SMC-specific/-selective expression are poorly understood. However, studies in our laboratory and by others have implicated some combination of the following factors and mechanisms: (1) cooperative interaction of multiple CArG elements including requirements regarding their spacing and phasing13; (2) combinatorial interaction with other cis-acting elements and their binding factors14,15; (3) regulation of SRF binding by homeodomain proteins such as MHox16; (4) possible translocation of SRF from cytoplasm to nucleus17; (5) selective regulation of SRF binding to CArG regions of SMC genes within intact chromatin12; and (6) recruitment of SRF accessory proteins that may be selective for SMCs.13 The latter mechanism is particularly interesting and was based on our observations of a unique SMC-selective CArG-SRF higher order complex in electrophoretic mobility shift assays (EMSAs).13 Of interest, formation of this higher order CArG-SRF complex was not dependent on CArG flanking sequences, but rather appeared to occur through protein-protein interactions and was observed with SMC nuclear extracts but not with extracts from a variety of other cell types. These results suggested the existence of SMC-selective SRF cofactors that may be important for controlling CArG-SRF–dependent gene transcription in SMCs. However, a SMC-selective coactivator for SRF has not been identified yet.

Recently, Wang et al18 reported the cloning of a cDNA encoding a protein termed myocardin that is highly expressed in the heart and acts as a potent transcriptional coactivator for SRF. They found that myocardin directly bound to SRF and transactivated SM22{alpha} and atrial natriuretic factor promoter-reporter genes in COS cells via a CArG-dependent manner. They also demonstrated that myocardin was required for cardiomyocyte differentiation in vivo based on the overexpression of dominant-negative myocardin mutant in Xenopus embryos. Chen et al19 recently presented evidence that myocardin is also expressed in the aorta and can induce activation of several SMC marker genes in transfection studies. However, as yet, no studies have directly addressed whether myocardin normally plays a role in CArG-SRF–dependent transcription of SMC marker genes. Thus, the goal of present studies was to investigate the role of myocardin in control of expression of SMC differentiation marker genes through a combination of loss and gain of function experiments in cultured SMCs and inducible SMC linage systems.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
Rat aortic SMCs, rat aortic endothelial cells (ECs), and bovine aortic ECs were isolated and cultured as previously described.20 Mouse 10T1/2 cells and NIH/3T3 cells were obtained from American Type Culture Collection (Rockville, Md). Mouse A404 cells were cultured and differentiated as described previously.12

RNA Extraction and Reverse Transcription (RT)-PCR
Total RNA was prepared from the tissues of adult female C57BL/6 mice (Harlan, Indianapolis, Ind) and cultured cells. The animal protocol was reviewed and approved by the animal care and use committee at the University of Virginia. Semiquantitative RT-PCR was performed as described previously.12

Construction of Reporter Plasmids
Myocardin expression plasmid and its carboxy-terminal truncation mutant, MyoC{Delta}381, were described previously.18 The fragments of rat SM {alpha}-actin (-2555 to +2813 bp),8 rat SM-MHC (-4220 to {approx}+11600 bp),21 and mouse SM22{alpha} (-447 to +89 bp)22 were subcloned into a pGL3-basic vector (Promega Corp). Single CArG mutants of the SM {alpha}-actin gene were constructed by replacing the BstEII-AatII fragment with that of p2600Int/LacZ mutants.8 Double and triple CArG mutants were constructed using site-directed mutagenesis. A series of CArG flanking mutations in the p{alpha}A125Luc construct were made by inserting a HindIII-XbaI fragment of p125CAT mutation constructs13 into the pGL3-basic vector.

Construction of Short Interfering (si) RNA Plasmids
A plasmid-based system for production of siRNA was developed by ligating the minimal mouse H1 promoter (CCATGCAAATTACGC- TGTGCTTTGTGGGAAATCACCCTAAACGTAAAATTTATTCCTC- TTTCGAGCCTTATAGTGGCGGCCGGTCTACACCTTAAGGCGA) into the SacI-SpeI sites of pBluescript KS (-) (Stratagene), and this vector was named as pMighty-Empty. This system was tested for efficacy in SMCs, by successful knockdown of cotransfected green fluorescent protein (GFP) with pMighty-{alpha}GFP, which was constructed by inserting the oligonucleotide specific for GFP downstream of H1 promoter. To generate the siRNA specific for myocardin, an oligonucleotide (TTAAAGTTC- CGATCAGTCTTACAGTTCAAGAGACTGTAAGACTGATCGGA- ACTTTTTGGAAAG; italic means specific sequence to rat myocardin) was inserted downstream of H1 promoter, and it was designated as pMighty-{alpha}Myo.

Transient Transfection and Luciferase Assay
Approximately 24 hours before transfection, rat aortic SMCs were seeded at 1.5x104 cells/cm2 onto 12-well plates. Cells were transfected with plasmids using Superfect (Qiagen Inc). The total amount of DNA per well was kept constant by adding the corresponding amount of expression vector without a cDNA insert. Luciferase activity was measured and normalized by cellular protein concentrations. Each sample was examined in duplicate and it was repeated in 3 different experiments.

Adenovirus Constructs and Infection
Replication-deficient adenoviruses encoding the flag-tagged myocardin (Ad/Myo) and MyoC{Delta}381 (Ad/MyoDN) gene expressed from the CMV promoter were generated using standard methods by the University of Iowa Gene Transfer Vector Core.23 Twenty-four hours after plating, SMCs and ECs were infected with purified viruses for 1 hour at a multiplicity of infection (MOI) of 50, which infected greater than 95% of SMCs as defined by using GFP-expressing adenovirus.

Electrophoretic Mobility Shift Assay
Nuclear extracts were prepared from cultured rat aortic SMCs and bovine aortic ECs that were infected with Ad/Myo or empty adenovirus (Ad/Emp). EMSA were performed as previously described.13,20

Immunofluorescence
Rat aortic SMCs were seeded at 0.2x104 cells/cm2 on the day before transfection. SMCs were transfected with the myocardin or MyoC{Delta}381 expression plasmid and incubated for 72 hours. SMCs were fixed, permeabilized, and incubated with polyclonal anti-flag antibody (Sigma Chemical Co) and monoclonal anti-SM {alpha}-actin antibody (Sigma Chemical Co). Specific staining was detected with Cy2-conjugated anti-rabbit IgG antibody and Cy3-conjugated anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories, Inc). Cells were counterstained with 4', 6-diamidino-2-phenylindole (DAPI).

Real-Time RT-PCR
To quantify the expression of mRNA in Ad/Myo- or Ad/Emp-infected SMCs, real-time RT-PCR analysis (iCycler, Bio-Rad Laboratories, Inc) was performed using either SYBR green (SM {alpha}-actin) or a dual fluorescence–labeled probe (SM-MHC and 18S rRNA).

An expanded Materials and Methods section can be found in the online data supplement available at http://www.circresaha.org.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Myocardin Expression In Vivo and In Vitro Was Limited to Cardiac and Smooth Muscle Cells
Our initial aim was to confirm and extend studies of others18,19 by examining myocardin mRNA expression in multiple SM tissues of the mouse by semiquantitative RT-PCR. Results showed that myocardin mRNA was expressed in all SM containing tissues examined as well as the heart (Figure 1A). In contrast, no expression was observed in non-SM tissues such as the brain, liver, and skeletal muscle. Myocardin mRNA was also abundantly expressed in cultured rat aortic SMCs, but not in ECs (Figure 1B). Moreover, myocardin mRNA expression was examined in P19 cells, A404 cells, 10T1/2 cells, and NIH/3T3 cells (Figure 1C). A404 cells can be induced to differentiate into SMCs by retinoic acid (RA) treatment.12 Of major interest, myocardin mRNA was expressed in undifferentiated A404 cells, but not in P19 cells, the parental stem cells from which A404 cells were derived and was increased by RA-induced differentiation of A404 cells. Although 10T1/2 cells have been reported to undergo SMC differentiation in response to transforming growth factor ß1 (TGF-ß1),24 myocardin was not expressed in either TGF-ß1–treated or untreated 10T1/2 cells, as well as NIH/3T3 cells, and none of these cells expressed the definitive SMC marker, SM-MHC.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Expression of myocardin mRNA in various SMC and non-SMC tissues as determined by semiquantitative RT-PCR. A, Myocardin and GAPDH mRNA expression in the brain, liver, skeletal muscle (sk. muscle), heart, aorta, bladder, stomach, intestine, and colon of the adult mice. B, Myocardin, PECAM-1, and GAPDH mRNA expression in cultured rat aortic SMCs (SMC) and endothelial cells (EC). C, Myocardin, SM {alpha}-actin, and SM-MHC mRNA expression in P19 cells, undifferentiated and differentiated A404 cells, 10T1/2 cells, 10T1/2 cells treated with 1 ng/mL TGF-ß1, and NIH/3T3 cells.

Myocardin Induced Expression of Multiple SMC Marker Genes in Embryonic Fibroblasts and Cultured SMCs
To determine whether myocardin was capable of inducing expression of SMC differentiation marker genes, a myocardin expression vector was transfected into 10T1/2 cells and effects on expression of SMC marker genes examined by RT-PCR. Expression of SM {alpha}-actin and SM-MHC mRNA was substantially induced by myocardin in 10T1/2 cells (Figure 2A). Myocardin also activated the transcription of the SM {alpha}-actin, SM-MHC, and SM22{alpha} promoter-enhancer luciferase genes by 40-, 60-, and 9-fold, respectively, in cotransfection studies in SMCs (Figure 2B). Importantly, the SM {alpha}-actin and SM-MHC promoter-enhancer constructs tested are sufficient to drive expression in SMCs in vivo in transgenic mice in a manner that recapitulates that of the endogenous gene.8,21 Taken together, results demonstrate that overexpression of myocardin alone is sufficient to activate multiple SMC marker genes including the definitive marker SM-MHC in multipotential 10T1/2 cells and SMCs.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 2. Effect of myocardin on SMC marker genes expression. A, Induced expression of SMC marker genes by myocardin in 10T1/2 cells. 10T1/2 cells were transfected with myocardin expression construct or treated with 1 ng/mL TGF-ß1 for 48 hours and expression of SM {alpha}-actin and SM-MHC mRNA was examined by semiquantitative RT-PCR. B, Transcriptional activation of SMC marker genes by myocardin in cultured rat aortic SMCs. SM {alpha}-actin (-2555/+2813 bp; p{alpha}A [-2.6/+2.8]), SM-MHC (-4200/{approx}+11600 bp), and SM22{alpha} (-447/+89 bp) promoter-luciferase constructs (700 ng) were transiently transfected with myocardin (400 ng) into SMCs and assayed for luciferase activity. Activity was normalized for protein content. An arbitrary value of 100 was assigned to the activity of the luciferase construct only. Values represent the mean±SEM.

Myocardin Was Included in SMC-Selective CArG-SRF Higher Order Complex in EMSA
Results of our previous studies provided evidence for formation of a unique SMC-selective CArG-SRF higher order complex using SMC nuclear extracts and 95-bp oligonucleotide probe containing CArGs B and A of the SM {alpha}-actin promoter.13 To determine whether myocardin was included in this complex, a series of EMSA were performed using nuclear extracts prepared from SMCs infected with an adenovirus expressing flag-tagged myocardin, because as yet, no specific antibodies are available to detect myocardin itself. As previously reported,13 we found evidence of a SMC-selective CArG-SRF complex using the 95-bp probe and SMC nuclear extracts (Figure 3, band B), that had lower mobility than the complex formed by the 95-bp probe and nuclear extracts from ECs (band A). Of major interest, the SMC-selective shift complex was supershifted by either an anti-SRF antibody or an anti-flag antibody. These results indicate that myocardin is a component of a SMC-selective CArG-SRF higher order complex within the context of SMC nuclear extracts.



View larger version (79K):
[in this window]
[in a new window]
 
Figure 3. Characterization of nuclear proteins that bound to the 95-bp probe of SM {alpha}-actin promoter by EMSA. Nuclear extracts from bovine aortic ECs and rat aortic SMCs that were infected with Ad/Myo or Ad/Emp or uninfected were incubated with a 32P-labeled probe corresponding to the -137 to -42 bp region of SM {alpha}-actin gene in the absence or presence of a 20-fold molar excess of unlabeled competitor oligonucleotides. Arrowhead A and B indicate the DNA-EC protein complex and the DNA-SMC protein complex, respectively. Polyclonal antibodies against SRF or Flag were added for supershift.

Either Two CArG Elements or CArG B Was Required for SM {alpha}-Actin Gene Transcription by Myocardin
To determine the importance of CArG elements in myocardin-induced SM {alpha}-actin gene transcription, we tested the effects of myocardin on activity of a series of promoter constructs containing mutations of either a single or combinations of each of three CArG elements located within the -2.6/+2.8 kb SM {alpha}-actin promoter-enhancer. Myocardin increased SM {alpha}-actin gene transcription in a dose-dependent manner (Figure 4A). Single CArG mutations of CArG B, CArG A, or the intronic CArG did not affect SM {alpha}-actin gene transactivation by myocardin. However, myocardin-induced transcription was markedly decreased in double or triple CArG mutants except p{alpha}A (-2.6/+2.8) CArG A+int mutation construct, which exhibited lower basal activity than wild-type, but which responded to myocardin similarly to wild-type (Figure 4B). These mutants responded to TGF-ß1 (data not shown), suggesting the lack of responsiveness was not due to loss of basal promoter activity. Results indicate that either two CArG elements or single CArG B is required for SM {alpha}-actin gene activation by myocardin.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 4. Effect of CArG mutations on myocardin-induced SM {alpha}-actin gene transcription in rat aortic SMCs. p{alpha}A (-2.6/+2.8) construct or single CArG mutants (A) and double or triple CArG mutants (B) were transiently transfected with 0, 100, 200, 400, or 800 ng of myocardin into SMCs and assayed for luciferase activity. Activity was normalized for protein content. An arbitrary value of 100 was assigned to the activity of the p{alpha}A (-2.6/+2.8) construct. Values represent the mean±SEM.

CArG Flanking Sequences Were Not Necessary for the SM {alpha}-Actin Gene Transactivation by Myocardin
Several reports have shown that the activity and specificity of CArG-dependent genes were regulated by CArG flanking sequences.13,14 To investigate the involvement of the sequences surrounding SM {alpha}-actin CArGs B and A in myocardin-induced transactivation, we tested a series of mutations in CArG flanking regions of the p{alpha}A125Luc construct (Figure 5A). Mutations used in this study were the same as those used in our previous study.13



View larger version (72K):
[in this window]
[in a new window]
 
Figure 5. Mutational analysis of CArG elements and their flanking sequences in the context of the -125/+23 bp SM {alpha}-actin promoter-luciferase gene. A, Schematic representation of mutations covering the -125 to +23 bp region of SM {alpha}-actin gene promoter. Mutated sequences are underlined. CArG elements and TGF-ß1 control element (TCE) are highlighted. B and C, Effects of myocardin on promoter activity of CArG flanking region mutational constructs were evaluated by transfection into rat aortic SMCs. Luciferase activity was measured and normalized for protein content. An arbitrary value of 100 was assigned to the activity of cells transfected with the p{alpha}A125Luc construct. Values represent the mean±SEM.

Myocardin activated transcription of the p{alpha}A125Luc construct by 124-fold in cultured SMCs (Figure 5B). Mutation of CArG B or double mutations of CArGs B and A completely abolished the response to myocardin. In contrast, all CArG flanking region mutants and the CArG A mutation construct exhibited over 10-fold increases by myocardin (Figures 5B and 5C). Our interpretation of these results is that sequences that flank the CArG elements are not necessary for the induction of the SM {alpha}-actin promoter by myocardin and that the basal SM {alpha}-actin promoter from -56 to +23 bp plus CArG B are sufficient to confer myocardin responsiveness.

siRNA Specific for Myocardin Decreased Transcriptional Activity of SMC Marker Genes in Aortic SMCs
Studies thus far have clearly shown that myocardin potently activates CArG-dependent transcription of SMC marker genes in cultured cells. To determine whether endogenous myocardin, which is expressed in our cultured SMCs (Figure 1B), regulates SMC marker gene expression, the effect of an siRNA specific for myocardin was examined by a plasmid-based siRNA production system. Aortic SMCs were cotransfected with SMC-selective marker promoter-enhancer reporter constructs and pMighty-{alpha}Myo, and luciferase activity measured. The siRNA specific for myocardin significantly decreased transcriptional activity of each SMC marker gene (Figure 6). Of interest, the myocardin siRNA reduced activity of SM {alpha}-actin and SM-MHC by 65% and 75%, respectively, but SM22{alpha} by only 40%. This result suggests that the contribution of myocardin may differ between SMC marker genes. However, the decreased efficacy in reducing SM22{alpha} may also be a function of this representing a truncated promoter that does not fully recapitulate expression of the endogenous SM22{alpha} gene,9 as is the case with SM {alpha}-actin8 and SM-MHC.21



View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. Effect of siRNA specific for myocardin on SMC marker gene transcription in rat aortic SMCs. SM {alpha}-actin, SM-MHC, and SM22{alpha} promoter-luciferase constructs were transiently transfected with pMighty-{alpha}Myo or pMighty-{alpha}Scr (250 ng) into SMCs, and assayed for luciferase activity. Activity was normalized for protein content. An arbitrary value of 100 was assigned to the activity of pMighty-{alpha}Scr–transfected cells. Values represent the mean±SEM. *P<0.05 compared with pMighty-{alpha}Scr–transfected cells.

Wild-Type Myocardin Increased, Whereas the Dominant-Negative Myocardin, MyoC{Delta}381, Decreased Expression of Endogenous SMC Markers in Aortic SMCs
To further investigate the role of myocardin in SMC differentiation, the effects of myocardin and its dominant-negative form on endogenous SMC marker expression were examined. We used a carboxy-terminal deletion mutant of myocardin, MyoC{Delta}381, because it behaved as a dominant-negative manner in cotransfection studies with SM {alpha}-actin promoter-reporter constructs (online Figure 1, available in the online data supplement at http://www.circresaha.org). Aortic SMCs were transfected with flag-tagged MyoC{Delta}381 or flag-tagged myocardin, incubated for 72 hours, and used for immunofluorescence studies. Studies were performed in subconfluent cultures of SMCs leading to sub-optimal transfection efficiencies, for two reasons: (1) to permit dual immunofluorescence analyses of individual cells; and (2) because this is known to result in suboptimal expression of SMC differentiation markers, thereby permitting analyses of both repression and activation of differentiation. As shown in Figures 7A through 7D, expression of SM {alpha}-actin was markedly suppressed in the flag-tagged MyoC{Delta}381-expressing cells. Indeed, the fraction of MyoC{Delta}381-expressing cells that were positive for SM {alpha}-actin was only 10% as compared with 57% in non-MyoC{Delta}381-expressing cells in the same culture dish (online Table 2). In contrast, expression of SM {alpha}-actin protein was enhanced in flag-tagged myocardin-expressing cells (Figures 7E through 7H) with 83% of positive staining for SM {alpha}-actin compared with 54% in non–flag-tagged myocardin-expressing cells. GFP expression vector was used as a control, with no effect on the ratio of SM {alpha}-actin–positive cells.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 7. Effect of overexpression of either MyoC{Delta}381 or wild-type myocardin on SM {alpha}-actin protein expression as determined by immunocytochemistry. Rat aortic SMCs were transiently transfected with MyoC{Delta}381 (A through D) or myocardin (E through H) and were stained with polyclonal anti-flag antibody and secondary Cy2-conjugated anti-rabbit IgG antibody (B and F) and with monoclonal anti-SM {alpha}-actin antibody and secondary Cy3-conjugated anti-mouse IgG antibody (C and G). Cells were counterstained with DAPI (A and E). Images were acquired with Olympus IX51 microscope and RS Image version 1.7.3 software (Roper Scientific, Inc). Merged images are shown (D and H). Arrowheads indicate flag-positive cells.

To further assess effects of myocardin and its dominant-negative form on expression of endogenous SMC marker genes, cultured SMCs were infected with either Ad/Myo or Ad/MyoDN and expression of SM {alpha}-actin and SM-MHC mRNA analyzed by real-time RT-PCR. Results showed that wild-type myocardin induced SM {alpha}-actin and SM-MHC mRNA expression significantly, whereas MyoC{Delta}381 suppressed expression (Figure 8). These results provide strong evidence that endogenous myocardin plays an important role in regulating expression of multiple SMC marker genes in SMCs.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 8. Effect of adenovirus-mediated overexpression of either MyoC{Delta}381 or wild-type myocardin on SMC marker genes expression as determined by real-time PCR. Rat aortic SMCs were infected with Ad/MyoDN, Ad/Myo, or Ad/Emp at 50 MOI for 1 hour and incubated for indicated times. Expression of SM {alpha}-actin and SM-MHC mRNA and 18S rRNA were quantified by real-time PCR. Ratios of SM {alpha}-actin (A and C) or SM-MHC (B and D) to 18S rRNA expression were calculated. An arbitrary value of 100 was assigned to Ad/Emp-infected control. Values represent mean±SEM (n=4). *P<0.05 compared with control.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Although it is clear that the binding of SRF to CArG elements is required for expression of multiple SMC-specific/-selective genes, the mechanism by which these complexes confer cell-specificity has not been elucidated. The search for cell-selective SRF coactivators extended to many fields of study including skeletal and cardiac muscle, which also express a plethora of CArG-SRF dependent genes during differentiation-maturation.25,26 Thus, the discovery of the potent "cardiac-selective" SRF coactivator myocardin by Wang et al18 was a particularly exciting advance for this field. Although Chen et al19 recently showed that myocardin was also expressed in adult aorta and could induce several SMC marker genes by transfection studies, it has not been elucidated whether myocardin normally plays a role in regulating SMC-selective CArG-SRF–dependent genes in SMCs. Our results provide several compelling lines of evidence indicating that myocardin plays a key role in control of expression of multiple CArG-SRF–dependent genes in SMCs: (1) it is expressed in multiple vascular and nonvascular SMCs in adult mice; (2) it is expressed in an A404 SMC precursor line, but not the parental P19 cells, and expression is increased when A404 cells are induced to differentiate; (3) it potently activates transcription of multiple SMC marker genes in cultured SMCs or embryonic fibroblasts in a CArG-dependent manner; and (4) suppression of endogenous myocardin in SMCs with either siRNA or dominant-negative myocardin markedly decreases expression of endogenous SMC marker genes and/or activity of exogenously transfected SMC marker gene promoter-reporter constructs.

Results of the present studies confirm and extend previous studies of Wang et al18 who suggested that cooperative interaction of multiple CArG elements were necessary for myocardin-induced gene activation based on observations that myocardin induced the activity of a reporter construct containing 4 tandem copies of c-fos SRE linked to the E1b promoter, but not the single CArG containing c-fos gene construct in COS cells. In general, our results are consistent with their findings in that myocardin responsiveness was without question CArG-dependent. However, our results revealed a subtle but potentially significant difference in that we found that retention of a single CArG B element within the context of the -2.6/+2.8 kb SM {alpha}-actin promoter8 was sufficient to confer myocardin responsiveness. Although the underlying mechanisms responsible for this are unclear, results clearly indicate that gene context plays a critical role in determining myocardin responsiveness, perhaps through cooperative interaction with other cis- and trans-factors in a manner similar to myocyte enhancer factor-2 (MEF2), MyoD/myogenin, and SRF in skeletal muscle,25 where retention of only a subset of cis-elements for these factors was necessary for recruitment of other factors through protein-protein interactions. Consistent with this, results of the present studies provided evidence for formation of a higher order CArG-SRF-myocardin complex in SMCs that exhibited a lower mobility in EMSA than the equivalent complex in ECs. Although somewhat speculative, it is interesting to suggest that this may reflect recruitment of some additional factor(s) present in SMCs that is lacking in ECs. Indeed, we have previously published evidence for the existence of SMC-selective higher order CArG-SRF complex that was dependent on protein-protein interaction with CArG-SRF and not additional DNA sequences.13 However, much further investigation will be needed to reconcile these observations.

A particularly intriguing and potentially significant observation in the present studies was that myocardin mRNA was expressed in a novel A404 SMC precursor line, which we have previously described,12 but not in the P19 stem cells from which they were derived. Importantly, these SMC precursor cells do not express any known SMC marker gene.12 These observations have several possible important implications. First, myocardin may serve as a novel marker to identify SMC progenitor cells, although further in vivo studies will be necessary to test this possibility. Second, results indicate that, at least within some cell contexts, expression of myocardin alone is not sufficient to induce SMC differentiation. This is not surprising in that A404 cells may lack important cofactors or signals necessary for SMC gene activation. Indeed, we previously demonstrated that SRF could not bind to the CArG-containing regions of SMC marker genes within the context of intact chromatin, although SRF was able to bind to the CArG region of the c-fos gene in A404 cells.12 However, on RA treatment, cells exhibited a number of histone modifications consistent with chromatin relaxation and SRF bound to CArG regions of SMC marker genes. Taken together, results support a model in which A404 cells fail to activate SMC differentiation marker genes due to aspects of chromatin structure that prevent binding of SRF to CArG regions of SMC marker genes and subsequent recruitment of myocardin and/or other cofactors. Alternatively, because RA increased myocardin mRNA expression, it is possible that the level of expression of myocardin is simply insufficient to activate SMC marker genes in A404 cells. Of interest, myocardin has a SAP domain, named for scaffold attachment factors A and B (SAF-A/B), acinus, and protein inhibitor of activated STAT (PIAS), which may serve as a potential DNA-binding motif that could perform a specific role in chromatin organization.27 It is interesting to speculate that myocardin may elicit its effects, at least in part, by regulating chromatin structure. In any case, further studies are needed to identify what factors are induced by RA treatment in A404 cells that result in chromatin remodeling and coordinate activation of virtually all known SMC marker genes.

Although results of the present studies clearly implicate an important role for myocardin in the control of CArG-dependent SMC marker genes, it is clearly not a SMC-specific gene in that it is also expressed in cardiomyocytes. Of interest, many similarities exist in mechanisms that contribute to cell-specific gene expression in these two cell types beyond a dominant role of CArG-SRF–dependent mechanisms.15,16,22,28–32 For example, cell-specific expression in both cell types is believed to result from complex combinatorial interactions of multiple cis-acting elements and their trans-acting factors, none of which are completely cell-specific. Indeed, several gene families have been implicated in regulation of cell-specific expression in both cardiomyocytes and SMCs, including homeodomain proteins such as MHox and Nkx factors,16,28 GATA proteins,15,29 the Sp1 family,22,29 basic helix-loop-helix transcription factors,30,31 and the MEF-2 family.29,32 However, the precise mechanisms whereby these various factors act in concert with myocardin to regulate the complex temporal and spatial pattern of expression of various cardiac and SMC-specific genes remain to be elucidated. Identification of the cooperative mechanisms by which these transcription factors and their cofactors, including SRF and myocardin regulate SMC-specific expression will provide important insights regarding the control of differentiation and dedifferentiation of SMCs.

In summary, the results of the present studies implicate a critical role for myocardin in normal regulation of expression of multiple CArG-SRF–dependent SMC marker genes in cultured cell systems. Moreover, our results and others18,19 show that myocardin is expressed both during early embryonic development as well as in adult SMCs. Although potentially of major significance, clearly further studies are needed to directly investigate the role of myocardin in vivo during development and after vascular injury that is characterized by phenotypic modulation of SMCs.22


*    Acknowledgments
 
This work was supported by NIH grants P01HL19242, R01HL38854, and R37HL57353 to G.K.O. E.N.O. was supported by grants from the NIH and the D.W. Reynolds Center for Clinical Cardiovascular Research. We thank Diane Raines, Doug Mullinex, and Lindsey Murray for their excellent technical assistance.

Received September 19, 2002; revision received February 25, 2003; accepted March 13, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Schwartz SM, Ross R. Cellular proliferation in atherosclerosis and hypertension. Prog Cardiovasc Dis. 1984; 26: 355–372.[CrossRef][Medline] [Order article via Infotrieve]

2. Owens GK. Regulation of differentiation of vascular smooth muscle cells. Physiol Rev. 1995; 75: 487–517.[Abstract/Free Full Text]

3. Treisman R. Identification of a protein binding site that mediates transcriptional response of the c-fos gene to serum factors. Cell. 1986; 46: 567–574.[CrossRef][Medline] [Order article via Infotrieve]

4. Nakano Y, Nishihara T, Sasayama S, Miwa T, Kamada S, Kakunaga T. Transcriptional regulatory elements in the 5' upstream and first intron regions of the human smooth muscle (aortic type) {alpha}-actin-encoding gene. Gene. 1991; 99: 285–289.[CrossRef][Medline] [Order article via Infotrieve]

5. Katoh Y, Loukianov E, Kopras E, Zilberman A, Periasamy M. Identification of functional promoter elements in the rabbit smooth muscle myosin heavy chain gene. J Biol Chem. 1994; 269: 30538–30545.[Abstract/Free Full Text]

6. Manabe I, Owens GK. CArG elements control smooth muscle subtype-specific expression of smooth muscle myosin in vivo. J Clin Invest. 2001; 107: 823–834.[Medline] [Order article via Infotrieve]

7. Solway J, Seltzer J, Samaha FF, Kim S, Alger LE, Niu Q, Morrisey EE, Ip HS, Parmacek MS. Structure and expression of a smooth muscle cell-specific gene, SM22{alpha}. J Biol Chem. 1995; 270: 13460–13469.[Abstract/Free Full Text]

8. Mack CP, Owens GK. Regulation of smooth muscle {alpha}-actin expression in vivo is dependent on CArG elements within the 5' and first intron promoter regions. Circ Res. 1999; 84: 852–861.[Abstract/Free Full Text]

9. Li L, Liu Z-C, Mercer B, Overbeek P, Olson EN. Evidence for serum response factor-mediated regulatory networks governing SM22{alpha} transcription in smooth, skeletal, and cardiac muscle cells. Dev Biol. 1997; 187: 311–321.[CrossRef][Medline] [Order article via Infotrieve]

10. Norman C, Runswick M, Pollock R, Treisman R. Isolation and property of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element. Cell. 1988; 55: 989–1003.[CrossRef][Medline] [Order article via Infotrieve]

11. Landerholm TE, Dong X-R, Lu J, Belaguli NS, Schwartz RJ, Majesky MW. A role for serum response factor in coronary smooth muscle differentiation from proepicardial cells. Development. 1999; 126: 2053–2062.[Abstract]

12. Manabe I, Owens GK. Recruitment of serum response factor and hyperacetylation of histones at smooth muscle-specific regulatory regions during differentiation of a novel P19-derived in vitro smooth muscle differentiation system. Circ Res. 2001; 88: 1127–1134.[Abstract/Free Full Text]

13. Mack CP, Thompson MM, Lawrenz-Smith S, Owens GK. Smooth muscle {alpha}-actin CArG elements coordinate formation of a smooth muscle cell-selective, serum response factor-containing activation complex. Circ Res. 2000; 86: 221–232.[Abstract/Free Full Text]

14. Hautmann MB, Madsen CS, Owens GK. A transforming growth factor ß (TGFß) control element drives TGFß-induced stimulation of smooth muscle {alpha}-actin gene expression in concert with two CArG elements. J Biol Chem. 1997; 272: 10948–10956.[Abstract/Free Full Text]

15. Nishida W, Nakamura M, Mori S, Takahashi M, Ohkawa Y, Tadokoro S, Yoshida K, Hiwada K, Hayashi K, Sobue K. A triad of serum response factor and the GATA and NK families governs the transcription of smooth and cardiac muscle genes. J Biol Chem. 2002; 277: 7308–7317.[Abstract/Free Full Text]

16. Hautmann MB, Thompson MM, Swartz EA, Olson EN, Owens GK. Angiotensin II-induced stimulation of smooth muscle {alpha}-actin expression by serum response factor and the homeodomain transcription factor MHox. Circ Res. 1997; 81: 600–610.[Abstract/Free Full Text]

17. Camoretti-Mercado B, Liu H, Halayko AJ, Forsythe SM, Kyle JW, Li B, Fu Y, McConville J, Kogut P, Vieira JE, Patel NM, Hershenson MB, Fuchs E, Sinha S, Miano JM, Parmacek MS, Burkhardt JK, Solway J. Physiological control of smooth muscle-specific gene expression through regulated nuclear translocation of serum response factor. J Biol Chem. 2000; 275: 30387–30393.[Abstract/Free Full Text]

18. Wang D-Z, Chang PS, Wang Z, Sutherland L, Richardson JA, Small E, Krieg PA, Olson EN. Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell. 2001; 105: 851–862.[CrossRef][Medline] [Order article via Infotrieve]

19. Chen J, Kitchen CM, Streb JW, Miano JM. Myocardin: a component of a molecular switch for smooth muscle differentiation. J Mol Cell Cardiol. 2002; 34: 1345–1356.[CrossRef][Medline] [Order article via Infotrieve]

20. Shimizu RT, Blank RS, Jervis R, Lawrenz-Smith SC, Owens GK. The smooth muscle {alpha}-actin gene promoter is differentially regulated in smooth muscle versus non-smooth muscle cells. J Biol Chem. 1995; 270: 7631–7643.[Abstract/Free Full Text]

21. Madsen CS, Regan CP, Hungerford JE, White SL, Manabe I, Owens GK. Smooth muscle-specific expression of the smooth muscle myosin heavy chain gene in transgenic mice requires 5'-flanking and first intronic DNA sequence. Circ Res. 1998; 82: 908–917.[Abstract/Free Full Text]

22. Regan CP, Adam PJ, Madsen CS, Owens GK. Molecular mechanisms of decreased smooth muscle differentiation marker expression after vascular injury. J Clin Invest. 2000; 106: 1139–1147.[Medline] [Order article via Infotrieve]

23. Ooboshi H, Chu Y, Rios CD, Faraci FM, Davidson BL, Heistad DD. Altered vascular function after adenovirus-mediated overexpression of endothelial nitric oxide synthase. Am J Physiol Heart Circ Physiol. 1997; 273: H265–H270.[Abstract/Free Full Text]

24. Hirschi KK, Rohovsky SA, D’Amore PA. PDGF, TGF-ß, and heterotypic cell-cell interactions mediate endothelial cell-induced recruitment of 10T1/2 cells, and their differentiation to a smooth muscle fate. J Cell Biol. 1998; 141: 805–814.[Abstract/Free Full Text]

25. Molkentin JD, Black BL, Martin JF, Olson EN. Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell. 1995; 83: 1125–1136.[CrossRef][Medline] [Order article via Infotrieve]

26. Lee TC, Chow KL, Fang P, Schwartz RJ. Activation of skeletal {alpha}-actin gene transcription: the cooperative formation of serum response factor-binding complexes over positive cis-acting promoter serum response elements displaces a negative-acting nuclear factor enriched in replicating myoblasts and nonmyogenic cells. Mol Cell Biol. 1991; 11: 5090–5100.[Abstract/Free Full Text]

27. Aravind L, Koonin EV. SAP-a putative DNA-binding motif involved in chromosomal organization. Trends Biochem Sci. 2000; 25: 112–114.[CrossRef][Medline] [Order article via Infotrieve]

28. Durocher D, Charron F, Warren R, Schwartz RJ, Nemer M. The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors. EMBO J. 1997; 16: 5687–5696.[CrossRef][Medline] [Order article via Infotrieve]

29. Lisi RD, Millino C, Calabria E, Altruda F, Schiaffino S, Ausoni S. Combinatorial cis-acting elements control tissue-specific activation of the cardiac troponin I gene in vitro and in vivo. J Biol Chem. 1998; 273: 25371–25380.[Abstract/Free Full Text]

30. Srivastava D, Cserjesi P, Olson EN. A subclass of bHLH proteins required for cardiac morphogenesis. Science. 1995; 270: 1995–1999.[Abstract/Free Full Text]

31. Yamagishi H, Olson EN, Srivastava D. The basic helix-loop-helix transcription factor, dHAND, is required for vascular development. J Clin Invest. 2000; 105: 261–270.[Medline] [Order article via Infotrieve]

32. Firulli AB, Miano JM, Bi W, Johnson AD, Casscells W, Olson EN, Schwarz JJ. Myocyte enhancer binding factor-2 expression and activity in vascular smooth muscle cells: association with the activated phenotype. Circ Res. 1996; 78: 196–204.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
P.-Y. Chen, M. Simons, and R. Friesel
FRS2 via Fibroblast Growth Factor Receptor 1 Is Required for Platelet-derived Growth Factor Receptor {beta}-mediated Regulation of Vascular Smooth Muscle Marker Gene Expression
J. Biol. Chem., June 5, 2009; 284(23): 15980 - 15992.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
W. Zhou, S. Negash, J. Liu, and J. U. Raj
Modulation of pulmonary vascular smooth muscle cell phenotype in hypoxia: role of cGMP-dependent protein kinase and myocardin
Am J Physiol Lung Cell Mol Physiol, May 1, 2009; 296(5): L780 - L789.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Q. Xiao, Z. Luo, A. E. Pepe, A. Margariti, L. Zeng, and Q. Xu
Embryonic stem cell differentiation into smooth muscle cells is mediated by Nox4-produced H2O2
Am J Physiol Cell Physiol, April 1, 2009; 296(4): C711 - C723.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Perot, J. Derre, J.-M. Coindre, F. Tirode, C. Lucchesi, O. Mariani, L. Gibault, L. Guillou, P. Terrier, and A. Aurias
Strong Smooth Muscle Differentiation Is Dependent on Myocardin Gene Amplification in Most Human Retroperitoneal Leiomyosarcomas
Cancer Res., March 15, 2009; 69(6): 2269 - 2278.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. N. Davis, A. C. Hilyard, P. H. Nguyen, G. Lagna, and A. Hata
Induction of MicroRNA-221 by Platelet-derived Growth Factor Signaling Is Critical for Modulation of Vascular Smooth Muscle Phenotype
J. Biol. Chem., February 6, 2009; 284(6): 3728 - 3738.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. W. Orr, M. Y. Lee, J. A. Lemmon, A. Yurdagul Jr, M. F. Gomez, P. D. Schoppee Bortz, and B. R. Wamhoff
Molecular Mechanisms of Collagen Isotype-Specific Modulation of Smooth Muscle Cell Phenotype
Arterioscler. Thromb. Vasc. Biol., February 1, 2009; 29(2): 225 - 231.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Jin, T. Yoshida, R. Ho, G. K. Owens, and A. V. Somlyo
The Actin-associated Protein Palladin Is Required for Development of Normal Contractile Properties of Smooth Muscle Cells Derived from Embryoid Bodies
J. Biol. Chem., January 23, 2009; 284(4): 2121 - 2130.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Kawai-Kowase, T. Ohshima, H. Matsui, T. Tanaka, T. Shimizu, T. Iso, M. Arai, G. K. Owens, and M. Kurabayashi
PIAS1 Mediates TGF{beta}-Induced SM {alpha}-Actin Gene Expression Through Inhibition of KLF4 Function-Expression by Protein Sumoylation
Arterioscler. Thromb. Vasc. Biol., January 1, 2009; 29(1): 99 - 106.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. Morrow, S. Guha, C. Sweeney, Y. Birney, T. Walshe, C. O'Brien, D. Walls, E. M. Redmond, and P. A. Cahill
Notch and Vascular Smooth Muscle Cell Phenotype
Circ. Res., December 5, 2008; 103(12): 1370 - 1382.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. A. Lemmon and B. R. Wamhoff
"FRNKly, Smooth Muscle, I Don't Give a CArG!": A Novel Mechanism for Smooth Muscle Cell Differentiation
Arterioscler. Thromb. Vasc. Biol., December 1, 2008; 28(12): 2091 - 2093.
[Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. Vaahtomeri, E. Ventela, K. Laajanen, P. Katajisto, P.-J. Wipff, B. Hinz, T. Vallenius, M. Tiainen, and T. P. Makela
Lkb1 is required for TGF{beta}-mediated myofibroblast differentiation
J. Cell Sci., November 1, 2008; 121(21): 3531 - 3540.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Yoshida, Q. Gan, and G. K. Owens
Kruppel-like factor 4, Elk-1, and histone deacetylases cooperatively suppress smooth muscle cell differentiation markers in response to oxidized phospholipids
Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1175 - C1182.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
Y. Shang, T. Yoshida, B. A. Amendt, J. F. Martin, and G. K. Owens
Pitx2 is functionally important in the early stages of vascular smooth muscle cell differentiation
J. Cell Biol., October 14, 2008; 181(3): 461 - 473.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. A. Saleem, J. Zavadil, M. Bailly, K. McGee, I. R. Witherden, H. Pavenstadt, H. Hsu, J. Sanday, S. C. Satchell, R. Lennon, et al.
The molecular and functional phenotype of glomerular podocytes reveals key features of contractile smooth muscle cells
Am J Physiol Renal Physiol, October 1, 2008; 295(4): F959 - F970.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. E. Westerweel and M. C. Verhaar
Directing Myogenic Mesenchymal Stem Cell Differentiation
Circ. Res., September 12, 2008; 103(6): 560 - 561.
[Full Text] [PDF]


Home page
Circ. Res.Home page
E. S. Jeon, W. S. Park, M. J. Lee, Y. M. Kim, J. Han, and J. H. Kim
A Rho Kinase/Myocardin-Related Transcription Factor-A-Dependent Mechanism Underlies the Sphingosylphosphorylcholine-Induced Differentiation of Mesenchymal Stem Cells Into Contractile Smooth Muscle Cells
Circ. Res., September 12, 2008; 103(6): 635 - 642.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. S. Parmacek
Myocardin: Dominant Driver of the Smooth Muscle Cell Contractile Phenotype
Arterioscler. Thromb. Vasc. Biol., August 1, 2008; 28(8): 1416 - 1417.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
X. Long, R. D. Bell, W. T. Gerthoffer, B. V. Zlokovic, and J. M. Miano
Myocardin Is Sufficient for a Smooth Muscle-Like Contractile Phenotype
Arterioscler. Thromb. Vasc. Biol., August 1, 2008; 28(8): 1505 - 1510.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. R. Wamhoff, K. R. Lynch, T. L. Macdonald, and G. K. Owens
Sphingosine-1-Phosphate Receptor Subtypes Differentially Regulate Smooth Muscle Cell Phenotype
Arterioscler. Thromb. Vasc. Biol., August 1, 2008; 28(8): 1454 - 1461.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D.L. Tharp, B.R. Wamhoff, H. Wulff, G. Raman, A. Cheong, and D.K. Bowles
Local Delivery of the KCa3.1 Blocker, TRAM-34, Prevents Acute Angioplasty-Induced Coronary Smooth Muscle Phenotypic Modulation and Limits Stenosis
Arterioscler. Thromb. Vasc. Biol., June 1, 2008; 28(6): 1084 - 1089.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D.-W. Lin, I.-C. Chang, A. Tseng, M.-L. Wu, C.-H. Chen, C. A. Patenaude, M. D. Layne, and S.-F. Yet
Transforming Growth Factor {beta} Up-regulates Cysteine-rich Protein 2 in Vascular Smooth Muscle Cells via Activating Transcription Factor 2
J. Biol. Chem., May 30, 2008; 283(22): 15003 - 15014.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Elberg, L. Chen, D. Elberg, M. D. Chan, C. J. Logan, and M. A. Turman
MKL1 mediates TGF-{beta}1-induced {alpha}-smooth muscle actin expression in human renal epithelial cells
Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1116 - F1128.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Au, J. Tam, D. Fukumura, and R. K. Jain
Bone marrow-derived mesenchymal stem cells facilitate engineering of long-lasting functional vasculature
Blood, May 1, 2008; 111(9): 4551 - 4558.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kennard, H. Liu, and B. Lilly
Transforming Growth Factor- (TGF- 1) Down-regulates Notch3 in Fibroblasts to Promote Smooth Muscle Gene Expression
J. Biol. Chem., January 18, 2008; 283(3): 1324 - 1333.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Zhang, S. Zhuang, D. E. Casteel, D. J. Looney, G. R. Boss, and R. B. Pilz
A Cysteine-rich LIM-only Protein Mediates Regulation of Smooth Muscle-specific Gene Expression by cGMP-dependent Protein Kinase
J. Biol. Chem., November 16, 2007; 282(46): 33367 - 33380.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Q. Gan, T. Yoshida, J. Li, and G. K. Owens
Smooth Muscle Cells and Myofibroblasts Use Distinct Transcriptional Mechanisms for Smooth Muscle {alpha}-Actin Expression
Circ. Res., October 26, 2007; 101(9): 883 - 892.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. A. Pidkovka, O. A. Cherepanova, T. Yoshida, M. R. Alexander, R. A. Deaton, J. A. Thomas, N. Leitinger, and G. K. Owens
Oxidized Phospholipids Induce Phenotypic Switching of Vascular Smooth Muscle Cells In Vivo and In Vitro
Circ. Res., October 12, 2007; 101(8): 792 - 801.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Kanematsu, A. Ramachandran, and R. M. Adam
GATA-6 mediates human bladder smooth muscle differentiation: involvement of a novel enhancer element in regulating {alpha}-smooth muscle actin gene expression
Am J Physiol Cell Physiol, September 1, 2007; 293(3): C1093 - C1102.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Zhang, H. Fang, J. Zhou, and B. P. Herring
A Novel Role of Brg1 in the Regulation of SRF/MRTFA-dependent Smooth Muscle-specific Gene Expression
J. Biol. Chem., August 31, 2007; 282(35): 25708 - 25716.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Li, Z. Luo, W. Huang, Q. Lu, C. S. Wilcox, P. A. Jose, and S. Chen
Response Gene to Complement 32, a Novel Regulator for Transforming Growth Factor-beta-induced Smooth Muscle Differentiation of Neural Crest Cells
J. Biol. Chem., April 6, 2007; 282(14): 10133 - 10137.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. S. Parmacek
Myocardin-Related Transcription Factors: Critical Coactivators Regulating Cardiovascular Development and Adaptation
Circ. Res., March 16, 2007; 100(5): 633 - 644.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. P. Staus, A. L. Blaker, J. M. Taylor, and C. P. Mack
Diaphanous 1 and 2 Regulate Smooth Muscle Cell Differentiation by Activating the Myocardin-Related Transcription Factors
Arterioscler. Thromb. Vasc. Biol., March 1, 2007; 27(3): 478 - 486.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Touw, A. M. Hoggatt, G. Simon, and B. P. Herring
Hprt-targeted transgenes provide new insights into smooth muscle-restricted promoter activity
Am J Physiol Cell Physiol, March 1, 2007; 292(3): C1024 - C1032.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Yoshida, Q. Gan, Y. Shang, and G. K. Owens
Platelet-derived growth factor-BB represses smooth muscle cell marker genes via changes in binding of MKL factors and histone deacetylases to their promoters
Am J Physiol Cell Physiol, February 1, 2007; 292(2): C886 - C895.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Chow, R. D. Bell, R. Deane, J. W. Streb, J. Chen, A. Brooks, W. Van Nostrand, J. M. Miano, and B. V. Zlokovic
Serum response factor and myocardin mediate arterial hypercontractility and cerebral blood flow dysregulation in Alzheimer's phenotype
PNAS, January 16, 2007; 104(3): 823 - 828.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Kawai-Kowase and G. K. Owens
Multiple repressor pathways contribute to phenotypic switching of vascular smooth muscle cells
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C59 - C69.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
E. S. Jeon, H. J. Moon, M. J. Lee, H. Y. Song, Y. M. Kim, Y. C. Bae, J. S. Jung, and J. H. Kim
Sphingosylphosphorylcholine induces differentiation of human mesenchymal stem cells into smooth-muscle-like cells through a TGF-{beta}-dependent mechanism
J. Cell Sci., December 1, 2006; 119(23): 4994 - 5005.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
B. P. Herring, O. El-Mounayri, P. J. Gallagher, F. Yin, and J. Zhou
Regulation of myosin light chain kinase and telokin expression in smooth muscle tissues
Am J Physiol Cell Physiol, November 1, 2006; 291(5): C817 - C827.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
E. E. Creemers, L. B. Sutherland, J. McAnally, J. A. Richardson, and E. N. Olson
Myocardin is a direct transcriptional target of Mef2, Tead and Foxo proteins during cardiovascular development
Development, November 1, 2006; 133(21): 4245 - 4256.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. L. Tharp, B. R. Wamhoff, J. R. Turk, and D. K. Bowles
Upregulation of intermediate-conductance Ca2+-activated K+ channel (IKCa1) mediates phenotypic modulation of coronary smooth muscle
Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2493 - H2503.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Doi, T. Iso, H. Sato, M. Yamazaki, H. Matsui, T. Tanaka, I. Manabe, M. Arai, R. Nagai, and M. Kurabayashi
Jagged1-selective Notch Signaling Induces Smooth Muscle Differentiation via a RBP-J{kappa}-dependent Pathway
J. Biol. Chem., September 29, 2006; 281(39): 28555 - 28564.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Li, S. Chang, X. Qi, J. A. Richardson, and E. N. Olson
Requirement of a Myocardin-Related Transcription Factor for Development of Mammary Myoepithelial Cells
Mol. Cell. Biol., August 1, 2006; 26(15): 5797 - 5808.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Sun, K. Boyd, W. Xu, J. Ma, C. W. Jackson, A. Fu, J. M. Shillingford, G. W. Robinson, L. Hennighausen, J. K. Hitzler, et al.
Acute Myeloid Leukemia-Associated Mkl1 (Mrtf-a) Is a Key Regulator of Mammary Gland Function
Mol. Cell. Biol., August 1, 2006; 26(15): 5809 - 5826.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. Sinha, B. R. Wamhoff, M. H. Hoofnagle, J. Thomas, R. L. Neppl, T. Deering, B. P. Helmke, D. K. Bowles, A. V. Somlyo, and G. K. Owens
Assessment of Contractility of Purified Smooth Muscle Cells Derived from Embryonic Stem Cells
Stem Cells, July 1, 2006; 24(7): 1678 - 1688.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
F. Yin, A. M. Hoggatt, J. Zhou, and B. P. Herring
130-kDa smooth muscle myosin light chain kinase is transcribed from a CArG-dependent, internal promoter within the mouse mylk gene
Am J Physiol Cell Physiol, June 1, 2006; 290(6): C1599 - C1609.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
W. Xing, T.-C. Zhang, D. Cao, Z. Wang, C. L. Antos, S. Li, Y. Wang, E. N. Olson, and D.-Z. Wang
Myocardin Induces Cardiomyocyte Hypertrophy
Circ. Res., April 28, 2006; 98(8): 1089 - 1097.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. R. Wamhoff, D. K. Bowles, and G. K. Owens
Excitation-Transcription Coupling in Arterial Smooth Muscle
Circ. Res., April 14, 2006; 98(7): 868 - 878.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. S.M. Rensen, P. M.G. Niessen, X. Long, P. A. Doevendans, J. M. Miano, and G. J.J.M. van Eys
Contribution of serum response factor and myocardin to transcriptional regulation of smoothelins
Cardiovasc Res, April 1, 2006; 70(1): 136 - 145.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
I. Gorenne, L. Jin, T. Yoshida, J.M. Sanders, I.J. Sarembock, G.K. Owens, A.P. Somlyo, and A.V. Somlyo
LPP Expression During In Vitro Smooth Muscle Differentiation and Stent-Induced Vascular Injury
Circ. Res., February 17, 2006; 98(3): 378 - 385.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Zhou, G. Hu, and B. P. Herring
Smooth Muscle-Specific Genes Are Differentially Sensitive to Inhibition by Elk-1
Mol. Cell. Biol., November 15, 2005; 25(22): 9874 - 9885.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. E. Callis, D. Cao, and D.-Z. Wang
Bone Morphogenetic Protein Signaling Modulates Myocardin Transactivation of Cardiac Genes
Circ. Res., November 11, 2005; 97(10): 992 - 1000.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Qiu, R. P. Ritchie, Z. Fu, D. Cao, J. Cumming, J. M. Miano, D.-Z. Wang, H. J. Li, and L. Li
Myocardin Enhances Smad3-Mediated Transforming Growth Factor-{beta}1 Signaling in a CArG Box-Independent Manner: Smad-Binding Element Is an Important cis Element for SM22{alpha} Transcription In Vivo
Circ. Res., November 11, 2005; 97(10): 983 - 991.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H. Doi, T. Iso, M. Yamazaki, H. Akiyama, H. Kanai, H. Sato, K. Kawai-Kowase, T. Tanaka, T. Maeno, E.-i. Okamoto, et al.
HERP1 Inhibits Myocardin-Induced Vascular Smooth Muscle Cell Differentiation by Interfering With SRF Binding to CArG Box
Arterioscler. Thromb. Vasc. Biol., November 1, 2005; 25(11): 2328 - 2334.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Francis, S. K. Chakrabarti, J. C. Garmey, and R. G. Mirmira
Pdx-1 Links Histone H3-Lys-4 Methylation to RNA Polymerase II Elongation during Activation of Insulin Transcription
J. Biol. Chem., October 28, 2005; 280(43): 36244 - 36253.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Oh, J. A. Richardson, and E. N. Olson
Requirement of myocardin-related transcription factor-B for remodeling of branchial arch arteries and smooth muscle differentiation
PNAS, October 18, 2005; 102(42): 15122 - 15127.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Kawai-Kowase, M. S. Kumar, M. H. Hoofnagle, T. Yoshida, and G. K. Owens
PIAS1 Activates the Expression of Smooth Muscle Cell Differentiation Marker Genes by Interacting with Serum Response Factor and Class I Basic Helix-Loop-Helix Proteins
Mol. Cell. Biol., September 15, 2005; 25(18): 8009 - 8023.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. van Tuyn, S. Knaan-Shanzer, M. J.M. van de Watering, M. de Graaf, A. van der Laarse, M. J. Schalij, E. E. van der Wall, A. A.F. de Vries, and D. E. Atsma
Activation of cardiac and smooth muscle-specific genes in primary human cells after forced expression of human myocardin
Cardiovasc Res, August 1, 2005; 67(2): 245 - 255.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. V. G. Bosc, J. J. Layne, M. T. Nelson, and D. C. Hill-Eubanks
Nuclear Factor of Activated T Cells and Serum Response Factor Cooperatively Regulate the Activity of an {alpha}-Actin Intronic Enhancer
J. Biol. Chem., July 15, 2005; 280(28): 26113 - 26120.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Zhou and B. P. Herring
Mechanisms Responsible for the Promoter-specific Effects of Myocardin
J. Biol. Chem., March 18, 2005; 280(11): 10861 - 10869.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Proweller, W. S. Pear, and M. S. Parmacek
Notch Signaling Represses Myocardin-induced Smooth Muscle Cell Differentiation
J. Biol. Chem., March 11, 2005; 280(10): 8994 - 9004.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Liu, S. Sinha, O. G. McDonald, Y. Shang, M. H. Hoofnagle, and G. K. Owens
Kruppel-like Factor 4 Abrogates Myocardin-induced Activation of Smooth Muscle Gene Expression
J. Biol. Chem., March 11, 2005; 280(10): 9719 - 9727.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
E. M. Small, A. S. Warkman, D.-Z. Wang, L. B. Sutherland, E. N. Olson, and P. A. Krieg
Myocardin is sufficient and necessary for cardiac gene expression in Xenopus
Development, March 1, 2005; 132(5): 987 - 997.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Yoshida and G. K. Owens
Molecular Determinants of Vascular Smooth Muscle Cell Diversity
Circ. Res., February 18, 2005; 96(3): 280 - 291.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Streb and J. M. Miano
AKAP12{alpha}, an Atypical Serum Response Factor-dependent Target Gene
J. Biol. Chem., February 11, 2005; 280(6): 4125 - 4134.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Yin and B. P. Herring
GATA-6 Can Act as a Positive or Negative Regulator of Smooth Muscle-specific Gene Expression
J. Biol. Chem., February 11, 2005; 280(6): 4745 - 4752.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. Drori, G. D. Girnun, L. Tou, J. D. Szwaya, E. Mueller, X. Kia, R. A. Shivdasani, and B. M. Spiegelman
Hic-5 regulates an epithelial program mediated by PPAR{gamma}
Genes & Dev., February 1, 2005; 19(3): 362 - 375.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. J. Lepore, T. P. Cappola, P. A. Mericko, E. E. Morrisey, and M. S. Parmacek
GATA-6 Regulates Genes Promoting Synthetic Functions in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., February 1, 2005; 25(2): 309 - 314.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Li, M. P. Czubryt, J. McAnally, R. Bassel-Duby, J. A. Richardson, F. F. Wiebel, A. Nordheim, and E. N. Olson
Requirement for serum response factor for skeletal muscle growth and maturation revealed by tissue-specific gene deletion in mice
PNAS, January 25, 2005; 102(4): 1082 - 1087.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Cao, Z. Wang, C.-L. Zhang, J. Oh, W. Xing, S. Li, J. A. Richardson, D.-Z. Wang, and E. N. Olson
Modulation of Smooth Muscle Gene Expression by Association of Histone Acetyltransferases and Deacetylases with Myocardin
Mol. Cell. Biol., January 1, 2005; 25(1): 364 - 376.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. M. Miano, N. Ramanan, M. A. Georger, K. L. de Mesy Bentley, R. L. Emerson, R. O. Balza Jr., Q. Xiao, H. Weiler, D. D. Ginty, and R. P. Misra
Restricted inactivation of serum response factor to the cardiovascular system
PNAS, December 7, 2004; 101(49): 17132 - 17137.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Sinha, M. H. Hoofnagle, P. A. Kingston, M. E. McCanna, and G. K. Owens
Transforming growth factor-{beta}1 signaling contributes to development of smooth muscle cells from embryonic stem cells
Am J Physiol Cell Physiol, December 1, 2004; 287(6): C1560 - C1568.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. M. Spin, S. Nallamshetty, R. Tabibiazar, E. A. Ashley, J. Y. King, M. Chen, P. S. Tsao, and T. Quertermous
Transcriptional profiling of in vitro smooth muscle cell differentiation identifies specific patterns of gene and pathway activation
Physiol Genomics, November 17, 2004; 19(3): 292 - 302.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B.R. Wamhoff, M.H. Hoofnagle, A. Burns, S. Sinha, O.G. McDonald, and G.K. Owens
A G/C Element Mediates Repression of the SM22{alpha} Promoter Within Phenotypically Modulated Smooth Muscle Cells in Experimental Atherosclerosis
Circ. Res., November 12, 2004; 95(10): 981 - 988.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Lockman, J. S. Hinson, M. D. Medlin, D. Morris, J. M. Taylor, and C. P. Mack
Sphingosine 1-Phosphate Stimulates Smooth Muscle Cell Differentiation and Proliferation by Activating Separate Serum Response Factor Co-factors
J. Biol. Chem., October 8, 2004; 279(41): 42422 - 42430.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Oh, Z. Wang, D.-Z. Wang, C.-L. Lien, W. Xing, and E. N. Olson
Target Gene-Specific Modulation of Myocardin Activity by GATA Transcription Factors
Mol. Cell. Biol., October 1, 2004; 24(19): 8519 - 8528.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. S. Parmacek
Myocardin--Not Quite MyoD
Arterioscler. Thromb. Vasc. Biol., September 1, 2004; 24(9): 1535 - 1537.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Takeji, N. Kawada, T. Moriyama, K. Nagatoya, S. Oseto, S. Akira, M. Hori, E. Imai, and T. Miwa
CCAAT/Enhancer-Binding Protein {delta} Contributes to Myofibroblast Transdifferentiation and Renal Disease Progression
J. Am. Soc. Nephrol., September 1, 2004; 15(9): 2383 - 2390.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Yoshida, K. Kawai-Kowase, and G. K. Owens
Forced Expression of Myocardin Is Not Sufficient for Induction of Smooth Muscle Differentiation in Multipotential Embryonic Cells
Arterioscler. Thromb. Vasc. Biol., September 1, 2004; 24(9): 1596 - 1601.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. R. Reynolds, M. L. Mucenski, T. D. Le Cras, W. C. Nichols, and J. A. Whitsett
Midkine Is Regulated by Hypoxia and Causes Pulmonary Vascular Remodeling
J. Biol. Chem., August 27, 2004; 279(35): 37124 - 37132.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Han, X. Li, J. Wu, and E. N. Olson
A myocardin-related transcription factor regulates activity of serum response factor in Drosophila
PNAS, August 24, 2004; 101(34): 12567 - 12572.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. M. Miano
Channeling to Myocardin
Circ. Res., August 20, 2004; 95(4): 340 - 342.
[Full Text] [PDF]


Home page
Circ. Res.Home page
B.R. Wamhoff, D.K. Bowles, O.G. McDonald, S. Sinha, A.P. Somlyo, A.V. Somlyo, and G.K. Owens
L-type Voltage-Gated Ca2+ Channels Modulate Expression of Smooth Muscle Differentiation Marker Genes via a Rho Kinase/Myocardin/SRF-Dependent Mechanism
Circ. Res., August 20, 2004; 95(4): 406 - 414.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Albinsson, I. Nordstrom, and P. Hellstrand
Stretch of the Vascular Wall Induces Smooth Muscle Differentiation by Promoting Actin Polymerization
J. Biol. Chem., August 13, 2004; 279(33): 34849 - 34855.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Kawai-Kowase, H. Sato, Y. Oyama, H. Kanai, M. Sato, H. Doi, and M. Kurabayashi
Basic Fibroblast Growth Factor Antagonizes Transforming Growth Factor-{beta}1-Induced Smooth Muscle Gene Expression Through Extracellular Signal-Regulated Kinase 1/2 Signaling Pathway Activation
Arterioscler. Thromb. Vasc. Biol., August 1, 2004; 24(8): 1384 - 1390.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. K. Owens, M. S. Kumar, and B. R. Wamhoff
Molecular Regulation of Vascular Smooth Muscle Cell Differentiation in Development and Disease
Physiol Rev, July 1, 2004; 84(3): 767 - 801.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Brunelli, E. Tagliafico, F. G. De Angelis, R. Tonlorenzi, S. Baesso, S. Ferrari, M. Niinobe, K. Yoshikawa, R. J. Schwartz, I. Bozzoni, et al.
Msx2 and Necdin Combined Activities Are Required for Smooth Muscle Differentiation in Mesoangioblast Stem Cells
Circ. Res., June 25, 2004; 94(12): 1571 - 1578.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. P. Anderson, E. Dodou, A. B. Heidt, S. J. De Val, E. J. Jaehnig, S. B. Greene, E. N. Olson, and B. L. Black
HRC Is a Direct Transcriptional Target of MEF2 during Cardiac, Skeletal, and Arterial Smooth Muscle Development In Vivo
Mol. Cell. Biol., May 1, 2004; 24(9): 3757 - 3768.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Yoshida, M. H. Hoofnagle, and G. K. Owens
Myocardin and Prx1 Contribute to Angiotensin II-Induced Expression of Smooth Muscle {alpha}-Actin
Circ. Res., April 30, 2004; 94(8): 1075 - 1082.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. L. Du, M. Chen, J. Li, J. J. Lepore, P. Mericko, and M. S. Parmacek
Megakaryoblastic Leukemia Factor-1 Transduces Cytoskeletal Signals and Induces Smooth Muscle Cell Differentiation from Undifferentiated Embryonic Stem Cells
J. Biol. Chem., April 23, 2004; 279(17): 17578 - 17586.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. B. Pilz and D. E. Casteel
Regulation of Gene Expression by Cyclic GMP
Circ. Res., November 28, 2003; 93(11): 1034 - 1046.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Selvaraj and R. Prywes
Megakaryoblastic Leukemia-1/2, a Transcriptional Co-activator of Serum Response Factor, Is Required for Skeletal Myogenic Differentiation
J. Biol. Chem., October 24, 2003; 278(43): 41977 - 41987.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Kelm Jr., S.-X. Wang, J. A. Polikandriotis, and A. R. Strauch
Structure/Function Analysis of Mouse Pur{beta}, a Single-stranded DNA-binding Repressor of Vascular Smooth Muscle {alpha}-Actin Gene Transcription
J. Biol. Chem., October 3, 2003; 278(40): 38749 - 38757.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
E. N. Olson and M. D. Schneider
Sizing up the heart: development redux in disease
Genes & Dev., August 15, 2003; 17(16): 1937 - 1956.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Li, D.-Z. Wang, Z. Wang, J. A. Richardson, and E. N. Olson
The serum response factor coactivator myocardin is required for vascular smooth muscle development
PNAS, August 5, 2003; 100(16): 9366 - 9370.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Wang, D.-Z. Wang, G. C. T. Pipes, and E. N. Olson
Myocardin is a master regulator of smooth muscle gene expression
PNAS, June 10, 2003; 100(12): 7129 - 7134.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
M. Beckman
Rise to Power
Sci. Aging Knowl. Environ., May 28, 2003; 2003(21): nw75 - 75.
[Full Text]


Home page
Circ. Res.Home page
M. W. Majesky
Decisions, Decisions ... SRF Coactivators and Smooth Muscle Myogenesis
Circ. Res., May 2, 2003; 92(8): 824 - 826.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
92/8/856    most recent
01.RES.0000068405.49081.09v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshida, T.
Right arrow Articles by Owens, G. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, T.
Right arrow Articles by Owens, G. K.
Related Collections
Right arrow Gene regulation
Right arrow Smooth muscle proliferation and differentiation