Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2003;92:609-616
Published online before print March 6, 2003, doi: 10.1161/01.RES.0000065442.64694.9F
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
92/6/609    most recent
01.RES.0000065442.64694.9Fv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sanbe, A.
Right arrow Articles by Robbins, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sanbe, A.
Right arrow Articles by Robbins, J.
Related Collections
Right arrow Animal models of human disease
Right arrow Gene expression
Right arrow Gene regulation
Right arrow Genetically altered mice
(Circulation Research. 2003;92:609.)
© 2003 American Heart Association, Inc.


Molecular Medicine

Reengineering Inducible Cardiac-Specific Transgenesis With an Attenuated Myosin Heavy Chain Promoter

Atsushi Sanbe, James Gulick, Mark C. Hanks, Qiangrong Liang, Hanna Osinska, Jeffrey Robbins

From the Department of Pediatrics, Division of Molecular Cardiovascular Biology (A.S., J.G., Q.L., H.O., J.R.), The Children’s Hospital Research Foundation, Cincinnati, Ohio, and Procter and Gamble Pharmaceuticals (M.C.H.), Health Care Research Center-Discovery, Mason, Ohio.

Correspondence to Jeffrey Robbins, Department of Pediatrics, Division of Molecular Cardiovascular Biology, MLC7020 The Children’s Hospital Research Foundation, Cincinnati, OH 45229-3039. E-mail jeff.robbins{at}chmcc.org


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Despite the advantages of reversibly altering cardiac transgene expression, the number of successful studies with inducible cardiac-specific transgene expression remains limited. The utility of the current system is hampered by the large number of lines needed before a nonleaky inducible line is isolated and by the use of a heterologous virus-based minimal promoter in the responder line. We developed an efficient, experimentally flexible system that enables us to reversibly affect both abundant and nonabundant cardiomyocyte proteins. The use of bacterial-codon–based transactivators led to aberrant splicing, whereas other more efficient transactivators, by themselves, caused disease when expressed in the heart. The redesign of the system focused on developing stable transactivator-expressing lines in which expression was driven by the mouse {alpha}-myosin heavy chain promoter. A minimal responder locus was derived from the same promoter, in which the GATA sites and thyroid responsive elements responsible for robust cardiac specific expression were ablated, leading to an attenuated promoter that could be inducibly controlled. In all cases, whether activated or not, expression mimicked that of the parental promoter. By use of this system, an inducible expression of an abundant contractile protein, the atrial isoform of essential myosin light chain 1, and a powerful biological effector, glycogen synthase kinase-3ß (GSK-3ß), were obtained. Subsequently, we tested the hypothesis that GSK-3ß expression could reverse a preexisting hypertrophy. Inducible expression of GSK-3ß could both attenuate a hypertrophic response and partially reverse a pressure-overload–induced hypertrophy. The system appears to be robust and can be used to temporally control high levels of cardiac-specific transgene expression.


Key Words: transgene • myosin • cardiac disease • muscle • mice


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Much of the recent progress in basic cardiovascular research has depended on the targeted manipulation of the mammalian genome.1 Both gene-targeting and transgenic (TG) approaches can be used to create specific changes in the heart as well as in other organs that have an impact on cardiovascular function. These experiments, which are normally carried out in the mouse, have opened up new avenues for exploring the physiological consequences of protein ablation, mutation, and ectopic expression. In the last 15 years, there has been a slow but steady refinement of the techniques, all directed at being able to more precisely control both the location and developmental time of gene expression. Early on, investigators realized that although systemic genetic modification through transgenesis and gene targeting was tremendously useful, more precise methodologies were needed to target a modification to a particular cell type or organ. Thus, mammalian gene targeting was first implemented only for loss-of-function experiments using systemic gene ablation, but it then progressed to the creation of specific mutations.2 Organ-specific gene targeting has now been reported in a number of systems, including the heart,3 and recently, inducible cardiac-specific gene targeting has been demonstrated.4

Although transgenesis was first performed at the systemic level, it was soon realized that precise transcriptional control was needed to target TG expression to a particular organ system or cell type. The development of promoters able to direct TG expression specifically to the heart resulted in an explosion of new animal models that undergo hypertrophy and failure and also in the identification of important functions of many proteins that are expressed in the heart during normal and abnormal development and function.5 However, even with cardiac-specific promoters, transgenesis can be a blunt instrument, particularly in the study of powerful biological signaling proteins that in low abundance can have pleiotropic effects on cardiovascular structure, metabolism, and function. For example, the most widely used promoter for cardiac-specific TG experiments, which is derived from the {alpha}-myosin heavy chain ({alpha}-MHC) gene, is expressed in the early heart tube as well as in the developing atria,6 and TG expression throughout development undoubtedly has the potential of confounding the postterm phenotype.

Because of these and related concerns, the development of conditional or inducible TG systems has been the focus of multiple laboratories.7,8 The use of conditional transgenics, in which TG expression can be turned on/off over the animal’s lifetime, would be of tremendous benefit for exploring the physiological basis of the cardiac phenotype. Although a number of different approaches have been tried, the most successful has been the binary tetracycline (Tet)-based system, which has been widely used in both cells and animals to reversibly induce expression by the addition or removal of Tet or its analogue, doxycycline (Dox).8–10 As normally used in cell cultures and in the whole organism, controlled induction depends on a binary system and requires 2 transgenes: (1) a cardiac-specific promoter driving the Tet-controlled trans-activator (tTA) sequence coupled to the transcription activator virion protein 16 (VP16) and (2) a cytomegalovirus (CMV) minimal promoter coupled to multimers (5 to 7 copies) of the Tet operon (TetO). This chimeric promoter is then ligated to the target transgene that is to be conditionally controlled. In the presence of Tet, the tTA protein binds to the drug, and transcription of the reporter gene, driven only by the very low basal activity of the minimal promoter, is "off." If Tet is not present in the system, tTA binds to the TetO, allowing the VP16 transactivator to increase the expression driven by the CMV minimal promoter. Expression of the reporter gene can thus be turned on and off by removing or supplying Tet, respectively. For cardiac-specific induction, the effector transgene consists of a cardiac-specific promoter driving the expression of tTA (Tet-off) or of a "reverse" tTA (rtTA), in which 4 point mutations have been made,11 converting the system from a Tet-off, in which Dox is needed to keep TG expression silent, to a Tet-on system, in which TG expression is active only in the presence of the drug. New generations of activators and repressors that show increased efficiency and fewer experimental artifacts have been developed, and there are examples of successful experiments in many cell types and organ systems.8

However, despite the potential advantages of robust target gene induction/inactivation with a relatively benign biological effector, surprisingly few successes have been reported in the heart, and these are largely restricted to strong biological amplifiers/signals.12–18 One could infer from the paucity of data in the cardiovascular system that the current reagents are not robust in this particular organ and therefore preclude routine success. The present system uses a relatively short fragment of the rat {alpha}-MHC promoter to drive expression of the Tet activator in the heart.14 This heterologous promoter, although it is cardiac specific, does not exhibit position-independent or copy number–dependent expression, nor has it been shown to be homogenously expressed throughout the ventricular and atrial cardiomyocyte populations. Compounding the limitations of the current system is the use of the minimal CMV promoter in the responder line. The use of a virus-derived sequence heightens the probability of context-dependent expression as well as altered methylation patterns that tend to inactivate transcription. Indeed, in a series of preliminary experiments, we were struck by the number of lines needed to generate a working pair of transgenics that could then be crossbred to produce an animal in which gene induction occurred. Expression was often "leaky" or (if off) could not be activated. Clearly, at least in our hands, the current system was unsatisfactory, necessitating the creation of many (5 to 20) lines before a successful binary breeding was achieved.

In the present study, we describe the application of a reengineered system to inducible cardiac-specific TG expression. We found that mouse {alpha}-MHC, rather than the previously described rat promoter,12 driving very low levels of the Tet activator, coupled with a responder line in which the target transgene was linked to an attenuated mouse {alpha}-MHC promoter that was inactive in the heart except when induced, gave excellent results. The robustness of the system was titrated by attempting to inducibly replace one of the most abundant proteins in the cardiomyocyte, the essential myosin light chain (ELC1), as well as by conditionally expressing a powerful biological signaling protein in order to titrate its efficacy within a narrow temporal window. We found that even modest levels of transactivator protein were lethal or led to cardiac disease and that an attenuated {alpha}-MHC promoter could serve as an effective responder for TG induction.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
DNA Constructs and TG Mice
The original tTA construct, described by Gossen and et al,19 was inserted into the mouse {alpha}-MHC promoter cassette at the SalI site, and multiple lines of TG mice were generated. The tTA construct is bacterially derived, potentially making it less than ideal for mammalian systems20 because bacterial codon usage bias can lead to alternative splicing (Figure 1B). Thus, an optimized tTA fragment using mammalian codons was synthesized, and in a parallel set of constructs, we also changed 4 amino acids, creating rtTA.21,22 An additional set of constructs was made in which the synthesized fragment was linked to 3 repeats of a 12–amino-acid sequence, FFF, which is the minimum activator domain and a less toxic transcriptional activator domain than VP16.23 The tTA specificity and efficacy can be improved by changing 5 amino acids (S12G, E19G, A56P, D148E, and H179R),24 and this construct was made via polymerase chain reaction (PCR) using the mammalian codon–optimized DNA as a template (S2M2FFF, Figure 2A). This protein is more stable in cell culture systems, is more sensitive to Dox, and has very low background expression levels in the absence of Dox.24 The constructs were inserted into the {alpha}-MHC promoter cassette (Figure 1A). The CMV-TetO-LacZ indicator mice were purchased from Jackson Laboratories (Bar Harbor, Maine).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Characterization of {alpha}-MHC-Tet–controlled transcriptional activator (MHC-tTA) mice. A, Diagram of the cardiac-specific Tet-off construct, which was formed from a chimeric tTA fusion protein of the Tn10 Tet resistance operon in Escherichia coli (TetR) and the carboxy-terminal portion of the transactivator protein from herpes simplex virus (VP16). B, Determination of splicing variants. Reverse-transcriptase PCR using total left ventricular RNA derived from TG lines 55 and 43 was performed. C, Western blot analysis showing that no detectable tTA protein in the TG ventricles could be observed when either 50 µg or 100 µg of protein was used, indicating that any protein present is at a level below the assay detection. Bacterially expressed tTA (Bac.) was included as a positive control (300 ng). D and E, Cardiac inducibility of ß-galactosidase (LacZ) activity in {alpha}-MHC-tTA (line 55, Tet-off)/CMV-TetO-LacZ crosses. Panel D shows ß-galactosidase staining in NTG-treated (-), untreated (Un), and Dox-treated (Dox) hearts; + indicates presence of transgene. Panel E shows LacZ expression quantified as described in Materials and Methods.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Activator protein expression causes cardiac hypertrophy. A, Diagram of the S2M2FFF construct is shown. B, Western analysis of 30 µg cardiac protein showed easily detectable intact polypeptide. The line numbers are shown above their respective lanes. C, A hypertrophic response is apparent in the TG lines that express varying amounts of the activator. D, Appearance of a 6-week heart isolated from line 216 is shown.

A responder minimal promoter that was copy number dependent and chromosomal integration site independent was derived from the mouse {alpha}-MHC sequences. Two thyroid response elements (TREs) at positions 4217 to 4240 (TRE1) and 4251 to 4267 (TRE2)25,26 and 3 GATA sites at positions 2455,27 4106, and 411428 were destroyed to create the basal promoter. To provide a binding site for the transactivator, an {approx}300-bp fragment consisting of 7 repeats of the sequence TCGAGTTTACCACTCCCTA TCAGTGATAGAGAAAAGTGAAAG was inserted after base 4281, 57 bp upstream from the TATA element (Figure 3A). The ELC atrial isoform (ELC1a) or a constitutively active form of mouse glycogen synthase kinase-3ß (GSK-3ß) was linked to the responder promoter to determine its ability to drive high levels of TG protein expression on induction (Figure 3A). The human growth hormone polyadenylation site (hGH polyA) was placed downstream from all cDNAs (Figure 1A). All constructs were digested free of the vector sequence with NotI, purified from agarose, and used to generate TG mice as described.29



View larger version (48K):
[in this window]
[in a new window]
 
Figure 3. Engineering a responder locus from the {alpha}-MHC promoter. A, Diagram is shown of the Tet-responsive {alpha}-MHC promoter constructs. The responder construct consisted of a full-length {alpha}-MHC promoter in which 3 GATA sites (the third GATA site lies upstream from the region shown in detail) and 2 TREs were ablated. Other cis-acting regions important for cardiac-specific expression were left intact. To make the attenuated promoter Tet responsive, 7 repeats of the TetO sequences were inserted adjacent to the TATA box. The human growth hormone polyadenylation signal (black box) was placed downstream from the unique cloning site. Any gene of interest (gene) inserted into this Tet-responsive promoter construct, termed MHCminTetO, will be inducible. B, RNA (5 µg) was blotted onto nitrocellulose and hybridized to an ELC1a-specific oligonucleotide probe to detect expression. GAPDH expression was used to normalize the data. C, ELC1a protein was detected by Western analysis. D, Expression patterns are shown in an uninduced leaky line. Protein (30 µg) derived from line 98 was electrophoresed, and ELC1a levels were analyzed by use of Western blots. At indicates atria; Dia, diaphragm; Sol, soleus; Bi, biceps; Tib, tibialis; Mass, masseter; Ton, tongue; Sto, stomach; S. int, small intestine; Ao, aorta; Liv, liver; Spl, spleen; LV, left ventricle; and RV, right ventricle.

An expanded Materials and Methods section can be found in the online data supplement available at http://www.circresaha.org.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
tTA-VP16 cDNA Is Aberrantly Spliced In Vivo
On the basis of previous studies that successfully used the bacterially derived tTA-VP16 construct described by Bujard’s group (Furth et al9 and Godden et al19) for inducible cardiac-specific expression,13,14 we initiated our studies with the same transactivator and linked it to the mouse {alpha}-MHC promoter (Figure 1A). Multiple TG lines were generated, and although the different lines showed varying copy number, in no case could we detect TG protein in the heart. To explore the lack of expression, we analyzed the TG transcripts and discovered that the vast majority of the transcripts underwent aberrant splicing (Figure 1B), with the RNA pool consisting of a major (700-bp, spliced) and a minor (1300-bp, full-length) product. Both bands were sequenced, and the data confirmed that the major product resulted from aberrant splicing of the primary transcript, whereas the 1300-bp minor product (<1%) encoded the full-length protein. The construct was reengineered by PCR mutagenesis to remove the alternative splice site, TTAGGT->CTCGGC, at and around bases 427 to 428, and multiple TG lines were generated with the new cDNA. However, these lines also showed alternative splicing that now occurred at a site further upstream (data not shown). We conclude that normally cryptic splice sites throughout the construct can be and are recognized by the spliceosome apparatus, leading to the production of mutated polypeptides that are out of frame and inactive or are degraded by the cardiomyocyte.

The small amount of intact transcript should produce active tTA, but we were unable to detect any protein, even when 100 µg of protein was subjected to Western analysis (Figure 1C). We wished to determine whether even the small amount of protein that was present could explain the reported successes with the use of the tTA construct, and to that end, line 55 was crossed with CMV-TetO-LacZ indicator mice. Although no LacZ staining was apparent in the nontransgenic (NTG)- or Dox-treated hearts, withdrawal of the drug resulted in uniform and robust expression in the double-TG hearts (Figures 1D and 1E), indicating that very low levels of tTA protein are sufficient for inducible expression.

Detectable Amounts of Activator Protein Cause Cardiac Disease
Using the initial TetR-VP16 fusion protein as a starting point, Bujard, Urlinger, and colleagues8,24 have explored the potential of creating modified proteins that exhibit decreased generalized transcriptional squelching, improved DNA and activator molecule binding characteristics, and increased sensitivity and expanded induction range. We have now tested a number of these constructs in TG mice, and representative data for a Tet-on construct reported to show maximum efficiency and efficacy with minimal nonspecific transcriptional squelching24 are presented in Figure 2. This construct consists of a trimer of a minimal activation domain derived from VP16 (FFF)23 and an rTetR selected in a yeast screen for optimized sensitivity and inductive range (Figure 2A, S2M2FFF).24 These were synthesized using oligonucleotides optimized for mammalian codon usage and placed into the cardiac-specific {alpha}-MHC promoter construct (Figure 2A).

In contrast to lines of mice containing the full-length VP16 activator domain, multiple lines of mice made with the minimal activation domain (FFF) showed significant levels of the activator protein (Figure 2B). Because this used the reverse fusion protein, it constituted a Tet-on system, with TG expression being triggered only in the presence of the drug, and these mice, when crossed with the LacZ indicator line, also showed induction of gene expression (data not shown). However, as the TG S2M2FFF lines aged, we observed that all exhibited significant hypertrophy. This was particularly evident in 2 lines that had significantly different levels of activator protein accumulation (Figure 2). The significant hypertrophy (Figure 2D) that occurred in all lines containing detectable amounts of the protein indicates that TG expression of the activator, by itself, leads to a disease phenotype, precluding their use in creating inducible models of cardiovascular disease. In fact, the effects were quite severe, with mice from all lines dying within 2 months. Although the initial tTA construct was clearly inefficiently/incorrectly spliced and produced only small amounts of active protein, the viable mouse lines we obtained efficiently served as the activator arm for a bigenic inducible system (Figures 1D and 1E), and a stable line was bred. To date, after multiple generations, we have been unable to detect any signs of hypertrophy or cardiac disease in these animals. Echocardiographic analysis of adults revealed no detectable alteration in function (data not shown). The absence of hypertrophy or disease is more fully documented in the online data supplement (please see online Figures 1 and 2, available at http://www.circresaha.org).

Attenuated {alpha}-MHC Promoter Can Serve as Efficient Responder Locus
The responder arm of the bigenic system normally consists of a minimal CMV promoter linked to multiple copies of the Tet operator. In our hands, this part of the system also presented a series of significant experimental problems. Although we found that it was possible to obtain lines of mice that showed minimal expression levels when noninduced and responded appropriately during induction, isolating a line that displayed those characteristics necessitated the production of many (6 to 23) lines of animals. The TG mice obtained with such constructs only rarely yield the necessary inductive range, presumably because of the sensitivity of the minimal CMV promoter construct to chromosomal context.12

To circumvent these difficulties, we explored the potential of redesigning this part of the system around the well-characterized {alpha}-MHC promoter, with the goal being to create a construct that (1) showed low background expression levels, (2) could be highly induced, and (3) was relatively insensitive to chromosomal location. This promoter has a potential advantage over the minimal promoter constructs in that it also is highly cardiac specific and appears to be relatively chromosomal context independent in its expression pattern; it also shows copy-number dependence.30 The object was to create a minimally active promoter that retained these characteristics, and to this end, we ablated 3 GATA sites and 2 thyroid-like response elements, each of which plays a role in maintaining high levels of cardiac-specific expression.25,26 Seven copies of TetO were placed upstream from the TATA box to provide a strong Tet response element (Figure 3A). This promoter was then linked to ELC1a, such that inducible expression in the ventricle could be easily assayed.

Three lines (termed 93, 98, and 12 (Figures 3B and 3C) were made. Of these, line 12 had the desired characteristics, with no detectable activity in the absence of induction (Figures 3B and 3C). In the lines in which expression could be detected in the absence of the activator protein, expression mimicked the expression patterns of the parental promoter and was restricted to the heart and the lung (Figure 3D). Lung expression is due to the presence of the pulmonary myocardium, which is derived from atrial tissue and consists of a thin layer of atrium-like cells around a subpopulation of the pulmonary veins and venules.31

Replacement of Abundant Sarcomeric Protein via Inducible TG Expression
Previously, almost all of the cardiac-specific inducible TG experiments have dealt with strong biological effectors, in which small amounts of protein result in significant functional or structural alterations.13–15 We wished to determine whether the newly engineered system was robust enough to affect an abundant protein’s pool in the cardiomyocyte, and to that end, we attempted to inducibly express the atrium-specific form of ELC1 in the ventricle. Extensive data show that the overall stoichiometry of the contractile proteins is precisely controlled such that TG overexpression at the mRNA level does not lead to increases of overall protein content.29,32,33 That is, there is no "overexpression." Rather, endogenous protein levels are downregulated and replaced by the TG protein, with the overall steady-state protein level being maintained. Depending on the level of TG expression, partial or even complete replacement of endogenous ELC1v with the TG ELC1a should be feasible. Line 55 tTA mice (Figure 1) were crossed with a MHCminTetO-ELC1a mouse (line 12), and in the absence of Dox, 37% of ELC1v was replaced with TG ELC1a protein in the ventricles (Figure 4A). Breeding to homozygosity (++) resulted in a 55% replacement, showing that the inducible expression was copy number dependent. In all cases, we were able to reverse the isoform switch in the ventricle by a 3-week Dox treatment. Inducible expression is also Dox dose dependent, inasmuch as a 3-week Dox treatment at an intermediate dose of 100 mg/kg chow resulted in a stable level of 24% replacement (Figure 4B). We conclude that the 2 arms of the inducible system can effectively modulate abundant protein pools in the cardiomyocyte. Additional data showing the homogeneity of response and localization of the induced TG protein to the cardiomyocytes are presented in the online data supplement.



View larger version (99K):
[in this window]
[in a new window]
 
Figure 4. Inducible expression of ELC1a. A, Myofilament protein PAGE is shown. Crossbreeding between a tTA mouse (line 55, Figure 1) and a MHCminTetO-ELC1a mouse (line 12) resulted in a 37% replacement of the ECL1v protein with TG ELC1a protein. Breeding to homozygosity (++) resulted in a 55% replacement. Protein replacement was reversed after 3 weeks of Dox treatment (625 mg/kg chow) in both the heterozygous (+) and homozygous (++) mice. Atr indicates atrium. B, Inducible expression is Dox dose dependent. A 3-week Dox treatment of 200 and 625 mg/kg chow completely ablated inducible ELC1a expression, yielding 0% to 2% replacement, whereas a dose of 100 mg/kg chow resulted in 24% replacement.

Inducible Expression of GSK-3ß
We next explored the effectiveness of the system in controlling expression of a powerful biological effector. The serine/threonine kinase, GSK-3ß, is constitutively expressed in a large number of different cell types and, when dephosphorylated at serine 9, will actively phosphorylate many different substrates, thereby affecting basic cellular processes such as development, differentiation, and proliferation.34 Recently, it has been shown to play a key role in modulating the cardiac hypertrophic response, and inhibition of its activity by different hypertrophic stimuli can contribute to cardiac hypertrophy.35 Activated GSK-3ß, which is GSK-3ß constitutively expressed in the heart under the control of the {alpha}-MHC promoter, resulted in physiologically normal animals that showed a significantly diminished hypertrophic response when challenged with activated calcineurin.36

We placed a hemagglutinin (HA) epitope at the carboxyl terminus of a constitutively active S9A GSK-3ß (GSK-CA) and inserted the cDNA into the MHCminTetO-promoter construct. Of the 3 TG lines generated, 1 line showed the desired characteristics: no expression in the MHCminTetO-GSK-CA mice but, when bred to the MHC-tTA animals, robust TG expression on removal of Dox (Figure 5). Expression was highly inducible and could be efficiently repressed by the reintroduction of Dox treatment, with <1% of the protein being present after 2 weeks (Figure 5B). Expression was also quite homogeneous across the cardiomyocyte population, with the protein colocalizing in the contractile apparatus (online Figure 4 and online data supplement).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 5. Inducible expression of active GSK-3ß. The constitutively active form of GSK-3ß was made by engineering a serine->alanine substitution at position 9 (GSK-CA), HA was placed at the carboxyl terminus, and cDNA was inserted into the responder site in the MHCminTetO promoter. A, GSK-CA is efficiently induced in the double-TG animals in the absence of Dox. B, TG expression can be inducibly controlled with <1% of the protein remaining after 2 weeks of Dox treatment.

The ability of GSK-CA to reverse a pressure-overload hypertrophic response was then examined. Age-matched male NTG or double-TG mice were left untreated or were treated with Dox for 5 weeks, after which they underwent transaortic coarctation (TAC) (Figure 6A). Under these conditions, male mice underwent a significant hypertrophic response within 2 weeks, and the expression of GSK-3ß blunted the hypertrophic response (Figure 6B). Heart and body weights were determined 1 week or 7 weeks after TAC in 1 cohort, whereas Dox was withdrawn from another cohort at 1 week after TAC to activate GSK-CA synthesis. A third cohort was continued on the drug, and the mice were killed 6 weeks later.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. Inducible control of the hypertrophic response. A, Diagram of the protocols. Cohorts consisted of 4 to 6 male 12-week-old animals. On termination, the LV weight/body weight ratios were determined. B, LV weight/body weight ratios for NTG (white boxes), single-TG (dark or light gray boxes), and double-TG (black boxes) animals. The animals were euthanized 2 weeks after TAC. *P<0.001. Body weight did not significantly change during the course of the experiment. C, Hypertrophic responses in noninduced and induced hearts. Time course is shown of the hypertrophic response after TAC-induced pressure overload (n=3 to 6), and all points at and after 1 week differed significantly between the banded and sham-operated animals (n=3 to 5, P<0.001). DOX+->- denotes withdrawal of Dox and TG induction. D, Western blot analysis of protein. Three double-TG animals from both the ±Dox-treated cohorts (protocol 2) were individually tested for TG expression to determine the reproducibility of the response. +->- indicates withdrawal of Dox and induction of GSK-CA synthesis. The error bars show that induction is reproducible across multiple animals from that line. *P<0.001.

Induction of GSK-CA after 1 week of banding resulted in a significant reversal of hypertrophy. At 7 weeks, the double-TG animals that had been kept on the drug developed a hypertrophy comparable to that of NTG animals subjected to the surgery (Figure 6C). Determination of GSK-CA levels using both anti–GSK-3ß and anti-HA confirmed that the protein had been induced by Dox withdrawal (Figure 6D).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Inducible TG expression was first described almost 10 years ago,9 and although the technology was applied relatively quickly to the heart,14 there have been surprisingly few reports, considering the potential power of the technology. Our initial attempts with the published systems proved fruitless: not only could we not detect the transactivator protein, but the responder lines were often leaky or completely inactive and did not respond appropriately to the inducible response. Although we were able to isolate suitable lines, the experiment often required a large number of mice to be generated and subsequently tested, rendering the system of limited utility for routine experimentation (testing 10 to 30 lines in terms of breeding to the activator line would have been economically untenable). The admittedly limited data to date with our modified system are consistent with the need for only a modest number of lines being generated before one with the desired characteristics is obtained.

In the present study, we report a reconstruction of both arms of the system, resulting in a robust, cardiac-specific, inducible system. Although we used the same activator previously reported for inducible cardiac-specific expression,14 it is now driven by the mouse {alpha}-MHC promoter rather than the rat {alpha}-MHC promoter. The murine-derived promoter is extremely stable in TG mice throughout multiple generations and is expressed homogeneously in the cardiomyocyte population throughout the adult heart.32 The responder arm of the system was extensively reengineered, and instead of the target now being driven by a viral promoter, it uses an attenuated mouse {alpha}-MHC that is essentially intact, presumably conserving its well-defined copy number–dependent and position-independent characteristics. The system works for both high- and low-abundance proteins. In both cases, only 3 lines containing the target TG needed to be generated to obtain an animal in which expression was off, except when Dox was withdrawn in the subsequent double-TG animal. Although the bacteria-based transactivator was aberrantly spliced, sufficient levels of protein were produced for efficient induction. In fact, higher levels of transactivator in the single MHC-tTA–based lines made with mammalian codon-based cDNAs invariably led to cardiac disease in the mature adult. Thus, although it is clear from past studies20 and from our data that codon optimization can result in higher protein levels, the end result is not desirable because the ideal line will have the minimal amount of transactivator needed for the necessary biological effect. For our most useful line, although we are able to detect the correct transcript, the tTA antibody is not sufficiently sensitive to detect the protein (Figure 1C). However, the line is clearly able to induce high levels of expression. Transactivator production is stable, and multiple generations that are able to efficiently activate target TG expression on Dox withdrawal have now been bred.

Previous studies dealing with inducible cardiac-specific expression only modulated nonabundant proteins.12–15 Our system is able to effect major changes in one of the most abundant protein pools in the cardiomyocyte, a contractile protein. The data show that the degree of replacement is both TG-dose dependent and drug-dose dependent. This offers a potential strategy in which a single line is used to effect different replacement levels of a structural protein based on drug dosage.

We also used the system to confirm the role of GSK-3ß in mediating cardiac hypertrophy. Previous data have shown that continuous TG expression of activated GSK-3ß (GSK-CA) can blunt the hypertrophic response that is normally induced by activated calcineurin.36 In the present study, we extend those findings and show that by inducing a constitutively active GSK-3ß after the initial hypertrophic stimulus and response, hypertrophy is partially reversed, with inducible post-TAC expression being as efficient as chronic GSK-CA expression in terms of achieving the biological end point of smaller heart weight/body weight ratios. It may be possible to use GSK-3ß to actually reverse a preexisting hypertrophy, although its efficacy in the face of other stimuli and the direct biological pathways that are being affected remain to be resolved.


*    Acknowledgments
 
This study was supported by Procter and Gamble Pharmaceuticals, by NIH grants HL-61638, HL-41496, HL-52318, HL-60546, and HL-56620 (Dr Robbins), and by a Beginning Investigator Grant to Dr Sanbe from the American Heart Association.

Received November 21, 2002; revision received February 20, 2003; accepted February 26, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 

  1. Chien KR. Genomic circuits and the integrative biology of cardiac diseases. Nature. 2000; 407: 227–232.[CrossRef][Medline] [Order article via Infotrieve]
  2. Valancius V, Smithies O. Testing an "in-out" targeting procedure for making subtle genomic modifications in mouse embryonic stem cells. Mol Cell Biol. 1991; 11: 1402–1408.[Abstract/Free Full Text]
  3. Chen J, Kubalak SW, Chien KR. Ventricular muscle-restricted targeting of the RXR{alpha} gene reveals a non-cell-autonomous requirement in cardiac chamber morphogenesis. Development. 1998; 125: 1943–1949.[Abstract]
  4. Sohal DS, Nghiem M, Crackower MA, Witt SA, Kimball TR, Tymitz KM, Penninger JM, Molkentin JD. Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ Res. 2001; 89: 20–25.[Abstract/Free Full Text]
  5. Izumo S, Shioi T. Cardiac transgenic and gene-targeted mice as models of cardiac hypertrophy and failure: a problem of (new) riches. J Card Fail. 1998; 4: 263–270.[CrossRef][Medline] [Order article via Infotrieve]
  6. Ng WA, Grupp IL, Subramaniam A, Robbins J. Cardiac myosin heavy chain mRNA expression and myocardial function in the mouse heart. Circ Res. 1991; 68: 1742–1750.[Abstract/Free Full Text]
  7. Wang Y, O’Malley BW, Tsai SY. Inducible system designed for future gene therapy. Methods Mol Biol. 1997; 63: 401–413.[Medline] [Order article via Infotrieve]
  8. Bujard H. Controlling genes with tetracyclines. J Gene Med. 1999; 1: 372–374.[CrossRef][Medline] [Order article via Infotrieve]
  9. Furth PA, St Onge L, Boger H, Gruss P, Gossen M, Kistner A, Bujard H, Hennighausen L. Temporal control of gene expression in transgenic mice by a tetracycline-responsive promoter. Proc Natl Acad Sci U S A. 1994; 91: 9302–9306.[Abstract/Free Full Text]
  10. Mansuy IM, Bujard H. Tetracycline-regulated gene expression in the brain. Curr Opin Neurobiol. 2000; 10: 593–596.[CrossRef][Medline] [Order article via Infotrieve]
  11. Freundlieb S, Schirra-Muller C, Bujard H. A tetracycline controlled activation/repression system with increased potential for gene transfer into mammalian cells. J Gene Med. 1999; 1: 4–12.[CrossRef][Medline] [Order article via Infotrieve]
  12. Yu Z, Redfern CS, Fishman GI. Conditional transgene expression in the heart. Circ Res. 1996; 79: 691–697.[Abstract/Free Full Text]
  13. Redfern CH, Coward P, Degtyarev MY, Lee EK, Kwa AT, Hennighausen L, Bujard H, Fishman GI, Conklin BR. Conditional expression and signaling of a specifically designed Gi-coupled receptor in transgenic mice. Nat Biotechnol. 1999; 17: 165–169.[CrossRef][Medline] [Order article via Infotrieve]
  14. Fishman GI, Kaplan ML, Buttrick PM. Tetracycline-regulated cardiac gene expression in vivo. J Clin Invest. 1994; 93: 1864–1868.[Medline] [Order article via Infotrieve]
  15. Bowman JC, Steinberg SF, Jiang TR, Geenen DL, Fishman GI, Buttrick PM. Expression of protein kinase Cß in the heart causes hypertrophy in adult mice and sudden death in neonates. J Clin Invest. 1997; 100: 2189–2195.[Medline] [Order article via Infotrieve]
  16. Dor Y, Camenisch TD, Itin A, Fishman GI, McDonald JA, Carmeliet P, Keshet E. A novel role for VEGF in endocardial cushion formation and its potential contribution to congenital heart defects. Development. 2001; 128: 1531–1538.[Abstract]
  17. Suzuki J, Shen WJ, Nelson BD, Patel S, Veerkamp JH, Selwood SP, Murphy GM Jr, Reaven E, Kraemer FB. Absence of cardiac lipid accumulation in transgenic mice with heart-specific HSL overexpression. Am J Physiol. 2001; 281: E857–E866.
  18. Valencia TG, Roberts LD, Zeng H, Grant SR. Tetracycline-inducible CaM kinase II silences hypertrophy-sensitive gene expression in rat neonate cardiomyocytes. Biochem Biophys Res Commun. 2000; 274: 803–810.[CrossRef][Medline] [Order article via Infotrieve]
  19. Gossen M, Bonin AL, Freundlieb S, Bujard H. Inducible gene expression systems for higher eukaryotic cells. Curr Opin Biotechnol. 1994; 5: 516–520.[CrossRef][Medline] [Order article via Infotrieve]
  20. Valencik ML, McDonald JA. Codon optimization markedly improves doxycycline regulated gene expression in the mouse heart. Transgenic Res. 2001; 10: 269–275.[CrossRef][Medline] [Order article via Infotrieve]
  21. Gossen M, Bujard H. Efficacy of tetracycline-controlled gene expression is influenced by cell type: commentary. Biotechniques. 1995; 19: 213–217.[Medline] [Order article via Infotrieve]
  22. Gossen M, Freundlieb S, Bender G, Muller G, Hillen W, Bujard H. Transcriptional activation by tetracyclines in mammalian cells. Science. 1995; 268: 1766–1769.[Abstract/Free Full Text]
  23. Baron U, Gossen M, Bujard H. Tetracycline-controlled transcription in eukaryotes: novel transactivators with graded transactivation potential. Nucleic Acids Res. 1997; 25: 2723–2729.[Abstract/Free Full Text]
  24. Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, Hillen W. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 2000; 97: 7963–7968.[Abstract/Free Full Text]
  25. Subramaniam A, Gulick J, Neumann J, Knotts S, Robbins J. Transgenic analysis of the thyroid-responsive elements in the {alpha}-cardiac myosin heavy chain gene promoter. J Biol Chem. 1993; 268: 4331–4336.[Abstract/Free Full Text]
  26. Rindt H, Subramaniam A, Robbins J. An in vivo analysis of transcriptional elements in the mouse {alpha}-myosin heavy chain gene promoter. Transgenic Res. 1995; 4: 397–405.[CrossRef][Medline] [Order article via Infotrieve]
  27. Huang WY, Liew CC. A conserved GATA motif in a tissue-specific DNase I hypersensitive site of the cardiac {alpha}-myosin heavy chain gene. Biochem J. 1997; 325: 47–51.[Medline] [Order article via Infotrieve]
  28. Molkentin JD, Kalvakolanu DV, Markham BE. Transcription factor GATA-4 regulates cardiac muscle-specific expression of the {alpha}-myosin heavy chain gene. Mol Cell Biol. 1994; 14: 4947–4957.[Abstract/Free Full Text]
  29. Sanbe A, Fewell JG, Gulick J, Osinska H, Lorenz J, Hall DG, Murray LA, Kimball TR, Witt SA, Robbins J. Abnormal cardiac structure and function in mice expressing nonphosphorylatable cardiac regulatory myosin light chain 2. J Biol Chem. 1999; 274: 21085–21094.[Abstract/Free Full Text]
  30. Robbins J. Altering cardiac function via transgenesis: a nuts and bolts approach. Trends Cardiovasc Med. 1997; 7: 185–191.[CrossRef]
  31. Jones WK, Sanchez A, Robbins J. Murine pulmonary myocardium: developmental analysis of cardiac gene expression. Dev Dyn. 1994; 200: 117–128.[Medline] [Order article via Infotrieve]
  32. Gulick J, Hewett TE, Klevitsky R, Buck SH, Moss RL, Robbins J. Transgenic remodeling of the regulatory myosin light chains in the mammalian heart. Circ Res. 1997; 80: 655–664.[Abstract/Free Full Text]
  33. Palermo J, Gulick J, Colbert M, Fewell J, Robbins J. Transgenic remodeling of the contractile apparatus in the mammalian heart. Circ Res. 1996; 78: 504–509.[Abstract/Free Full Text]
  34. Eldar-Finkelman H. Glycogen synthase kinase 3: an emerging therapeutic target. Trends Mol Med. 2002; 8: 126–132.[CrossRef][Medline] [Order article via Infotrieve]
  35. Hardt SE, Sadoshima J. Glycogen synthase kinase-3ß: a novel regulator of cardiac hypertrophy and development. Circ Res. 2002; 90: 1055–1063.[Abstract/Free Full Text]
  36. Antos CL, McKinsey TA, Frey N, Kutschke W, McAnally J, Shelton JM, Richardson JA, Hill JA, Olson EN. Activated glycogen synthase-3ß suppresses cardiac hypertrophy in vivo. Proc Natl Acad Sci U S A. 2002; 99: 907–912.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. Vinet, P. Rouet-Benzineb, X. Marniquet, N. Pellegrin, L. Mangin, L. Louedec, J.-L. Samuel, and J.-J. Mercadier
Chronic doxycycline exposure accelerates left ventricular hypertrophy and progression to heart failure in mice after thoracic aorta constriction
Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H352 - H360.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
B. R. DeGeorge Jr, E. Gao, M. Boucher, L. E. Vinge, J. S. Martini, P. W. Raake, J. K. Chuprun, D. M. Harris, G. W. Kim, S. Soltys, et al.
Targeted Inhibition of Cardiomyocyte Gi Signaling Enhances Susceptibility to Apoptotic Cell Death in Response to Ischemic Stress
Circulation, March 18, 2008; 117(11): 1378 - 1387.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. M. Wolf, M. Arad, F. Ahmad, A. Sanbe, S. A. Bernstein, O. Toka, T. Konno, G. Morley, J. Robbins, J.G. Seidman, et al.
Reversibility of PRKAG2 Glycogen-Storage Cardiomyopathy and Electrophysiological Manifestations
Circulation, January 15, 2008; 117(2): 144 - 154.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Hambleton, A. York, M. A. Sargent, R. A. Kaiser, J. N. Lorenz, J. Robbins, and J. D. Molkentin
Inducible and myocyte-specific inhibition of PKC{alpha} enhances cardiac contractility and protects against infarction-induced heart failure
Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3768 - H3771.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Hirotani, P. Zhai, H. Tomita, J. Galeotti, J. P. Marquez, S. Gao, C. Hong, A. Yatani, J. Avila, and J. Sadoshima
Inhibition of Glycogen Synthase Kinase 3{beta} During Heart Failure Is Protective
Circ. Res., November 26, 2007; 101(11): 1164 - 1174.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Zhai, S. Gao, E. Holle, X. Yu, A. Yatani, T. Wagner, and J. Sadoshima
Glycogen Synthase Kinase-3{alpha} Reduces Cardiac Growth and Pressure Overload-induced Cardiac Hypertrophy by Inhibition of Extracellular Signal-regulated Kinases
J. Biol. Chem., November 9, 2007; 282(45): 33181 - 33191.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. Wang
Mitogen-Activated Protein Kinases in Heart Development and Diseases
Circulation, September 18, 2007; 116(12): 1413 - 1423.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. H. Purcell, B. J. Wilkins, A. York, M. K. Saba-El-Leil, S. Meloche, J. Robbins, and J. D. Molkentin
Genetic inhibition of cardiac ERK1/2 promotes stress-induced apoptosis and heart failure but has no effect on hypertrophy in vivo
PNAS, August 28, 2007; 104(35): 14074 - 14079.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Oka, J. Xu, R. A. Kaiser, J. Melendez, M. Hambleton, M. A. Sargent, A. Lorts, E. W. Brunskill, G. W. Dorn II, S. J. Conway, et al.
Genetic Manipulation of Periostin Expression Reveals a Role in Cardiac Hypertrophy and Ventricular Remodeling
Circ. Res., August 3, 2007; 101(3): 313 - 321.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
T. L. Reudelhuber, K. E. Bernstein, and P. Delafontaine
Is Angiotensin II a Direct Mediator of Left Ventricular Hypertrophy?: Time for Another Look
Hypertension, June 1, 2007; 49(6): 1196 - 1201.
[Full Text] [PDF]


Home page
Circ. Res.Home page
A. S. Galvez, A. Diwan, A. M. Odley, H. S. Hahn, H. Osinska, J. G. Melendez, J. Robbins, R. A. Lynch, Y. Marreez, and G. W. Dorn II
Cardiomyocyte Degeneration With Calpain Deficiency Reveals a Critical Role in Protein Homeostasis
Circ. Res., April 13, 2007; 100(7): 1071 - 1078.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Burkard, A. G. Rokita, S. G. Kaufmann, M. Hallhuber, R. Wu, K. Hu, U. Hofmann, A. Bonz, S. Frantz, E. J. Cartwright, et al.
Conditional Neuronal Nitric Oxide Synthase Overexpression Impairs Myocardial Contractility
Circ. Res., February 16, 2007; 100(3): e32 - e44.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. E. Yutzey and J. Robbins
Principles of Genetic Murine Models for Cardiac Disease
Circulation, February 13, 2007; 115(6): 792 - 799.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Sanbe, J. Yamauchi, Y. Miyamoto, Y. Fujiwara, M. Murabe, and A. Tanoue
Interruption of CryAB-Amyloid Oligomer Formation by HSP22
J. Biol. Chem., January 5, 2007; 282(1): 555 - 563.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. I. Kotlikoff
Genetically encoded Ca2+ indicators: using genetics and molecular design to understand complex physiology
J. Physiol., January 1, 2007; 578(1): 55 - 67.
[Abstract] [Full Text] [PDF]
<