| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Laboratory of Molecular Medicine (S.R., S.K., M.A., M.B., S.P., D.L., N.S., M.V., C.K.S.), Division of Transplantation (A.A.B., C.G.O.), Department of Surgery, and the Department of Physiology/Cell Biology (S.V.S., A.S.), Davis Heart and Lung Research Institute, The Ohio State University Medical Center, Columbus.
Correspondence to Dr Chandan K. Sen, Associate Director, 512 Davis Heart and Lung Research Institute, 473 W 12th Ave, Columbus, OH 43210. E-mail sen-1{at}medctr.osu.edu
| Abstract |
|---|
|
|
|---|
14% in arterial blood and <10% in the myocardium. During mild hypoxia, myocardial O2 drops to
1% to 3% or lower. In response to chronic moderate hypoxia, cells adjust their normoxia set point such that reoxygenation-dependent relative elevation of PO2 results in perceived hyperoxia. We hypothesized that O2, even in marginal relative excess of the PO2 to which cardiac cells are adjusted, results in activation of specific signal transduction pathways that alter the phenotype and function of these cells. To test this hypothesis, cardiac fibroblasts (CFs) isolated from adult murine ventricle were cultured in 10% or 21% O2 (hyperoxia relative to the PO2 to which cells are adjusted in vivo) and were compared with those cultured in 3% O2 (mild hypoxia). Compared with cells cultured in 3% O2, cells that were cultured in 10% or 21% O2 demonstrated remarkable reversible G2/M arrest and a phenotype indicative of differentiation to myofibroblasts. These effects were independent of NADPH oxidase function. CFs exposed to high O2 exhibited higher levels of reactive oxygen species production. The molecular signature response to perceived hyperoxia included (1) induction of p21, cyclin D1, cyclin D2, cyclin G1, Fos-related antigen-2, and transforming growth factor-ß1, (2) lowered telomerase activity, and (3) activation of transforming growth factor-ß1 and p38 mitogen-activated protein kinase. CFs deficient in p21 were resistant to such O2 sensitivity. This study raises the vital broad-based issue of controlling ambient O2 during the culture of primary cells isolated from organs.
Key Words: redox free radicals heart cell culture
| Introduction |
|---|
|
|
|---|
100 mm Hg or
14% O2.2 Thus, "normoxia" for cells is a variable that is dependent on the specific localization of the cell in organs and functional status of the specific tissue. O2 sensing is required to adjust to physiological or pathophysiological variations in PO2. Current work in this field is almost exclusively focused on the study of hypoxia. Reoxygenation, on the other hand, has been mostly investigated in the context of oxidative injury. Over 25 years ago, it was observed that PO2 beyond the comfort of the "perceived normoxic range" is a significant stressor, leading to growth arrest.3 The molecular bases of such observations remain to be characterized in light of current knowledge of signal transduction. During chronic hypoxia in the heart, cells adjust their normoxic set point such that the return to normoxic PO2 after chronic hypoxia is perceived as relative hyperoxia.4,5 We hypothesized that such challenge triggers changes in signal transduction processes. Although acute insult caused during reperfusion may be lethal to cells localized at the focus of insult, elevation of O2 tension in the surrounding ischemic tissue triggers phenotypic changes in the surviving cells that may be associated with tissue remodeling.
Ischemia in the heart results in a hypoxic area containing a central focus of near-zero O2 pressure bordered by tissue with diminished but nonzero O2 pressures. These border zones extend for several millimeters from the hypoxic core, with the O2 pressures progressively increasing from the focus to the normoxic region.6 Moderate hypoxia is associated with a 30% to 60% decrease (
1% to 3% O2) in PO2.7 Cardiac fibroblasts (CFs) are mainly responsible for the synthesis of major extracellular matrix (ECM) in the myocardium, including fibrillar collagen types I and III and fibronectin. More than 90% of the interstitial cells of the myocardium are fibroblasts,8 which actively engage in crosstalk with myocytes to determine the quantity and quality of the ECM. The present study rests on our striking observation that CFs isolated from adult murine ventricle and cultured in 10% or 21% O2 (high O2, relative to the PO2 to which cells are adjusted in vivo), compared with 3% O2 (mild hypoxia), exhibit reversible growth inhibition and a phenotype indicative of differentiation. The notion that marginal relative elevation in PO2, compared with the PO2 to which cells are adjusted during chronic moderate hypoxia, may serve as a signal to trigger CF differentiation and tissue remodeling is a novel concept relevant to fibrosis and tissue repair related to reperfusion injury. We hypothesized that in reoxygenated tissue, a sudden elevation of PO2 may profoundly influence the cellular phenotype even at those sites where oxidative injury may not be predominantly evident. Our objective was to characterize signal transduction pathways in the CFs that are sensitive to a sudden elevation of ambient PO2.
| Materials and Methods |
|---|
|
|
|---|
Cell Counting
Cells were seeded at 5000 cells per well in 4-well plates (culture area per well 1.9 cm2). Before they were counted, the cells were trypsinized and resuspended in a single-cell suspension. Counting was performed using a Z1 series Coulter counter.
Cell Cycle
Cell cycle profiles were determined using a flow cytometer11 and CellQuest software (BD Biosciences).
Mitochondrial Staining, ROS, and Oxidative Stress Markers
Mitochondria were stained using MitoTracker Red (Molecular Probes). Cellular reactive oxygen species (ROS) were detected using dihydrorhodamine 123 (Molecular Probes).
Lipid Peroxidation
4-Hydroxynonenal (HNE) protein adduct was detected using a specific antibody (Upstate Biotech).12
Protein Oxidation
Proteins were derivatized with dinitrophenylhydrazine, separated by SDS-gel electrophoresis, and blotted with antibody (Zymed) against dinitrophenyl groups.12
Immunofluorescence Microscopy
F-actin (phalloidin, dilution 1:40, Molecular Probes),
-smooth muscle actin (SMA, Sigma), and p21 (Santa Cruz) immunostaining and microscopy were performed as described previously using a Nikon E800 or Zeiss LSM510 multiphoton laser scanning microscope.13
Western Blot
Western blot was performed as described previously.14 Primary antibodies against vimentin (dilution 1:1000, Sigma), SMA (dilution 1:4000, Sigma), ß-actin (dilution 1:5000, Sigma), p21 (dilution 1:200, Santa Cruz), and Fos-related antigen-2 (Fra-2; dilution 1:200, Santa Cruz) were used to detect these antigens.
ELISA
Transforming growth factor (TGF)-ß1 ELISA was performed using a commercially available kit per the manufacturers recommendation (Promega).
mRNA Quantification
mRNAs were quantified by RNase protection assay (RPA) using commercial DNA templates (BD RiboQuant Ribonuclease Protection Assay system). Real-time polymerase chain reaction (PCR) detection of p21 was performed using double-stranded DNA binding dye SYBER Green-I and the following primer set: ACAGGAGCAAAGTGTGCCGTTGT and GCTCAGACACCAGAGTGCAAGACA.
Gel Contraction
Collagen lattices were prepared using type I collagen from rat-tail tendon as described.15 The degree of collagen gel contraction was determined after 6, 15, and 24 hours.
Luciferase and Chloramphenicol Acetyltransferase Reporter Assay
Luciferase activity was performed as described.16 A chloramphenicol acetyltransferase reporter assay (ELISA-based) was performed using a commercial kit (Promega). A TGF-ß1-luciferase promoter construct was kindly provided by Dr Cora Weigert and Dr Erwin D. Schleicher of the University of Tuebingen, Tuebingen, Germany.
p38 MAPK Activity
Phosphorylation of ATF-2 (substrate) by p38 mitogen-activated protein kinase (MAPK) was determined using a commercial kit (Cell Signaling Inc).
Telomerase Activity
Telomerase activity was determined using telomeric repeat amplification protocol (TRAPeze assay, Intergen).17 Retroviral hTERT vectors were kindly provided by Dr Robert Weinberg, Whitehead Institute for Biomedical Research (Cambridge, Mass), and Dr Judith Campisi, Lawrence Berkeley National Laboratory (Berkeley, Calif).
| Results |
|---|
|
|
|---|
|
Of importance, morphological characteristic of CFs grown at 3% O2 remained stable during the course of culture. In contrast, cells grown under hyperoxic conditions exhibited changes of phenotype indicative of differentiation (Figure 2A). Under hyperoxic conditions, cell size increased substantially (3- to 6-fold), and the appearance of stress fibers was evident, as shown in Figure 2A. Such changes were associated with a reorganization of SMA with stress fibers, a distinct morphological characteristic of CF differentiation. Additional results confirmed our contention that the exposure of CFs to a hyperoxic condition induces differentiation of fibroblasts to myofibroblasts. Hyperoxia enhances vimentin and SMA expression (Figure 2B). Contractile phenotype is a major characteristic feature of myofibroblasts. We used the collagen matrix contraction assay to test the contractility of hyperoxia-induced myofibroblasts. Figure 2C clearly demonstrates that under conditions of hyperoxia, CFs assume a markedly contractile phenotype.
|
Hyperoxic exposure resulted in potent induction of p21 expression and marginal increases in p53 expression in CFs (Figure 3A). Increased p21 mRNA expression was indeed associated with higher levels of p21 protein in CFs exposed to hyperoxia (Figure 3B). Microscopic visualization of CFs consistently revealed increased nuclear localization of p21 in CFs exposed to 21% O2 (Figure 3C). To test whether exposure to hyperoxia resulted in the activation of p21 transcription, p21 promoter (kindly provided by Drs Toshiyuki Sakai and Yoshihiro Sowa, Kyoto Prefectural University of Medicine, Kyoto, Japan) studies were conducted. Results show that exposure of CFs to 21% O2 resulted in a significant increase in p21 promoter-driven luciferase reporter activity (Figure 3D).
|
p21 plays an important role in differentiation-associated growth arrest, and its expression is augmented in many differentiating cells.25,26 p21 is also known to play a major role in G2/M arrest, a response triggered by exposure to hyperoxia (Figure 1C). Therefore, we were led to hypothesize that p21 induction in response to hyperoxia plays a major role in growth inhibition and subsequent differentiation. Disruption of this gene will allow fibroblasts to bypass hyperoxia-induced growth arrest and differentiation response. To test this hypothesis, experiments using CFs isolated from p21-deficient mice were conducted (Figures 4A and 4B). We observed that CFs deficient in p21 were not sensitive to hyperoxia-induced growth arrest (Figures 4C and 4D).
|
Next, our focus was directed to the study of O2-sensitive cellular signal transduction processes that accounted for the observed responses of CFs to hyperoxic exposure. The quantitative RPA approach was used to screen for 37 genes that are known to be key regulators of the cell cycle (Figure 5A). A summary of the findings is listed (Figure 5B). Exposure of CFs to hyperoxia resulted in marked induction of the following mediators of growth arrest/differentiation: cyclin D1, cyclin D2, cyclin G1, and Fra-2 (Figure 5A). Elevated expression of these candidates is associated not only with growth inhibition but also with differentiation. The D-type cyclins consist of cyclins D1, D2, and D3. Cyclin D1 synthesis is induced by p21.27 Cyclin D2 expression is induced in multiple states of growth arrest.28 Cyclin G1 is involved in G2/M arrest.29 This is consistent with our observation that CFs exposed to hyperoxia contain higher levels of cyclin G1 mRNA (Figure 5A) and are in G2/M arrest (Figure 1C). Fra-2 is a member of the Fos family of immediate-early genes, most of which are rapidly induced by second messengers. Although the role and biology of Fra-2 are less understood than those of its relatives, c-Fos, Fra-1, and FosB, it is evident that elevated Fra-2 is associated with cellular differentiation.30 In CFs exposed to hyperoxia, induction of Fra-2 mRNA was associated with higher levels of Fra-2 protein (Figure 5C). Telomerase, a ribonucleoprotein enzyme complex containing a catalytic reverse transcriptase component (hTERT) and an RNA template component, functions to add hexameric repeats of 5'-TTAGGG-3' to the end of telomeres to compensate for the progressive loss during cell division.31 Recently, it has been shown that telomerase activity in myofibroblasts is lower than that in fibroblasts.32 We observed that the exposure of CFs to hyperoxia results in the downregulation of telomerase activity (Figure 5D). It has been observed that compromised telomerase activity in proliferating cells leads to differentiation. In such cells, enhanced expression of p21 and p27 has been noted.33
|
TGF-ß1 induces CF differentiation.34 We determined that both total and active TGF-ß1 were substantially higher in CFs exposed to hyperoxia (Figure 6A). Experiments with conditioned cell culture media consistently support the notion that the media of CFs grown at 21% O2 contains significantly higher amounts of active TGF-ß1 than does the media of CFs grown at 3% O2 (Figure 6A). In support of the hypothesis that ROS (Figures 1F through 1H) can trigger the displacement of latency-associated peptide (LAP) from TGF-ß1,35 we observed that exposure to TGF-ß1containing conditioned culture media to oxidant challenge (UVC) significantly increased the levels of active TGF-ß1 (Figure 6B). Therefore, it is plausible that ROS generated by cells under conditions of hyperoxia (Figures 1F through 1H) may contribute to the activation of TGF-ß1. RPA results showed that TGF-ß1, TGF-ß2, and TGF-ß3 are sensitive to hyperoxia (Figure 6C). That hyperoxia indeed induced TGF-ß1 transcription was confirmed using a reporter assay (Figure 6D). Engagement of TGF-ß1 to its receptor is known to generate ROS by an NADH oxidasedependent mechanism.36 Thus, we sought to clarify whether elevated levels of TGF-ß1 present under conditions of hyperoxia are responsible for higher oxidant production (Figure 1F through 1H). We observed that treatment of CFs with TGF-ß1 triggers differentiation (Figure 7A) but does not elevate ROS generation (not shown) as determined in the present study.
|
|
The phenotypic characteristics of CFs observed in response to hyperoxia could be reproduced in CFs cultured at 3% O2 by treating cells with TGF-ß1 (compare Figure 2A with Figure 7A). Strikingly, inhibition of p38 MAPK, a downstream mediator of TGF-ß1 signaling, released both TGF-ß1induced as well as hyperoxia-induced growth inhibition. This result was obtained after tests of several known inhibitors of the signal transduction path; no other tested inhibitor shared the effect of SB203580. These data suggest a parallel between TGF-ß1induced and hyperoxia-induced changes in cellular responses (Figure 7B). On the basis of this observation, we hypothesized that exposure of CFs to hyperoxia induces the activation of p38 MAPK, which in turn plays a significant role in executing O2-induced growth inhibition as shown in Figure 1. We obtained direct evidence showing that the activation of p38 MAPK is sensitive to ambient O2 (Figure 7C).
| Discussion |
|---|
|
|
|---|
Cardiac remodeling leads to changes in the ECM and, in some cases, to cardiac fibrosis, a process involving myofibroblasts as an active component. Myofibroblasts are larger and more stellate, proliferate slowly, and have the most prominent microfilament arrays. These cells are characterized by the presence of SMA-containing stress fibers, vinculin-containing fibronexus adhesion complexes, fibronectin fibrils containing the ED-A splice variant, and increased expression of vimentin. Therefore, our observation that exposure to a higher PO2 relative to which cells are adjusted induces the differentiation of CF to myofibroblasts is of significant relevance to cardiac tissue remodeling in the face of reoxygenation.
In mammalian cells, differentiation and senescence are two common cellular processes that are initiated by cell cycle block.25 Irreversible growth arrest is one of the hallmarks of senescence. The observation that O2-induced growth arrest of CFs is reversible indicates a specific commitment toward differentiation. Induction of p21, a cyclin-dependent kinase (Cdk) inhibitor, is a common mechanism of growth arrest and early differentiation.25,26 Under conditions of stress, the growth of cycling cells is arrested at one of two critical cell cycle check points, G1-S or G2-M. Our findings confirm that p21 induction in response to hyperoxia plays a major role in growth inhibition and subsequent differentiation. Disruption of this gene allows CFs to bypass hyperoxia-induced growth arrest and differentiation response.
The molecular signature of exposure to a higher PO2 relative to which cells are adjusted included, in addition to p21, enhanced expression of other cell cycle inhibitors, such as cyclin D1, cyclin D2, cyclin G1, and Fra-2. These genes are associated not only with growth inhibition but also with differentiation. The D-type cyclins consist of cyclins D1, D2, and D3. Cyclin D1 synthesis is induced by p21.27 Cyclin D2 expression is induced in multiple states of growth arrest.28 Cyclin G1 is involved in G2/M arrest.29 This is consistent with our observation that CFs exposed to hyperoxia contain higher levels of cyclin G1 mRNA and are in G2/M arrest.
TGF-ß is a natural inducer of growth inhibition and differentiation in CFs.34 The effects of TGF-ß are associated with upregulation of the following Cdk inhibitors: p21, p15Ink4B, and p27Kip1.39 p38 MAPK activation represents a prominent downstream target of TGF-ß40 and is critical for p21 induction41 via p53 phosphorylation. Inhibition of p38 MAPK prevented TGF-ßinduced differentiation of CFs to myofibroblasts, suggesting a key role of this signaling mediator.34 Interestingly, ROS are involved in TGF-ßinduced p38 MAPK activation.42,43 Note that in the TGF-ß/p21 signaling axis, the activation of each key mediator (TGF-ß, p38 MAPK, and cysteine-rich zinc-finger transcription factor Sp-1) is ROS inducible. Mild sublethal oxidative challenge selectively activates p38 MAPK, resulting in cell cycle arrest at G2/M.44 Mechanisms controlling the activation of latent TGF-ß are important for regulating the activity of TGF-ß. Oxidation reactions disrupt the interaction between the LAP and TGF-ß to release active TGF-ß.35 Active TGF-ß tightly regulates the production of ECM by balancing new synthesis and turnover of ECM components. In this capacity, TGF-ß may provide a key role in physiological tissue remodeling or generate excess ECM to cause fibrosis.45 The effects of hyperoxic exposure reported in the present study are associated with elevated levels of ROS. We have failed to attenuate the effects by strategies involving adenoviral overexpression of catalase in CFs or treatment of cells with the commonly used antioxidant N-acetylcysteine. These observations led us to postulate that although a supporting role of ROS in signaling for hyperoxia may not be ruled out, molecular O2 could well serve as a trigger initiating O2-sensitive signaling pathways. This contention is consistent with a recent report demonstrating that molecular O2 may indeed modulate signaling processes by an ROS-independent prolyl-hydroxylation reaction.46
That low O2 ambience serves as a cue to trigger angiogenesis is a well-accepted notion. The present study presents first evidence indicating that the sensing of the O2 environment is not limited to hypoxia. It demonstrates that marginal relative elevation in PO2, compared with PO2 to which cells or tissues are adjusted, serves as a signal to trigger changes in the cellular phenotype relevant to tissue remodeling.
| Acknowledgments |
|---|
Received November 25, 2002; revision received December 27, 2002; accepted January 7, 2003.
| References |
|---|
|
|
|---|
2. Porwol T, Ehleben W, Brand V, Acker H. Tissue oxygen sensor function of NADPH oxidase isoforms, an unusual cytochrome aa3 and reactive oxygen species. Respir Physiol. 2001; 128: 331348.[CrossRef][Medline] [Order article via Infotrieve]
3. Packer L, Fuehr K. Low oxygen concentration extends the lifespan of cultured human diploid cells. Nature. 1977; 267: 423425.[CrossRef][Medline] [Order article via Infotrieve]
4. Novotna J, Bibova J, Hampl V, Deyl Z, Herget J. Hyperoxia and recovery from hypoxia alter collagen in peripheral pulmonary arteries similarly. Physiol Res. 2001; 50: 153163.[Medline] [Order article via Infotrieve]
5. Elsasser A, Schlepper M, Klovekorn WP, Cai WJ, Zimmermann R, Muller KD, Strasser R, Kostin S, Gagel C, Munkel B, Schaper W, Schaper J. Hibernating myocardium: an incomplete adaptation to ischemia. Circulation. 1997; 96: 29202931.
6. Rumsey WL, Pawlowski M, Lejavardi N, Wilson DF. Oxygen pressure distribution in the heart in vivo and evaluation of the ischemic "border zone." Am J Physiol. 1994; 266: H1676H1680.[Medline] [Order article via Infotrieve]
7. Siaghy EM, Devaux Y, Sfaksi N, Carteaux JP, Ungureanu-Longrois D, Zannad F, Villemot JP, Burlet C, Mertes PM. Consequences of inspired oxygen fraction manipulation on myocardial oxygen pressure, adenosine and lactate concentrations: a combined myocardial microdialysis and sensitive oxygen electrode study in pigs. J Mol Cell Cardiol. 2000; 32: 493504.[CrossRef][Medline] [Order article via Infotrieve]
8. Eghbali M, Czaja MJ, Zeydel M, Weiner FR, Zern MA, Seifter S, Blumenfeld OO. Collagen chain mRNAs in isolated heart cells from young and adult rats. J Mol Cell Cardiol. 1988; 20: 267276.[CrossRef][Medline] [Order article via Infotrieve]
9. Subramanian SV, Kelm RJ Jr, Polikandriotis JA, Orosz CG, Strauch AR. Reprogramming of vascular smooth muscle actin gene expression as an early indicator of dysfunctional remodelling following heart transplant. Cardiovasc Res. 2002; 54: 539548.
10. Koistinaho M, Kettunen MI, Goldsteins G, Keinanen R, Salminen A, Ort M, Bures J, Liu D, Kauppinen RA, Higgins LS, Koistinaho J. ß-Amyloid precursor protein transgenic mice that harbor diffuse Aß deposits but do not form plaques show increased ischemic vulnerability: role of inflammation. Proc Natl Acad Sci U S A. 2002; 99: 16101615.
11. Krishan A. Rapid flow cytofluorometric analysis of mammalian cell cycle by propidium iodide staining. J Cell Biol. 1975; 66: 188193.
12. Gordillo GM, Atalay M, Roy S, Sen CK. The hemangioma model for in vivo angiogenesis: inducible oxidative stress and MCP-1 expression in EOMA cells. Methods Enzymol. 2002; 352: 422432.[Medline] [Order article via Infotrieve]
13. Sen CK, Khanna S, Babior BM, Hunt TK, Ellison EC, Roy S. Oxidant-induced vascular endothelial growth factor expression in human keratinocytes and cutaneous wound healing. J Biol Chem. 2002; 277: 3328433290.
14. Sen CK, Khanna S, Roy S, Packer L. Molecular basis of vitamin E action: tocotrienol potently inhibits glutamate-induced pp60(c-Src) kinase activation and death of HT4 neuronal cells. J Biol Chem. 2000; 275: 1304913055.
15. Bogatkevich GS, Tourkina E, Silver RM, Ludwicka-Bradley A. Thrombin differentiates normal lung fibroblasts to a myofibroblast phenotype via the proteolytically activated receptor-1 and a protein kinase C-dependent pathway. J Biol Chem. 2001; 276: 4518445192.
16. Khanna S, Venojarvi M, Roy S, Sharma N, Trikha P, Bagchi D, Bagchi M, Sen CK. Dermal wound healing properties of redox active grape seed proanthocyanidins. Free Radic Biol Med. 2002; 33: 10891096.[CrossRef][Medline] [Order article via Infotrieve]
17. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, Coviello GM, Wright WE, Weinrich SL, Shay JW. Specific association of human telomerase activity with immortal cells and cancer. Science. 1994; 266: 20112015.
18. Winegrad S, Henrion D, Rappaport L, Samuel JL. Self-protection by cardiac myocytes against hypoxia and hyperoxia. Circ Res. 1999; 85: 690698.
19. Gonschior P, Gonschior GM, Conzen PF, Hobbhahn J, Goetz AE, Peter K, Brendel W. Myocardial oxygenation and transmural lactate metabolism during experimental acute coronary stenosis in pigs. Basic Res Cardiol. 1992; 87: 2737.[CrossRef][Medline] [Order article via Infotrieve]
20. Whalen WJ. Intracellular PO2 in heart and skeletal muscle. Physiologist. 1971; 14: 6982.[Medline] [Order article via Infotrieve]
21. Sorescu D, Weiss D, Lassegue B, Clempus RE, Szocs K, Sorescu GP, Valppu L, Quinn MT, Lambeth JD, Vega JD, Taylor WR, Griendling KK. Superoxide production and expression of nox family proteins in human atherosclerosis. Circulation. 2002; 105: 14291435.
22. Vendemiale G, Grattagliano I, Altomare E, Serviddio G, Portincasa P, Prigigallo F, Palasciano G. Mitochondrial oxidative damage and myocardial fibrosis in rats chronically intoxicated with moderate doses of ethanol. Toxicol Lett. 2001; 123: 209216.[CrossRef][Medline] [Order article via Infotrieve]
23. Blasig IE, Grune T, Schonheit K, Rohde E, Jakstadt M, Haseloff RF, Siems WG. 4-Hydroxynonenal, a novel indicator of lipid peroxidation for reperfusion injury of the myocardium. Am J Physiol. 1995; 269: H14H22.[Medline] [Order article via Infotrieve]
24. Haklar G, Ersahin C, Moini H, Sungun M, Dogan N, Bilsel S, Emerk K, Yalcin AS. Protective effects of cilazapril against free radical injury in myocardial ischaemia-reperfusion. Pharmacol Res. 1995; 31: 3336.[Medline] [Order article via Infotrieve]
25. Wainwright LJ, Lasorella A, Iavarone A. Distinct mechanisms of cell cycle arrest control the decision between differentiation and senescence in human neuroblastoma cells. Proc Natl Acad Sci U S A. 2001; 98: 93969400.
26. Di Cunto F, Topley G, Calautti E, Hsiao J, Ong L, Seth PK, Dotto GP. Inhibitory function of p21Cip1/WAF1 in differentiation of primary mouse keratinocytes independent of cell cycle control. Science. 1998; 280: 10691072.
27. Chen X, Bargonetti J, Prives C. p53, through p21 (WAF1/CIP1), induces cyclin D1 synthesis. Cancer Res. 1995; 55: 42574263.
28. Meyyappan M, Wong H, Hull C, Riabowol KT. Increased expression of cyclin D2 during multiple states of growth arrest in primary and established cells. Mol Cell Biol. 1998; 18: 31633172.
29. Kimura SH, Ikawa M, Ito A, Okabe M, Nojima H. Cyclin G1 is involved in G2/M arrest in response to DNA damage and in growth control after damage recovery. Oncogene. 2001; 20: 32903300.[CrossRef][Medline] [Order article via Infotrieve]
30. Outinen PA, Sood SK, Pfeifer SI, Pamidi S, Podor TJ, Li J, Weitz JI, Austin RC. Homocysteine-induced endoplasmic reticulum stress and growth arrest leads to specific changes in gene expression in human vascular endothelial cells. Blood. 1999; 94: 959967.
31. Blackburn EH. Telomerases. Annu Rev Biochem. 1992; 61: 113129.[CrossRef][Medline] [Order article via Infotrieve]
32. Liu T, Nozaki Y, Phan SH. Regulation of telomerase activity in rat lung fibroblasts. Am J Respir Cell Mol Biol. 2002; 26: 534540.
33. Kondo S, Tanaka Y, Kondo Y, Hitomi M, Barnett GH, Ishizaka Y, Liu J, Haqqi T, Nishiyama A, Villeponteau B, Cowell JK, Barna BP. Antisense telomerase treatment: induction of two distinct pathways, apoptosis and differentiation. FASEB J. 1998; 12: 801811.
34. Dugina V, Fontao L, Chaponnier C, Vasiliev J, Gabbiani G. Focal adhesion features during myofibroblastic differentiation are controlled by intracellular and extracellular factors. J Cell Sci. 2001; 114: 32853296.[Medline] [Order article via Infotrieve]
35. Barcellos-Hoff MH, Dix TA. Redox-mediated activation of latent transforming growth factor-ß1. Mol Endocrinol. 1996; 10: 10771083.
36. Thannickal VJ, Fanburg BL. Activation of an H2O2-generating NADH oxidase in human lung fibroblasts by transforming growth factor ß1. J Biol Chem. 1995; 270: 3033430338.
37. Kloner RA, Bolli R, Marban E, Reinlib L, Braunwald E. Medical and cellular implications of stunning, hibernation, and preconditioning: an NHLBI workshop. Circulation. 1998; 97: 18481867.
38. Hughes GC. Cellular models of hibernating myocardium: implications for future research. Cardiovasc Res. 2001; 51: 191193.
39. Reynisdottir I, Polyak K, Iavarone A, Massague J. Kip/Cip and Ink4 Cdk inhibitors cooperate to induce cell cycle arrest in response to TGF-ß. Genes Dev. 1995; 9: 18311845.
40. Goldberg PL, MacNaughton DE, Clements RT, Minnear FL, Vincent PA. p38 MAPK activation by TGF-ß1 increases MLC phosphorylation and endothelial monolayer permeability. Am J Physiol. 2002; 282: L146L154.
41. Alderton F, Humphrey PP, Sellers LA. High-intensity p38 kinase activity is critical for p21cip1 induction and the antiproliferative function of G(i) protein-coupled receptors. Mol Pharmacol. 2001; 59: 11191128.
42. Herrera B, Fernandez M, Roncero C, Ventura JJ, Porras A, Valladares A, Benito M, Fabregat I. Activation of p38 MAPK by TGF-ß in fetal rat hepatocytes requires radical oxygen production, but is dispensable for cell death. FEBS Lett. 2001; 499: 225229.[CrossRef][Medline] [Order article via Infotrieve]
43. Chiu C, Maddock DA, Zhang Q, Souza KP, Townsend AR, Wan Y. TGF-ß-induced p38 activation is mediated by Rac1-regulated generation of reactive oxygen species in cultured human keratinocytes. Int J Mol Med. 2001; 8: 251255.[Medline] [Order article via Infotrieve]
44. Kurata S. Selective activation of p38 MAPK cascade and mitotic arrest caused by low level oxidative stress. J Biol Chem. 2000; 275: 2341323416.
45. Border WA, Noble NA. Transforming growth factor ß in tissue fibrosis. N Engl J Med. 1994; 331: 12861292.
46. Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ, Kriegsheim A, Hebestreit HF, Mukherji M, Schofield CJ, Maxwell PH, Pugh CW, Ratcliffe PJ. Targeting of HIF-
to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science. 2001; 292: 468472.
This article has been cited by other articles:
![]() |
Y. NONOMURA, F. MIZOGUCHI, A. SUZUKI, T. NANKI, H. KATO, N. MIYASAKA, and H. KOHSAKA Hypoxia-induced Abrogation of Contact-dependent Inhibition of Rheumatoid Arthritis Synovial Fibroblast Proliferation J Rheumatol, April 1, 2009; 36(4): 698 - 705. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Roy, S. Khanna, S.-R. A. Hussain, S. Biswas, A. Azad, C. Rink, S. Gnyawali, S. Shilo, G. J. Nuovo, and C. K. Sen MicroRNA expression in response to murine myocardial infarction: miR-21 regulates fibroblast metalloprotease-2 via phosphatase and tensin homologue Cardiovasc Res, April 1, 2009; 82(1): 21 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sun Myocardial repair/remodelling following infarction: roles of local factors Cardiovasc Res, February 15, 2009; 81(3): 482 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, H. Cui, T. K. Kundu, W. Alzawahra, and J. L. Zweier Nitric Oxide Production from Nitrite Occurs Primarily in Tissues Not in the Blood: CRITICAL ROLE OF XANTHINE OXIDASE AND ALDEHYDE OXIDASE J. Biol. Chem., June 27, 2008; 283(26): 17855 - 17863. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Roy, S. Khanna, T. Rink, J. Radtke, W. T. Williams, S. Biswas, R. Schnitt, A. R. Strauch, and C. K. Sen p21waf1/cip1/sdi1 as a Central Regulator of Inducible Smooth Muscle Actin Expression and Differentiation of Cardiac Fibroblasts to Myofibroblasts Mol. Biol. Cell, December 1, 2007; 18(12): 4837 - 4846. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhu, B. Liu, S. Zhou, Y.-R. Chen, Y. Deng, J. L. Zweier, and G. He Ischemic preconditioning prevents in vivo hyperoxygenation in postischemic myocardium with preservation of mitochondrial oxygen consumption Am J Physiol Heart Circ Physiol, September 1, 2007; 293(3): H1442 - H1450. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Kuhn, S. Roy, J. Radtke, S. Khanna, and C. K. Sen Laser microdissection and capture of pure cardiomyocytes and fibroblasts from infarcted heart regions: perceived hyperoxia induces p21 in peri-infarct myocytes Am J Physiol Heart Circ Physiol, March 1, 2007; 292(3): H1245 - H1253. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, M. Petrimpol, K. D. Molle, M. N. Hall, E. J. Battegay, and R. Humar Hypoxia-Induced Endothelial Proliferation Requires Both mTORC1 and mTORC2 Circ. Res., January 5, 2007; 100(1): 79 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bedard and K.-H. Krause The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology Physiol Rev, January 1, 2007; 87(1): 245 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Sen, S. Khanna, and S. Roy Perceived hyperoxia: Oxygen-induced remodeling of the reoxygenated heart Cardiovasc Res, July 15, 2006; 71(2): 280 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Kuhn, S. Roy, J. Radtke, S. Gupta, and C. K. Sen Laser microdissection and pressure-catapulting technique to study gene expression in the reoxygenated myocardium Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2625 - H2632. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Roy, S. Khanna, D. E. Kuhn, C. Rink, W. T. Williams, J. L. Zweier, and C. K. Sen Transcriptome analysis of the ischemia-reperfused remodeling myocardium: temporal changes in inflammation and extracellular matrix Physiol Genomics, May 16, 2006; 25(3): 364 - 374. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Miragoli, G. Gaudesius, and S. Rohr Electrotonic Modulation of Cardiac Impulse Conduction by Myofibroblasts Circ. Res., March 31, 2006; 98(6): 801 - 810. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ernens, S. J. Goodfellow, F. Innes, N. S. Kenneth, L. E. Derblay, R. J. White, and P. H. Scott Hypoxic stress suppresses RNA polymerase III recruitment and tRNA gene transcription in cardiomyocytes Nucleic Acids Res., January 10, 2006; 34(1): 286 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Khanna, S. Roy, A. Slivka, T. K.S. Craft, S. Chaki, C. Rink, M. A. Notestine, A. C. DeVries, N. L. Parinandi, and C. K. Sen Neuroprotective Properties of the Natural Vitamin E {alpha}-Tocotrienol Stroke, October 1, 2005; 36(10): e144 - e152. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, A. Samouilov, X. Liu, and J. L. Zweier Characterization of the Effects of Oxygen on Xanthine Oxidase-mediated Nitric Oxide Formation J. Biol. Chem., April 23, 2004; 279(17): 16939 - 16946. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Roy, S. Khanna, W. A. Wallace, J. Lappalainen, C. Rink, A. J. Cardounel, J. L. Zweier, and C. K. Sen Characterization of Perceived Hyperoxia in Isolated Primary Cardiac Fibroblasts and in the Reoxygenated Heart J. Biol. Chem., November 21, 2003; 278(47): 47129 - 47135. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gaudesius, M. Miragoli, S. P. Thomas, and S. Rohr Coupling of Cardiac Electrical Activity Over Extended Distances by Fibroblasts of Cardiac Origin Circ. Res., September 5, 2003; 93(5): 421 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, S. Sharma, L. X. Zhu, T. Kogai, J. M. Hershman, G. A. Brent, S. M. Dubinett, and M. Huang Nonradioactive Iodide Effectively Induces Apoptosis in Genetically Modified Lung Cancer Cells Cancer Res., August 15, 2003; 63(16): 5065 - 5072. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2003 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |