| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Medicine |
From the Department of Internal Medicine, School of Medicine, State University of Campinas, Campinas, SP, Brazil.
Correspondence to Kleber G. Franchini, MD, PhD, Departamento de Clínica Médica, Faculdade de Ciências Médicas, Universidade Estadual de Campinas, Cidade Universitária "Zefferino Vaz," 13081-970 Campinas, SP, Brasil. E-mail franchin{at}obelix.unicamp.br
| Abstract |
|---|
|
|
|---|
Key Words: pressure overload transcription factors myocyte enhancer factor 2 c-jun extracellular signalregulated kinase 5
| Introduction |
|---|
|
|
|---|
One such gene, c-jun, has been shown to be rapidly and transiently activated by mechanical stress in isolated myocytes3 and myocardium.4 The c-jun promoter contains binding sites for transcription factors such as Sp1, CTF, activator protein-1 (AP-1), and myocyte enhancer factor 2 (MEF2).5 Binding of the AP-1 complex (c-Fos/ATF or c-Jun/c-Jun dimer) to the tissue plasminogen activatorresponsive element in the c-jun promoter has been shown to result in the stimulation of its transcription.6 Studies in NIH 3T3 fibroblasts and monocytic cells have shown that MEF2 transcription factors also play an important role in the transcriptional regulation of c-jun.7,8 Moreover, MEF2 activation in multiple models of cardiac hypertrophy supports the view that factors of this family might play a central role in the regulation of fundamental signaling mechanisms during the myocardial hypertrophic growth.911 Although it is well established that MEF2 is important for the activation of cardiac musclespecific genes,12 the regulation of MEF2 factors in the early phase of load-induced cardiac hypertrophy and the set of genes controlled by these factors in cardiac myocytes remain essentially unknown.
In the present study, experiments were performed to examine the importance of MEF2 in the regulation of c-jun transcriptional activation during acute pressure overload in the myocardium of rats. Additional assays were performed to investigate the importance of extracellular signalregulated kinase 5 (ERK5) and the MEF2 element in the regulation of c-jun activation induced by phenylephrine in isolated neonatal rat ventricular myocytes (NRVMs).
| Materials and Methods |
|---|
|
|
|---|
Immunoblotting
Homogenates of left ventricles (LVs) were resolved on SDS-PAGE and transferred to nitrocellulose membranes. The membranes were incubated with primary antibodies (antiphospho-p38, anti-p38, anti-MEF2A, and antic-jun from Santa Cruz Biotechnology; anti-ERK5 from Calbiochem) and stained with 125I-protein A.
ERK5 Kinase Activity and In Vitro Assay
ERK5 activity was assessed through an autophosphorylation assay.14 ERK5 activity toward MEF2 was analyzed by in vitro kinase assay, as described previously with modifications.11 Briefly, immunoprecipitated ERK5 from sham or overloaded rat LVs was mixed with MEF2 immunoprecipitated from the LVs of sham rats. The reaction was carried out by addition of [
-32P]ATP. Proteins were resolved in SDS-PAGE, and bands corresponding to p70MEF2 were quantified by densitometry.
Tissue Preparation for Immunohistochemistry
Procedures for immunohistochemistry were performed as described previously.15 LVs were fixed with 4% paraformaldehyde and set in paraffin. Sections were incubated with primary antibodies, followed by incubation with peroxidase-conjugated secondary antibodies; the sections were then stained by reacting diaminobenzidine with H2O2. Secondary antibody specificity was tested in a series of positive and negative control measurements.
Isolation of Total RNA/Reverse TranscriptionPolymerase Chain Reaction Analysis
Total LV RNA was isolated with Trizol reagent.16 cDNA synthesis was performed in 6-µg aliquots of RNA with the Superscript preamplification system (Life Technologies). Taq DNA polymerase was used to amplify the cDNA in the presence of sense and antisense primers for c-jun (5'-GACCTTCTACGACGATGC-3' and 5'-CAGCGCCAGCTACTGAGGC-3', respectively) or ß-actin (5'-TTCTACAATGAGCTGCGTGTGGCT-3' and 5'-GCTTCTCCT-TAATGTCACGCACGA-3', respectively).
Preparation of Nuclear Extracts and EMSAs
The preparation of LV nuclear extracts and electrophoretic mobility shift assays (EMSAs) were carried out as described previously.17 MEF2 (GATCGCTCTAAAAATAACCCTGTCG) and nuclear factor-
B (AGTTGAGGGGACTTTCCCAGGC) DNA binding site oligonucleotides were from Santa Cruz. The specificity for MEF2 binding was confirmed by competition assays with unlabeled oligonucleotides and immunogel-shift experiments with anti-MEF2A antibody and preimmune serum.
Plasmid Transfection and Dual Reporter Gene Assays
Plasmids18 containing the murine c-jun promoter fused to the firefly luciferase gene (pJC6GL3, wild type) with mutations at the MEF2 (pJSXGL3) and AP-1 (pJTXGL3) sites were generated by Dr Ron Prywes (Columbia University, New York, NY). Experiments were first carried out in the in situ rat hearts. c-jun promoter reporter plasmids and the internal control SV40-renilla luciferase were injected into the LVs of anesthetized rats. After 1 week of recovery, the rats were subjected to aortic constriction (lasting from 10 minutes to 3 hours). A transconstriction systolic gradient was measured, and the LV was assayed for luciferase activity. In a different set of experiments, c-jun promoters and SV-40 reporter plasmids were transfected in NRVMs, which were then treated with phenylephrine. All firefly luciferase values were normalized to renilla firefly activities.
ERK5-Antisense ODN Transfection
An ERK5-antisense oligodeoxynucleotide (ODN) (5'-GGCTTTCGAGGTTCAG-3') based on nucleotides 91 to 105 of the rat ERK5 mRNA partial sequence (GenBank No. AJ005424) was constructed. The sense sequence (5'-CTGAACCTCGAAAGCC-3') was used as a control. All bases were obtained from Life Technologies and were phosphorothioate-protected. The ERK5 ODNs were transfected in NRVMs 24 hours after the transfection with reporter genes. NRVMs were maintained for 18 hours in medium containing 10% serum and then for 6 hours in serum-free medium, treated with phenylephrine for an additional 3 hours, and then harvested for reporter gene assays. Cells used for immunoblotting and confocal analysis were collected immediately after the 18-hour serum exposition.
Laser Confocal Analysis
NRVMs were fixed with 4% paraformaldehyde and incubated with primary antibodies. This was followed by incubation with biotin-conjugated secondary antibodies and then with streptavidin-Cy2 and rhodamine-conjugated phalloidin. Images were obtained with a laser confocal microscope (Zeiss LSM510).
Statistical Analysis
Data are presented as mean±SEM. Differences between the mean values of the densitometric readings were tested by 1-way ANOVA for repeated measurements and the Bonferroni multiple-range test. A value of P<0.05 indicated statistical significance.
An expanded Materials and Methods section can be found in the online data supplement available at http://www.circresaha.org.
| Results |
|---|
|
|
|---|
40 mm Hg (from 130 to 170 mm Hg) in the period ranging from 10 minutes to 2 hours after aortic constriction. Systolic pressures measured in the abdominal aorta were similar in aorta-constricted and in sham-operated rats.
|
Protein Expression and Activation of p70MEF2 in Overloaded Myocardium
As a first step toward studying the regulation of MEF2 in overloaded myocardium, immunoblotting experiments were performed to assess the amount of the MEF2 protein with anti-MEF2A antibody. Because this antibody has been shown to cross-react with other isoforms of MEF2 proteins, the specific product recognized by this antibody was named p70MEF2. As shown in Figure 2A, a prominent double band was stained at
70 kDa in the homogenates of the rat LV. Experiments performed with blocking peptide indicated the specificity of this antibody to p70MEF2 (please see online Figure 1A, available in the data supplement at http://www.circresaha.org). Aortic constriction lasting from 10 minutes up to 2 hours produced no change in p70MEF2 protein levels in the rat heart. p70MEF2 was then localized in sections of LV by immunohistochemical staining. Myocardial p70MEF2 was localized predominantly at the nuclei of cardiac myocytes (Figure 2C). Pressure overload caused no major change in the p70MEF2 distribution pattern in cardiac myocytes (data not shown).
|
To obtain evidence that pressure overload activates MEF2 in the myocardium, we performed EMSA of LV nuclear extracts to study the interaction between MEF2 and an oligonucleotide containing the consensus binding DNA sequence for MEF2 (Figure 2D). A consistent increase in DNA binding activity of MEF2 was observed after 1 and 2 hours of sustained pressure overload. The specificity of the DNA probe for MEF2 binding was confirmed by competition assays with unlabeled oligonucleotides (Figure 2D) and by supershift assay with the anti-MEF2 antibody (Figure 2E). The immunogel-shift assay showed that a major component of the DNA-protein complex was shifted by the anti-MEF2 antibody, confirming that the MEF2 consensus oligonucleotide was bound by MEF2 proteins.
Effect of Pressure Overload on MAPK-MEF2 Pathway
MEF2 proteins have potential mitogen-activated protein kinase (MAPK) phosphorylation sites,12 which have been suggested to be involved in the activation of this transcription factor.19,20 Nevertheless, the available data indicate that only p38 and ERK5 are able to regulate MEF2 factors.19,20 To analyze the role of p38 and ERK5 in mediating the load-induced activation of p70MEF2 in the myocardium, we first studied whether pressure overload regulates ERK5 and p38 activity in this tissue. Immunoblotting analysis with antibodies against phospho-p38 and pan-p38 indicated that pressure overload ranging from 10 minutes to 2 hours did not change the activity or quantity of p38 in the LV myocardium (Figure 3A). Immunohistochemical analysis showed that p38-MAPK is constitutively present in the sarcoplasm and nuclei of cardiac myocytes (online Figure 1B). However, in overloaded myocardium, no change was detected in the nuclear and sarcoplasmic staining with specific antibody (data not shown).
|
Analysis performed through an in vitro kinase assay based on immunoprecipitated ERK5 autophosphorylation showed a progressive increase of ERK5 activity in overloaded hearts that was detected as early as 30 minutes, up to a maximum of 4.2-fold, after 2 hours of pressure overload (Figure 3B). Western blotting with anti-ERK5 antibody showed that equivalent amounts of ERK5 protein were present in LV homogenates during the experimental protocol (Figure 3B). Immunohistochemical analysis of ERK5 in myocardial sections of control rats showed a diffuse staining in the cytosol of cardiac myocytes (Figure 3C). However, consistent nuclear staining of cardiac myocytes was observed in the myocardial sections obtained from rats subjected to pressure overload (Figure 3D).
We then investigated whether acute pressure overload could induce ERK5 to interact with p70MEF2. Coimmunoprecipitation assays of LV homogenates showed a progressive association between ERK5 and p70MEF2 in vivo (Figure 4A). The ability of activated ERK5 to phosphorylate p70MEF2 was confirmed by an in vitro kinase assay. ERK5 immunoprecipitated from LV homogenates of control and overloaded hearts was added to p70MEF2 immunoprecipitated from LV homogenates of control rats suspended in a kinase buffer and [
-32P]ATP. Densitometric analysis indicated a progressive increase in the phosphorylation of p70MEF2, beginning at 30 minutes and reaching a 2.2-fold maximum increase at 2 hours after the onset of pressure overload (Figure 4B). Immunoblotting analysis showed that an equal amount of MEF2 substrate was present in samples containing immunoprecipitated MEF2. In contrast, a weak band of MEF2 was detected in samples containing only ERK5 immunoprecipitates, which may represent the amount of MEF2 associated with ERK5. Accordingly, a minor phosphorylated MEF2 band was also encountered in the lane correspondent to ERK5 immunoprecipitates alone, further indicating that MEF2 is a physiological substrate of ERK5.
|
MEF2 Element Regulates c-jun Promoter Activation by Pressure Overload
Pressure overload has been shown to induce a rapid increase in myocardial c-jun expression.4 In addition, in cell culture systems, c-jun expression has been reported to be increased by transcription factors activated by MAPKs, including MEF2 and the AP-1 complex.19 In the present study, the influence of pressure overload on LV c-jun expression was analyzed by reverse transcription (RT)polymerase chain reaction (PCR), Western blot, and immunohistochemistry. Pressure overload induced a biphasic increase in c-jun mRNA and protein expression in the LV, with an early peak (
3-fold) at 10 minutes and a second peak (
2.5-fold) at 2 hours after aortic constriction (Figures 5A and 5B). In the LVs of control rats, immunostaining with antic-Jun antibody was found predominantly at the sarcoplasm of cardiac myocytes (Figure 5C). Pressure overload markedly increased the nuclear staining for c-Jun, as demonstrated in the representative example of Figure 5D.
|
Experiments using in vivo transfection of LVs with the c-jun promoter reporter gene were performed to evaluate the role of MEF2 in the regulation of load-induced c-jun expression in the myocardium (Figure 6). The LV was transfected with firefly luciferasefused plasmids containing wild-type c-jun promoter (pJC6GL3), a c-jun promoter mutated for the AP-1 site (pJTXGL3), or a c-jun promoter mutated for the MEF2 site (pJSXGL3) by direct injection in the wall of the LV (Figure 6A). After 1 week, transfected rats were subjected to aortic constriction or sham operation and euthanized 3 hours after these procedures for the analysis of luciferase activity (Figures 6B and 6C). Pressure overload induced a 2-fold increase in luciferase activity in the LV transfected with the wild-type plasmid (pJC6GL3), which confirmed that pressure overload induces c-jun transactivation. In contrast, LVs of 30-minuteoverloaded hearts showed no change in luciferase activity, indicating that the first peak of c-junenhanced expression was probably regulated by posttranscriptional mechanisms. Pressure overload still increased firefly luciferase activity in the LVs of rats transfected with the c-jun promoter mutated at the AP-1 site (pJTXGL3) by 2-fold, although the basal luciferase activity of this promoter was 3-fold less than wild-type c-jun. In contrast, no change was observed in luciferase activity in the LVs of rats transfected with MEF2-mutated plasmid (pJSXGL3), even though in these experiments this plasmid showed basal activity similar to that of wild-type plasmid. In general, these data support the notion that the MEF2 site plays an important role in c-jun promoter transactivation by acute pressure overload.
|
ERK5 and MEF2 Element Regulate c-jun Promoter Activation Induced by Phenylephrine in NRVMs
To further analyze the regulation of c-jun promoter activity by ERK5 and MEF2, additional experiments were performed on NRVMs subjected to hypertrophic stimulus with phenylephrine The results obtained in this model were consistent with the data from our in vivo studies. As shown in Figure 7A, NRVMs transfected with wild-type c-jun promoter showed a
2-fold increase in luciferase activity after a 3-hour phenylephrine treatment. MEF2 element mutation abolished the phenylephrine-induced increases in c-jun promoter luciferase activity. However, similar increases in luciferase activity were found in NRVMs transfected with the AP-1mutated c-jun promoter. It was noticeable that luciferase baseline activities of MEF2-mutated and AP-1mutated plasmids were markedly reduced (
50-fold) compared with the baseline activity seen in NRVMs transfected with the wild-type c-jun promoter.
|
The role of ERK5 on phenylephrine-induced activation of c-jun promoter in NRVMs was assessed by transfecting NRVMs with ERK5-antisense ODNs. As shown in Figure 7B, ERK5 antisense produced an inhibitory effect on phenylephrine-induced activation of the c-jun promoter similar to the MEF2 element mutation, supporting a central role of ERK5 in the agonist-induced activation of c-jun promoter in NRVMs. The effectiveness of ERK5-antisense ODN transfection to reduce ERK5 protein expression and the absence of a deleterious effect of this procedure on NRVMs were demonstrated by immunoblotting and laser confocal analysis with anti-ERK5 antibody (Figures 8A through 8E). As shown in Figure 8A, antisense transfection markedly reduced ERK5 protein expression (
72%), an effect confirmed by immunohistochemical analysis (Figures 8B and 8C). The specificity of this procedure was demonstrated by our data, which indicated that the expression of p38-MAPK and MEF2 were not changed by antisense transfection (Figures 8A, 8D, and 8E).
|
| Discussion |
|---|
|
|
|---|
Transcriptional Regulation of c-jun by MEF2
The early induction of c-jun expression in the myocardium in response to acute mechanical stress is a well-characterized phenomenon.4 In the present study, we first investigated the regulation of c-Jun by characterizing its expression by protein blotting and RT-PCR and its localization in the LV by immunohistochemistry. The analysis of LV sections stained with antic-Jun antibody indicated that myocardial c-Jun is located mostly in cardiac myocytes. In addition, it was shown that the amount of c-Jun in the nuclei of cardiac myocytes increases dramatically in overloaded hearts, indicating a load-induced translocation of c-Jun to the nuclei. RT-PCR and Western blot analysis of the myocardial homogenates indicated that the enhanced expressions of c-Jun protein and mRNA in overloaded hearts are actually biphasic, with an initial peak at 10 minutes and a later peak at 2 hours after the beginning of sustained pressure overload. Because reporter gene assays showed no increase in c-jun promoter activity after 30 minutes of pressure overload, the first peak of c-Jun mRNA and protein expression would be explained by posttranscriptional regulation unless the promoter sequence used in the present study does not contain the appropriate regulatory domains to detect early regulatory function.
The second peak of c-Jun mRNA and protein expression, seen at 2 hours of sustained pressure overload, might represent a more transcriptional regulation of c-jun. The analysis of load-induced transcriptional regulation of c-jun was assessed by transfection of intact hearts with constructions of the c-jun promoter-reporter gene. Wild-type and MEF2 or AP-1 site-mutated constructions were directly injected into intact rat hearts that were then overloaded as a result of aortic constriction. We observed that sustained increases of aortic pressure by 3 hours were paralleled by consistent increases in the wild-type reporter gene activity. Mutation that abolished AP-1 binding did not affect the load-induced increase in reporter gene activity, although it was accompanied by a 3-fold reduction in c-jun promoter basal activity. These results suggest that the AP-1 site is important for basal but not for load-induced c-jun transcription in rat hearts. However, mutation that inhibits binding of MEF2 factors abolished the load-induced increase in reporter gene activity, indicating that the MEF2 site is essential for the load-induced transcriptional activation of c-jun. Experiments performed in NRVMs treated with phenylephrine confirmed the results obtained in in vivo preparations, strengthening the idea that the MEF2 site of the c-jun promoter and presumably MEF2 factors are important regulators of c-jun expression in cardiac myocytes in response to hypertrophic stimuli. In this context, although the present study lacks a direct demonstration that changes in MEF2 protein function interfere with c-jun expression, several studies have shown that procedures that render MEF2 proteins inactive affect c-jun promoter-reporter gene activity to a similar extent as mutation of the MEF2 site. This indicates that the use of c-jun promoter construction containing MEF2 site mutation is a useful tool to assess the regulatory function of MEF2 transcription factors.2224
The contribution of MEF2 factors to the regulatory events that occur early in response to hypertrophic stimuli was not previously explored in cardiac myocytes. The idea that MEF2 proteins regulate transcriptional events in the myocardium that precede the activation of muscle-specific genes during the hypertrophic stimuli was strengthened by our demonstration in the present study that p70MEF2 is expressed at high levels in cardiac myocyte nuclei and that MEF2 is rapidly activated in overloaded hearts, as demonstrated by EMSA. Although our data indicate that MEF2 factors play an important role to the regulation of c-jun expression in response to hypertrophic stimuli, questions such as the relative contribution of specific members of MEF2 family to the regulation of c-jun and the importance of this pathway to the whole process of cardiac hypertrophy remain to be determined.
Upstream Activator of MEF2 in Cardiac Myocytes in Response to Hypertrophic Stimuli
MEF2 can be regulated at transcriptional and translational levels.12 Two other potentially important mechanisms for the regulation of MEF2 activity may lie in the control of their nuclear localization and transcriptional activity, with both probably regulated by reversible phosphorylation of this factor in serine and threonine residues.12 In this context, MAPKs have been shown to phosphorylate and activate MEF2 transcription factors.19,20 In addition, MEF2 activity has been shown to be regulated by dissociation from class II histone deacetylases10,25 as well as through dephosphorylation by calcineurin.10,26 However, the relative importance and the necessity and sufficiency of each of these mechanisms to MEF2 activation in response to hypertrophic stimuli remain to be elucidated.
Although any MAPK could potentially influence MEF2 activity, the available data have restricted this effect to p38 and ERK5.19,20 Moreover, distinct experimental evidence indicates that p38 and ERK5 pathways may regulate cardiac myocyte hypertrophy.27,28 In this context, experimental evidence has indicated that MEF2 proteins are targets of p38 activity during cardiac growth in a transgenic murine model of myocardial hypertrophy.11 However, our present data indicate that pressure overload lasting up to 2 hours is not accompanied by a detectable change in the activity of p38 in the rat myocardium. Thus, these results do not support a role for p38 in the early activation of MEF2 in overloaded myocardium of rats. This agrees with a previous observation indicating that the activation of p38-MAPK rather than initiation of the hypertrophic response may be more important in its maintenance over a longer period of time.29 However, this contrasts to a more recent report showing an early activation of p38 in the rat myocardium after aortic constriction.30 The reason for the discrepancies is not apparent, but differences in the experimental design and stimulus intensity could explain the difference between the results of the present and previous studies. To date, although rats of the present study were subjected to increases in peak systolic pressure of the ascending aorta of
40 mm Hg, systolic gradients of 100 mm Hg were observed in the above-mentioned study of Fischer et al.30 Such pressure stimulus, by inducing greater systolic stress, might trigger additional effects, such as ischemia and inflammatory activation, which are known to be effective activators of p38-MAPK.31
In contrast to p38, our present findings indicate that ERK5 was rapidly activated and migrated to the nuclei of cardiac myocytes of overloaded hearts, as assessed by kinase assays and immunohistochemical analysis, respectively. In addition, we showed that pressure overload induced an ERK5-p70MEF2 association and that load-induced activated ERK5 is able to phosphorylate p70MEF2 in vitro. These phenomena paralleled the increase in MEF2-DNA binding activity, supporting the idea that ERK5 might modulate the activation of p70MEF2 by acute pressure overload in the rat heart. On the other hand, by transfecting NRVMs with ERK5-antisense ODNs, we also demonstrated that ERK5 plays a central role in phenylephrine-induced c-jun promoter upregulation. A further suggestion of the interaction of ERK5-MEF2 in the regulation of c-jun promoter activation is supported by the fact that ERK5 antisense inhibited the phenylephrine-induced c-jun promoter activation to the same extent as MEF2 element mutation.
The mechanisms whereby hypertrophic stimuli induces the activation of ERK5 in vivo remain to be determined, but studies have shown that stimuli such as mechanical stress, ischemia, oxidative stress, interleukins, and growth factors may activate ERK5 in cardiac myocytes.28,32,33 Our present results, which show the c-jun promoter activation by phenylephrine in NRVMs and its abolition by transfection with ERK5-antisense ODNs, suggest that
1-adrenergic receptors may also be involved in ERK5 activation, which is in accord with results from studies that have demonstrated ERK5 activation by G-proteincoupled receptor pathways.28,34
In conclusion, our data indicate that the transcriptional activation of c-jun elicited by mechanical and agonist-induced stimuli in cardiac myocytes involves the activation of MEF2, suggesting that this transcription factor may play a central role to the regulation of early gene expression induced by hypertrophic stimuli. In searching for the upstream regulators, we have also shown data compatible with the notion that ERK5 might be an important mediator of MEF2 and c-jun promoter activation in response to hypertrophic stimuli. Further work will be required to unravel the importance of c-Jun upregulation in the process of myocardial hypertrophy.
| Acknowledgments |
|---|
Received January 24, 2002; revision received November 21, 2002; accepted November 26, 2002.
| References |
|---|
|
|
|---|
2. Komuro I, Yazaki Y. Control of cardiac gene expression by mechanical stress. Annu Rev Physiol. 1993; 55: 5575.[CrossRef][Medline] [Order article via Infotrieve]
3. Sadoshima J, Jahn L, Takahashi T, Kulik TJ, Izumo S. Molecular characterization of the stretch-induced adaptation of cultured cardiac cells: an in vitro model of load-induced cardiac hypertrophy. J Biol Chem. 1992; 267: 1055110560.
4. Schunkert H, Jahn L, Izumo S, Apstein CS, Lorell BH. Localization and regulation of c-fos and c-jun protooncogene induction by systolic wall stress in normal and hypertrophied rat hearts. Proc Natl Acad Sci U S A. 1991; 88: 1148011484.
5. Han TH, Lamph WW, Prywes R. Mapping of epidermal growth factor-, serum-, and phorbol ester-responsive sequence elements in the c-jun promoter. Mol Cell Biol. 1992; 12: 44724477.
6. Angel P, Hattori K, Smeal T, Karin M. The jun proto-oncogene is positively autoregulated by its product, Jun/AP-1. Cell. 1988; 55: 875885.[CrossRef][Medline] [Order article via Infotrieve]
7. Coso OA, Montaner S, Fromm C, Lacal JC, Prywes R, Teramoto H, Gutkind JS. Signaling from G protein-coupled receptors to the c-jun promoter involves the MEF2 transcription factor: evidence for a novel c-jun amino-terminal kinase-independent pathway. J Biol Chem. 1997; 272: 2069120697.
8. Han J, Jiang Y, Li Z, Kravchenko VV, Ulevitch RJ. Activation of the transcription factor MEF2C by the MAP kinase p38 in inflammation. Nature. 1997; 386: 296299.[CrossRef][Medline] [Order article via Infotrieve]
9. Molkentin JD, Markham BE. Myocyte-specific enhancer-binding factor (MEF-2) regulates
-cardiac myosin heavy chain gene expression in vitro and in vivo. J Biol Chem. 1993; 268: 1951219520.
10. Passier R, Zeng H, Frey N, Naya FJ, Nicol RL, McKinsey TA, Overbeek P, Richardson JA, Grant SR, Olson EN. CaM kinase signaling induces cardiac hypertrophy and activates the MEF2 transcription factor in vivo. J Clin Invest. 2000; 105: 13951406.[Medline] [Order article via Infotrieve]
11. Kolodziejczyk SM, Wang L, Balazsi K, DeRepentigny Y, Kothary R, Megeney LA. MEF2 is upregulated during cardiac hypertrophy and is required for normal post-natal growth of the myocardium. Curr Biol. 1999; 9: 12031206.[CrossRef][Medline] [Order article via Infotrieve]
12. Black BL, Olson EN. Transcriptional control of muscle development by myocyte enhancer factor-2 (MEF2) proteins. Annu Rev Cell Dev Biol. 1998; 14: 167196.[CrossRef][Medline] [Order article via Infotrieve]
13. Glennon PE, Kaddoura S, Sale EM, Sale GJ, Fuller SJ, Sugden PH. Depletion of mitogen-activated protein kinase using an antisense oligodeoxynucleotide approach downregulates the phenylephrine-induced hypertrophic response in rat cardiac myocytes. Circ Res. 1996; 78: 954961.
14. Abe J, Takahashi M, Ishida M, Lee JD, Berk BC. c-Src is required for oxidative stress-mediated activation of big mitogen-activated protein kinase 1. J Biol Chem. 1997; 272: 2038920394.
15. Domingos PP, Fonseca PM, Nadruz W Jr, Franchini KG. Load-induced focal-adhesion kinase activation in the myocardium: role of stretch and contractile activity. Am J Physiol. 2002; 281: H556H564.
16. Ferreri NR, An S-J, McGiff JC. Cyclooxygenase-2 expression and function in the medullary thick ascending limb. Am J Physiol. 1999; 277: F360F368.[Medline] [Order article via Infotrieve]
17. Thai MV, Guruswamy S, Cao KT, Pessin JE, Olson AL. Myocyte enhancer factor 2 (MEF2)-binding site is required for GLUT4 gene expression in transgenic mice: regulation of MEF2 DNA binding activity in insulin-deficient diabetes. J Biol Chem. 1998; 273: 1428514292.
18. Clarke N, Arenzana N, Hai T, Minden A, Prywes R. Epidermal growth factor induction of the c-jun promoter by a Rac pathway. Mol Cell Biol. 1998; 18: 10651073.
19. Marinissen MJ, Chiariello M, Pallante M, Gutkind JS. A network of mitogen-activated protein kinases links G protein-coupled receptors to the c-jun promoter: a role for c-Jun NH2-terminal kinase, p38s, and extracellular signal-regulated kinase 5. Mol Cell Biol. 1999; 19: 42894301.
20. Han J, Molkentin JD. Regulation of MEF2 by p38 MAPK and its implication in cardiomyocyte biology. Trends Cardiovasc Med. 2000; 10: 1922.[CrossRef][Medline] [Order article via Infotrieve]
21. Yamazaki T, Komuro I, Yazaki Y. Signaling pathways for cardiac hypertrophy. Cell Signal. 1998; 10: 693698.[CrossRef][Medline] [Order article via Infotrieve]
22. Han TH, Prywes R. Regulatory role of MEF2D in serum induction of the c-jun promoter. Mol Cell Biol. 1995; 15: 29072915.[Abstract]
23. Kato Y, Zhao M, Morikawa A, Sugiyama T, Chakravortty D, Koide N, Yoshida T, Tapping RI, Yang Y, Yokochi T, Lee JD. Big mitogen-activated kinase regulates multiple members of the MEF2 protein family. J Biol Chem. 2000; 275: 1853418540.
24. Suzuki E, Nishimatsu H, Satonaka H, Walsh K, Goto A, Omata M, Fujita T, Nagai R, Hirata Y. Angiotensin II induces myocyte enhancer factor 2- and calcineurin/nuclear factor of activated T celldependent transcriptional activation in vascular myocytes. Circ Res. 2002; 90: 10041011.
25. Lu J, McKinsey TA, Zhang CL, Olson EN. Regulation of skeletal myogenesis by association of the MEF2 transcription factor with class II histone deacetylases. Mol Cell. 2000; 6: 233244.[CrossRef][Medline] [Order article via Infotrieve]
26. Wu H, Naya FJ, McKinsey TA, Mercer B, Shelton JM, Chin ER, Simard AR, Michel RN, Bassel-Duby R, Olson EN, Williams ES. MEF2 responds to multiple calcium-regulated signals in the control of skeletal muscle fiber type. EMBO J. 2000; 19: 19631973.[CrossRef][Medline] [Order article via Infotrieve]
27. Wang Y, Huang S, Sah VP, Ross J Jr, Brown JH, Han J, Chien KR. Cardiac muscle cell hypertrophy and apoptosis induced by distinct members of the p38 mitogen-activated protein kinase family. J Biol Chem. 1998; 273: 21612168.
28. Nicol RL, Frey N, Pearson G, Cobb M, Richardson J, Olson EN. Activated MEK5 induces serial assembly of sarcomeres and eccentric cardiac hypertrophy. EMBO J. 2001; 20: 27572767.[CrossRef][Medline] [Order article via Infotrieve]
29. Sugden PH, Clerk A. "Stress-responsive" mitogen-activated protein kinases (c-jun N-terminal kinases and p38 mitogen-activated protein kinases) in the myocardium. Circ Res. 1998; 83: 345352.
30. Fischer TA, Ludwig S, Flory E, Gambaryan S, Singh K, Finn P, Pfeffer MA, Kelly RA, Pfeffer JM. Activation of cardiac c-Jun NH2-terminal kinases and p38-mitogen-activated protein kinases with abrupt changes in hemodynamic load. Hypertension. 2001; 37: 12221228.
31. Bogoyevitch MA, Gillespie-Brown J, Ketterman AJ, Fuller SJ, Ben-Levy R, Ashworth A, Marshall CJ, Sugden PH. Stimulation of the stress-activated mitogen-activated protein kinase subfamilies in perfused heart: p38/RK mitogen-activated protein kinases and c-Jun N-terminal kinases are activated by ischemia/reperfusion. Circ Res. 1996; 79: 162173.
32. Takeishi Y, Abe J, Lee JD, Kawakatsu H, Walsh RA, Berk BC. Differential regulation of p90 ribosomal S6 kinase and big mitogen-activated protein kinase 1 by ischemia/reperfusion and oxidative stress in perfused guinea pig hearts. Circ Res. 1999; 85: 11641172.
33. Takeishi Y, Huang Q, Abe J, Glassman M, Che W, Lee JD, Kawakatsu H, Lawrence EG, Hoit BD, Berk BC, Walsh RA. Src and multiple MAP kinase activation in cardiac hypertrophy and congestive heart failure under chronic pressure-overload: comparison with acute mechanical stretch. J Mol Cell Cardiol. 2001; 33: 16371648.[CrossRef][Medline] [Order article via Infotrieve]
34. Marinissen MJ, Gutkind JS. G-protein-coupled receptors and signaling networks: emerging paradigms. Trends Pharmacol Sci. 2001; 22: 368376.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
E. Mukwevho, T. A. Kohn, D. Lang, E. Nyatia, J. Smith, and E. O. Ojuka Caffeine induces hyperacetylation of histones at the MEF2 site on the Glut4 promoter and increases MEF2A binding to the site via a CaMK-dependent mechanism Am J Physiol Endocrinol Metab, March 1, 2008; 294(3): E582 - E588. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vahebi, A. Ota, M. Li, C. M. Warren, P. P. de Tombe, Y. Wang, and R. J. Solaro p38-MAPK Induced Dephosphorylation of {alpha}-Tropomyosin Is Associated With Depression of Myocardial Sarcomeric Tension and ATPase Activity Circ. Res., February 16, 2007; 100(3): 408 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Spruill and P. J. McDermott Regulation of c-jun mRNA expression in adult cardiocytes by MAP kinase interacting kinase-1 (MNK1) FASEB J, October 1, 2006; 20(12): 2133 - 2135. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. R. Carvalho, R. A. Bassani, K. G. Franchini, and J. W. M. Bassani Enhanced calcium mobilization in rat ventricular myocytes during the onset of pressure overload-induced hypertrophy Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1803 - H1813. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Ceylan-Isik, K. H. LaCour, and J. Ren Sex difference in cardiomyocyte function in normal and metallothionein transgenic mice: the effect of diabetes mellitus J Appl Physiol, May 1, 2006; 100(5): 1638 - 1646. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Nadruz Jr., M. A.F. Corat, T. M. Marin, G. A. Guimaraes Pereira, and K. G. Franchini Focal adhesion kinase mediates MEF2 and c-Jun activation by stretch: Role in the activation of the cardiac hypertrophic genetic program Cardiovasc Res, October 1, 2005; 68(1): 87 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Torsoni, T. M. Marin, L. A. Velloso, and K. G. Franchini RhoA/ROCK signaling is critical to FAK activation by cyclic stretch in cardiac myocytes Am J Physiol Heart Circ Physiol, October 1, 2005; 289(4): H1488 - H1496. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Nadruz Jr, V. J. Lagosta, H. Moreno Jr, O. R. Coelho, and K. G. Franchini Simvastatin Prevents Load-Induced Protein Tyrosine Nitration in Overloaded Hearts Hypertension, May 1, 2004; 43(5): 1060 - 1066. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Nadruz Jr., C. B. Kobarg, J. Kobarg, and K. G. Franchini c-Jun is regulated by combination of enhanced expression and phosphorylation in acute-overloaded rat heart Am J Physiol Heart Circ Physiol, February 1, 2004; 286(2): H760 - H767. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Fosslien Mitochondrial Medicine - Cardiomyopathy Caused by Defective Oxidative Phosphorylation Ann. Clin. Lab. Sci., October 1, 2003; 33(4): 371 - 395. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. N. Olson and M. D. Schneider Sizing up the heart: development redux in disease Genes & Dev., August 15, 2003; 17(16): 1937 - 1956. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2003 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |