Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2002;91:525-531
Published online before print August 22, 2002, doi: 10.1161/01.RES.0000034710.46739.C0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
91/6/525    most recent
01.RES.0000034710.46739.C0v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Westfall, M. V.
Right arrow Articles by Metzger, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Westfall, M. V.
Right arrow Articles by Metzger, J. M.
Related Collections
Right arrow Contractile function
Right arrow Pathophysiology
Right arrow Myocardial cardiomyopathy disease
(Circulation Research. 2002;91:525.)
© 2002 American Heart Association, Inc.


Cellular Biology

Myofilament Calcium Sensitivity and Cardiac Disease

Insights From Troponin I Isoforms and Mutants

Margaret V. Westfall, Andrea R. Borton, Faris P. Albayya, Joseph M. Metzger

From the Departments of Surgery (M.V.W., A.R.B.) and Physiology (M.V.W., A.R.B., F.P.A., J.M.M.), School of Medicine, University of Michigan, Ann Arbor, Mich.

Correspondence to Margaret V. Westfall, Dept of Surgery/Cardiac Surgery Section, University of Michigan, 1150 W Medical Center Dr, B560 MSRB II, Ann Arbor, MI 48109-0686. E-mail wfall{at}w.imap.itd.umich.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The heightened Ca2+ sensitivity of force found with hypertrophic cardiomyopathy (HCM)–associated mutant cardiac troponin I (cTnIR145G; R146G in rodents) has been postulated to be an underlying cause of hypertrophic growth and premature sudden death in humans and in animal models of the disease. Expression of slow skeletal TnI (ssTnI), a TnI isoform naturally expressed in developing heart, also increases myofilament Ca2+ sensitivity, yet its expression in transgenic mouse hearts is not associated with overt cardiac disease. Gene transfer of TnI isoforms or mutants into adult cardiac myocytes is used here to ascertain if expression levels or functional differences between HCM TnI and ssTnI could help explain these divergent organ-level effects. Results showed significantly reduced myofilament incorporation of cTnIR146G compared with ssTnI or wild-type cTnI. Despite differences in myofilament incorporation, ssTnI and cTnIR146G expression each resulted in enhanced myofilament tension in response to submaximal Ca2+ under physiological ionic conditions. Myofilament expression of an analogous HCM mutation in ssTnI (ssTnIR115G) did not further increase myofilament Ca2+ sensitivity of tension compared with ssTnI. In contrast, there was a divergent response under acidic pH conditions, a condition associated with the myocardial ischemia that often accompanies hypertrophic cardiomyopathy. The acidic pH-induced decrease in myofilament Ca2+ sensitivity was significantly greater in myocytes expressing cTnIR146G and ssTnIR115G compared with ssTnI. These results suggest that differences in pH sensitivities between wild-type ssTnI and mutant TnI proteins may be one factor in helping explain the divergent organ and organismal outcomes in TnI HCM- and ssTnI-expressing mice.


Key Words: troponin I • myofilament proteins • hypertrophic cardiomyopathy • heart


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Familial hypertrophic cardiomyopathy (HCM) is an autosomal dominant disorder resulting from diverse mutations within thick and thin filament contractile proteins.1,2 Mutations within individual contractile proteins have been shown to cause primary alterations in myofilament Ca2+ sensitivity of force production in myocytes and in the hearts from animal models expressing these mutations.3 These changes in myofilament Ca2+ sensitivity are postulated to be important for development of the clinical and pathological manifestations of HCM.2 However, the mechanism whereby a primary change in myofilament Ca2+ sensitivity leads to the compensatory or dysfunctional structure/function responses observed in the human disease state is not well understood.

The thin filament regulatory protein troponin I (TnI) is known to directly influence the myofilament’s response to Ca2+ activation.4 The human cTnIR145G mutation,5 and the analogous cTnIR146G mutation in transgenic mouse hearts,6 increases myocardial Ca2+ sensitivity of tension. In transgenic mice, expression of cTnIR146G causes myocyte hypertrophy, myofibrillar disarray, fibrosis, and premature death, outcomes attributed to the cTnIR146G.6 For comparison, the slow skeletal troponin I (ssTnI) isoform, normally expressed only during early cardiac development,7,8 also increases myofilament Ca2+ sensitivity of tension,4 yet ssTnI transgenic mice have apparent normal cardiac morphology and life span.9 These findings suggest that other factors, together with heightened Ca2+ sensitivity, must be associated with the cTnIR146G mutation to cause these divergent organ-level outcomes between ssTnI and R146G transgenic mice.

In the present study, Ca2+-activated tension under physiological ionic conditions is measured in adult myocytes expressing ssTnI or cTnIR146G, for comparison to results previously reported in papillary muscles from transgenic mice.6 In addition, cTnIR146G expression levels in transgenic mice lacking detectable pathology do show evidence of myocardial hypoxia/ischemia.6 This appears significant, because myocardial ischemia has been documented in asymptomatic patients with HCM.10 Given that hypoxia/ischemia-mediated cellular acidosis is known to directly depress myocardial contractile function,1113 we tested the hypothesis that under acidic pH conditions, ssTnI and cTnIR146G would have divergent effects on adult cardiac myocyte contractile function. To test this hypothesis, the influence of acidic conditions on myofilament tension is compared in adult ventricular myocytes expressing cTnI, ssTnI, mutant cTnI, or mutant ssTnI after gene transfer. Our results provide evidence that the apparent paradox of heightened Ca2+ sensitivity in myofilaments with mutant TnI or wild-type ssTnI is at least in part explained by the differential pH-dependent change in tension observed in myofilaments expressing mutant TnI proteins compared with wild-type ssTnI.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mutagenesis Strategy and Generation of Adenoviral Vectors
The rat cTnIR146G and rat ssTnIR115G mutants (Figure 1A) were constructed using a pGEM3Z vector containing cTnI and ssTnI cDNAs (kind gifts of A. Murphy, MD, Johns Hopkins University, Baltimore, Md), respectively. The Stratagene Quik Change site-directed mutagenesis kit14 was used to mutagenize pGEM-3ZcTnI and pGEM-3ZssTnI with oligonucleotide primers (cTnI primer 1: CGGCCCACTCTCGGCCGAGTGAGAATCTCAGCAG; cTnI primer 2: CTGCTGAGATTCTCACTCGGCCGAGAGTGGGCCG; ssTnI primer 1: CGTCCACCCCTCGGCCGGGTCCGTGTCTC; primer 2: GAGACACGGACC-CGGCCGAGGGGTGGACG). A FLAG epitope (DYKDDDDK; Sigma) was engineered into the carboxyl-terminus of cTnI cDNA by PCR mutagenesis, as described by Michele et al.15 The 187-bp BanII fragment of cTnIFLAG containing the FLAG epitope was ligated to a 594-bp COOH fragment of cTnIR146G, to form cTnIR146GFLAG. Sequenced mutant TnI cDNA was subcloned into a shuttle vector16 to form pAdcTnIR146G, pAdssTnIR115G, pAdcTnIFLAG, and pAdcTnIR146GFLAG.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 1. Location of R146G mutation within rat cTnI protein and analysis of cTnIR146G expression in adult rat cardiac myocytes. A, Schematic diagram showing the location and sequence surrounding the R146G mutation within the highly conserved inhibitory peptide (IP) region of the cardiac (cTnI) and slow skeletal (ssTnI) troponin I isoforms. Hatched region represents the isoform-specific 32 amino acid extension found in cTnI, but not ssTnI. B, Representative Western blot demonstrating cTnI (control), cTnIFLAG (FLAG), cTnIR146GFLAG (R146GFLAG), and cTnIR146G (R146G) expression over time at 500 and 1000 MOI (multiplicity of infection) in adult cardiac myocytes 5 and 6 days after gene transfer. Samples in odd numbered lanes (ie, 1, 3, 5, 7, 9, 11, and 13) were collected on day 5, whereas samples in evenly numbered lanes (ie, 2, 4, 6, 8, 10, 12, and 14) were collected on day 6. Samples in lanes 1, 2, 5, 6, 11, and 12 received 500 MOI of virus, whereas myocyte samples shown in lanes 3, 4, 7, 8, 13, and 14 received 1000 MOI of indicated virus. Western blots were analyzed by incubating blots with MAB 1691 (1:500), a monoclonal Ab recognizing all TnI isoforms, including cTnIFLAG and cTnIR146GFLAG. Significantly lower expression of cTnIR146GFLAG, relative to cTnIFLAG, was detected at 500 and 1000 MOI for both days 5 and 6 after gene transfer. Total TnI content remained unchanged in myocytes expressing cTnIR146G compared with endogenous cTnI, although this mutant protein could not be distinguished from endogenous cTnI on Western blots (see online data supplement). C, Representative Western blot analysis of cTnI, cTnIFLAG, and cTnIR146G expression in intact vs membrane-permeabilized myocytes 6 days after gene transfer. MAB 1691 mAb (1:500) was used to detect TnI expression. Proportion of cTnIFLAG or cTnIR146G expression relative to endogenous cTnI is not significantly affected by permeabilization of membranes. These results provide indirect evidence that neither mutant contractile protein detectably accumulates within the cytosol.

Recombinant replication-deficient adenovirus vectors were constructed by cotransfection of the shuttle vector containing the cDNA of interest with pJM17 in HEK 293 cells.4 Large preparations of each plaque-purified virus were separated on a CsCl2 gradient, stored in 10% glycerol at -80°C, and verified by Southern blot analysis. Titers obtained for each virus were on the order of 1x1010 plaque-forming units/mL.

Primary Cultures of Rat Ventricular Myocytes
Calcium-tolerant adult ventricular myocytes were isolated as described earlier.17 Details of the isolation procedure and viral incubations can be found in the expanded Materials and Methods section in the online data supplement available at http://www.circresaha.org.

Analysis of Protein Expression
Control and virus-treated cardiac myocytes cultured for 4 to 6 days were collected from each coverslip in sample buffer. Permeabilized myocytes were prepared by adding ice-cold relaxing solution (pH 7.0; see below) containing 0.1% Triton X-100 (TX-100) to myocytes for 1 minute, rinsing cells in relaxing solution lacking TX-100, and then collecting in sample buffer. Protein expression in intact and permeabilized myocytes was analyzed by Western blotting, as described by Westfall et al18 using a 1:500 dilution of MAB 1691 (Chemicon), a monoclonal antibody recognizing all isoforms of TnI. Control and virus-treated HEK 293 cells, which lack endogenous cTnI, also were collected 48 hours after gene transfer. Identical viral doses of cTnIR146G or cTnIR146GFLAG resulted in comparable tagged and untagged cTnIR146G mutant expression (results not shown), suggesting equivalent gene transfer and protein stability for tagged and untagged mutant TnI proteins.

Indirect Immunodetection of Mutant TnI Expression and Myofilament Incorporation
Dual mAbs17,18 were used to determine the extent of thin filament remodeling resulting from mutant TnI expression within single cardiac myocytes in primary culture. To detect cTnIFLAG expression, the primary mAbs pairs used were the M2 anti-FLAG mAb (Sigma; 1:500) and MAB 1691 anti-TnI mAb (Chemicon; 1:500). Total replacement of cTnI with ssTnIR115G in myocytes was followed using the MAB 1691 and cTnI-specific TI-1 mAb,18 which does not recognize ssTnI. FLAG mAb and TI-1 mAb binding were each detected with a Texas Red–conjugated secondary goat anti-mouse Ab, whereas fluorescein isothiocyanate–conjugated goat anti-mouse Ab was used to detect MAB1691 binding. High-resolution images were obtained with a Noran OZ laser scanning confocal microscope (Morphology and Image Analysis Core at the Michigan Diabetes Research and Training Center).

Measurement of Steady-State, Ca2+-Activated Tension in Single Cardiac Myocytes at pH 7.0 and 6.2
Single rod-shaped cardiac myocytes, attached to micropipettes coated with silicone adhesive, were permeabilized in 0.2% Triton X-100 for 1 minute. Sarcomere length was set at 2.20 µm19 and all tension measurements were performed at 15°C. Relaxing and activating solutions (pH 7.0 and pH 6.2) used for tension measurements contained 1 mmol/L free Mg2+, 4 mmol/L MgATP, 14.5 mmol/L creatine phosphate, 20 mmol/L imidazole, and sufficient KCl to yield an ionic strength of 180 mmol/L, as determined from the computer program by A. Fabiato.20 The pCa (-log[Ca2+]) of relaxing solution was 9.0, whereas the pCa of maximal activation solution was 4.0. Steady-state, Ca2+-activated isometric tension was measured at each pCa, as previously described in detail.19 Tension-pCa relationships were constructed by expressing tension (P) at various submaximal Ca2+ concentrations as a fraction of tension at maximal activation (Po, pCa 4.0). Every third activation was performed at pCa 4.0 to bracket submaximal Ca2+ activations for normalization of tension. The Marquardt-Levenberg nonlinear least squares fitting algorithm was used to derive values for the Hill coefficient (nH) and Ca2+ required for half maximal activation (pCa50) from the tension/pCa relationship, using the Hill equation (P=[Ca2+]n/(Kn+[Ca2+]n), where P is the fraction of maximum tension (Po), the pCa50 is used as an indicator of K, and nH is the Hill coefficient.

Statistics
Values are expressed as mean±SEM. Grouped comparisons were performed using an analysis of variance and post hoc Student-Newman-Keuls multiple comparison test, with a value of P<0.05 considered significantly different.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Expression and Myofilament Incorporation of cTnIR146G
The extent of expression and myofilament incorporation of cTnIR145G in human myocardium5 and/or cTnIR146G in transgenic mice6 is not known. Expression of cTnIR146G in adult rat myocytes also could not be distinguished from endogenous cTnI by Western blot analysis (Figure 1B). Information about the degree of contractile protein expression and incorporation into the sarcomere is critical for subsequently establishing the specific effects of a particular isoform and/or mutation on the mechanical properties of myocytes. Thus, experiments initially focused on expression and myofilament incorporation of cTnIFLAG and cTnIR146GFLAG in adult rat cardiac myocytes, to distinguish the epitope-tagged TnI proteins from endogenous cTnI (Figure 1B). Expression of mutant cTnIR146GFLAG differed significantly from cTnIFLAG in adult cardiac myocytes over time. The progressive, stoichiometric replacement of endogenous cTnI with cTnIFLAG reached 85±7% of total TnI (n=9) by 6 days after gene delivery, a value comparable to ssTnI replacement after gene transfer.14 In contrast, significantly less replacement was observed with cTnIR146GFLAG after 6 days (43±6%, n=18; P<0.001 versus cTnIFLAG; Figure 1B). Attempts to increase expression with higher virus doses did not significantly change cTnIR146GFLAG replacement of cTnI (1000 MOI, day 6=48±4% total TnI, n=5; Figure 1B). These results suggest the capacity of myocytes to express and incorporate cTnIR146GFLAG into the sarcomere is significantly impaired compared with cTnIFLAG. As a result, we speculate that the cTnIR145G allele likely contributes to less than half of total TnI in the myofilaments of adult human myocytes.

The newly expressed TnI proteins did not accumulate within the cytosol (Figure 1C), based on Western analysis of intact and membrane-permeabilized myocytes expressing cTnIFLAG (permeabilized myocytes: 84±9% of total TnI, n=4) or cTnIR146GFLAG (permeabilized myocytes: 49±9% of total TnI, n=6; see Figure 1C). Total TnI content and the stoichiometry of TnI expression relative to troponin T, tropomyosin, and a silver-stained portion of the gel also remained unchanged 5 to 6 days after gene transfer of cTnIR146G, cTnIFLAG, or cTnIR146GFLAG compared with control values (see online Table, available in the data supplement at http://www.circresaha.org). Maintenance of contractile protein stoichiometry and isoform expression, and the lack of cytosolic accumulation, together support the idea that each delivered mutant is specifically incorporated into the contractile apparatus by stoichiometric replacement of endogenous cTnI.

Immunolabeling experiments were carried out to directly analyze myofilament incorporation of mutant and wild-type TnI proteins in adult myocytes. A striated pattern of immunostaining was observed in controls (Figure 2A) and myocytes expressing cTnIFLAG or cTnIR146GFLAG (Figures 2C and 2E), using a mAb recognizing all isoforms of TnI. A striated immunolabeling profile was also observed with M2 anti-FLAG mAb in myocytes expressing cTnIFLAG and cTnIR146GFLAG (Figures 2D and 2F), but not control myocytes (Figure 2B). The consistent striated labeling pattern observed across the length and depth of myocytes expressing cTnIFLAG and cTnIR146GFLAG, and the absence of cytosolic accumulation of epitope-tagged protein further indicates there is specific incorporation of each mutant TnI protein into the myofilaments.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 2. Representative confocal projection images of myocytes immunolabeled with anti-TnI mAb and anti-FLAG mAb. Indirect immunofluorescence images are shown for control myocytes (A and B), myocytes treated with AdcTnIFLAG (C and D), and AdcTnIR146GFLAG (E and F). Myocytes were maintained in culture for 5 to 6 days for subsequent imaging. Immunolabeling in the left panels (ie, A, C, and E) was performed using anti-TnI mAb, MAB 1691 (1:1000), which recognizes all isoforms of TnI and subsequently detected with goat anti-mouse antibody conjugated to fluorescein isothiocyanate (FITC; 1:200). Striated pattern of immunolabeling observed throughout the length and breadth of each cell in each left-hand panel indicates that endogenous cTnI and the exogenous TnI are incorporated into the myofilaments of the adult myocytes. Immunolabeling in right-hand panels was carried out using anti-FLAG M2 mAb (1:1000; B, D, and F), along with a secondary Ab conjugated to Texas Red (TR; 1:100). Striated pattern of labeling is demonstrated in the inset for each image showing positive immunostaining. Bar=25 µm, with inset images showing {approx}12 µm of each cell.

TnI Competition Assay
The differences in cTnIR146GFLAG replacement of cTnI compared with ssTnI4,14 and cTnIFLAG (Figure 1B) raised the possibility that cTnIR146G may not compete with equal effectiveness for sites within the myofilament. Cardiac myocytes exquisitely regulate total contractile protein.21 One potential therapeutic strategy for HCM mutations may be to competitively replace the human cTnIR145G mutation in the cardiac sarcomere via expression of wild-type cTnI. To test this idea in vitro, competition experiments were performed to determine whether vector-mediated cTnI expression could effectively out-compete cTnIR146G expression/incorporation at the level of the sarcomere (Figure 3). Adult myocytes were cotransduced with a range of AdcTnIFLAG doses, along with cTnI or cTnIR146G at a fixed titer. Western blot analysis indicated that cTnIFLAG expression is far lower in cTnI- compared with cTnIR146G-expressing myocytes. Thus, normal cTnI appears to have an advantage over mutant TnI for expression at the level of the sarcomere, over a broad range of transcriptional activation.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Representative Western blot analysis of competitive expression between cTnI and cTnIFLAG, or cTnIR146G and cTnIFLAG in adult cardiac myocytes. Myocytes were transduced with cTnI (500 MOI) or cTnIR146G (500 MOI), plus 0, 50, 100, 200, or 500 MOI of AdcTnIFLAG. Myocytes were collected 6 days after gene transfer and analyzed by Western blot analysis. Control and soleus samples are shown to demonstrate cTnI and ssTnI expression, respectively. *Myocytes transduced only with cTnIFLAG (500 MOI).

Myofilament Ca2+-Activated Tension in Myocytes Expressing cTnIR146G and ssTnI
The functional relationship between Ca2+ and steady state isometric tension was directly assessed in single, permeabilized myocytes after TnI gene transfer. The position of the tension-pCa curve (pH 7.0), as measured by the pCa50, was comparable in control and AdcTnI-treated myocytes (Figure 4A). In contrast, the cTnIR146G mutation significantly increased pCa50 relative to control values, in agreement with earlier work in transgenic mouse myocardium.6 Replacement of cTnI with ssTnI also increased myofilament Ca2+ sensitivity, as demonstrated previously,4 and this increase was similar in magnitude to the increase observed with cTnIR146G (Figure 4A). Thus, under normal physiological activating conditions, cTnIR146G and ssTnI each cause heightened myofilament Ca2+ sensitivity.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 4. Summary of pCa50 comparisons at pH 7.0 and 6.2 in myocytes expressing TnI proteins. A, pCa50 results at pH 7.0 for control, cTnI-, or cTnIR146G-expressing myocytes 5 to 6 days after gene transfer. B, pCa50 results at pH 6.20 for control myocytes and myocytes expressing cTnI, cTnIR146G, or ssTnI 5 to 6 days after gene transfer (n=5 to 10). pCa50 significantly decreased in each group of myocytes, but decreased to a significantly lesser extent in myocytes expressing ssTnI compared with cTnI or cTnIR146G. pCa50 results were compared at each pH using a 1-way ANOVA followed by a post hoc Newman-Keuls test, with P<0.05 considered significantly different from control (*) or cTnI (+). Maximum tension decreased markedly at pH 6.2 for each group of myocytes (results not shown), in agreement with earlier findings from cTnI- and ssTnI-expressing myocytes.14 C, Comparison of pCa50 results in ssTnI vs cTnIR146G-expressing myocytes at pH 7.0 and pH 6.2. Results were compared by subtracting the average pCa50 for myocytes expressing ssTnI from pCa50 values obtained for myocytes expressing cTnIR146G. Statistical analysis was performed using a 1-way ANOVA and a post hoc Newman-Keuls test; *P<0.05 considered significantly different from the zero baseline. In B, P<0.05 considered significantly different from all other groups.

Myocardial ischemia-mediated acidosis has been observed in patients with HCM.22,23 Evidence of ischemia has been detected in asymptomatic patients10 and transgenic mice.6 However, the effect of intracellular acidification on the contractile responses of myocytes expressing cTnIR146G is unknown. Thus, the tension-pCa relationship under acidic conditions (pH 6.2) was determined in myocytes expressing ssTnI, cTnI, and cTnIR146G (Figure 4B). Myocytes expressing cTnI and cTnIR146G responded to acidic pH with a large decrease in the pCa50, whereas the pH response was markedly blunted in myocytes expressing ssTnI (Figure 4B). We propose this difference in myofilament pH sensitivity between myocytes expressing cTnIR146G and ssTnI (Figure 4C) has important implications for the cardiac response to ischemia in patients carrying the HCM mutation (see Discussion).

Replacement of Endogenous cTnI With ssTnI Containing the Mutation Analogous to cTnIR146G
Acidosis decreases force generation in myocytes expressing normal and mutant cTnI. Thus, a mutant ssTnI, ssTnIR115G, was generated to determine whether the mutation itself alters myofilament pH sensitivity. Before functional studies, mutant ssTnI expression and incorporation were examined. In contrast to epitope-tagged cTnIR146G, comparable expression of ssTnI and ssTnIR115G was observed in adult myocytes (Figure 5A). Total TnI was unchanged in myocytes expressing ssTnI or ssTnIR115G, relative to a silver-stained portion of the gel, TnT, or Tm detection on Western blots (see online Table). Wild-type ssTnI and ssTnIR115G also were expressed to comparable levels in intact and membrane-permeabilized myocytes (Figure 5A). In immunolabeling experiments, cTnI-specific mAb labeling disappeared with ssTnI or ssTnIR115G expression (Figure 5B, right panel), whereas positive labeling continued to be present using a nonisoform-specific anti-TnI mAb (Figure 5B, left panel). These results indicate that, in contrast to cTnIR146G, ssTnIR115G and wild-type ssTnI each replace endogenous myofilament cTnI with similar efficiency.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. Expression, myofilament incorporation, and function in myocytes expressing ssTnI compared with ssTnIR115G. A, Representative Western blot analysis of ssTnI and ssTnIR115G expression in intact and membrane permeabilized myocytes 6 days after gene transfer. MAB 1691 mAb (1:500) was used to detect TnI expression. Overall expression of ssTnI (92±3% of total TnI; n=12) and ssTnIR115G (84±6% of total TnI; n=12) and replacement of endogenous cTnI was not different in intact myocytes. Proportion of exogenous TnI (eg, cTnI, ssTnIR115G) relative to endogenous cTnI also is not significantly affected by permeabilization of membranes (% of Total TnI: ssTnIintact 91±3%, n=10; ssTnIperm 94±2%, n=10; P>0.05; ssTnIR115Gintact 84±5%, n=8; ssTnIR115Gperm 84±5%, n=8; P>0.05), an indication that exogenous contractile protein does not detectably accumulate within the cytosol. B, Representative confocal projection images of myocytes expressing cTnI (top) and ssTnIR115G (bottom). Left panels, Labeling with MAB 1691, a mAb recognizing all isoforms of TnI, and detected with secondary Ab conjugated to FITC; Right panels, Labeled with a cTnI-specific mAb (TI-1; kind gift of S. Schiaffino, MD, University of Padova, Padova, Italy) and a secondary Ab conjugated to Texas Red. A striated pattern of labeling is present (see inset) in both sets of myocytes labeled with the MAB 1691 Ab, which indicates TnI is localized within the myofilaments. In contrast, cTnI expression detected with TI-1 mAb is present in myocytes expressing cTnI but is lacking in myocytes expressing ssTnIR115G. Lack of cTnI immunolabeling in myocytes expressing ssTnIR115G provides strong evidence that nascent TnI protein is replacing endogenous cTnI. Bar=25 µm, with inset images showing {approx}12 µm of each cell. C, Comparison of difference in pCa50 values between myocytes expressing ssTnI vs ssTnIR115G at pH 7.0 and pH 6.2. pCa50 in myocytes from both groups responded similarly to pH 7.0, whereas the pCa50 decreased significantly more at pH 6.2 in myocytes expressing ssTnIR115G vs ssTnI (*P<0.05).

Ca2+-Activated Tension in Myocytes Expressing ssTnIR115G
Functional studies on permeabilized myocytes were performed to determine whether ssTnIR115G would influence Ca2+-activated tension relative to ssTnI or cTnIR146G. Expression of cTnIR146G, ssTnI, or ssTnIR115G increased the pCa50 to a similar extent (pCa50: ssTnI 6.13±0.08, n=5; ssTnIR115G 6.06±0.04, n=8; cTnIR146G 6.15±0.06, n=10). This result indicates ssTnIR115G does not additively increase the myofilament Ca2+ sensitivity produced with ssTnI alone, and likely works through a common mechanism. Unexpectedly, the normal "protective" effect of ssTnI on myofilament Ca2+ sensitivity at acidic pH was attenuated in myocytes expressing ssTnIR115G (Figure 5C; pCa50 at pH 6.20=5.15+0.09, n=6) and was more similar to cTnIR146G (Figure 4B). Thus, regardless of TnI isoform, the HCM-linked mutation greatly diminishes submaximal tension in response to acidic pH. The slope of the tension-pCa relationship measured from the Hill coefficient (nH) also was comparable in control, cTnIR146G-, and ssTnIR115G-expressing myocytes (nH: Control 2.53±0.32, n=8; cTnI 2.41±0.27, n=7; cTnIR146G 2.24±0.21, n=10; ssTnIR115G, 2.00±0.20, n=8), and these values were significantly greater than the slope observed in myocytes expressing ssTnI (nH 1.27±0.11, n=5; P<0.05). The comparable nH values in myocytes expressing ssTnIR115G and cTnIR146G provides evidence that the mutation influences myofilament cooperativity in an isoform-independent manner. Finally, maximum tension values in myocytes expressing cTnIR146G, ssTnI, or ssTnIR115G were unchanged relative to control values (in kN/m2: control 15.4±1.4, n=8; cTnI 17.5±3.4, n=7; cTnIR146G 17.9±3.4, n=8; ssTnI 17.1±2.6, n=4; ssTnIR115G 13.1±2.1, n=8).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The heightened myofilament Ca2+ sensitivity caused by HCM-associated mutant sarcomeric proteins has been proposed to be a key element in the development of organ-level disease.3 The present study shows that under physiological activating conditions, ssTnI and cTnIR146G similarly enhance myofilament Ca2+ sensitivity of tension in adult cardiac myocytes. This presents a paradox whereby both ssTnI and cTnIR146G heighten Ca2+ sensitivity, although only cTnIR146G leads to organ-level pathology and premature death in mice.6,9 We further show that myofilament pH sensitivity is an additional factor that, together with enhanced myofilament Ca2+ sensitivity, may be important for the development of cardiac dysfunction caused by the HCM-associated cTnIR146G mutation. Specifically, under acidic pH conditions, enhancement of calcium sensitivity of contraction is lost in cTnIR146G compared with ssTnI (Figure 4C).

Working Model: Progression From Enhanced Myofilament Ca2+ Sensitivity to Cardiac Dysfunction
The development of ventricular arrhythmia resulting from myocyte disarray is often assumed to be the primary entity involved in the premature deaths in HCM patients.24 However, multiple clinical studies have pointed to the possibility that localized or regional myocardial ischemia could also be a factor in the development of cardiac dysfunction, arrhythmia, and/or death.10,23,25 In support of this idea is the recent finding of myocytes with evidence of hypoxia in cTnIR146G mouse lines where hearts did not yet exhibit overt pathology.6

A model incorporating divergent myofilament pH sensitivity in conjunction with the enhanced myofilament Ca2+ sensitivity in cTnIR146G- versus ssTnI-expressing myocytes is proposed below. Our working hypothesis is that enhanced myofilament Ca2+ sensitivity could work in parallel with greater pH sensitivity to cause progressive changes in myocardium-expressing cTnIR146G, but not ssTnI. The shared heightened myofilament Ca2+ sensitivity of tension in myocytes expressing ssTnI or cTnIR146G will cause a slight slowing of myocardial relaxation, as demonstrated in transgenic mice expressing either TnI protein.6,9 This relaxation delay may only lead to subtle changes in working myocardium to compensate for delayed relaxation, including remodeling of the sarcomere or Ca2+ handling protein content or function1 and/or alterations in the adrenergic signaling response.26,27 Short intervals of mild local ischemia resulting from myocardial bridging (eg, a band of overlying muscle that can result in systolic compression of a coronary artery23), exercise, and/or stress22,25 within myocytes expressing cTnIR146G or ssTnI would initiate the divergent pathway leading to dysfunction in cTnIR146G-expressing myocardium. Specifically, the acidosis accompanying ischemia is predicted to decrease cardiac function to a greater extent in hearts expressing cTnIR146G compared with ssTnI (Figure 4C). In support of this idea, it is known that ischemia is a noted complication in HCM patients,10,22,23 and experimental work has demonstrated the presence of cellular acidosis during cardiac ischemia.1113 The working model does not attempt to incorporate the important connection between hypertrophy and mortality, due to the complexity of this relationship. Most importantly, the possible role of other factors in addition to acidic pH, such as altered crossbridge kinetics and/or cellular signaling,26,28 may require consideration as this model is refined in the future.

Implications of TnI Competition Assay
Our results indicate there is diminished ability of cTnIR146G to replace endogenous cTnI within the sarcomere. In transgenic mice, cTnIR146G mRNA increased 2- to 10-fold,6 and thus, the reduced presence of cTnIR146G within the sarcomere is presumably due to a reduced ability of mutant cTnI to incorporate in myofilaments relative to wild-type cTnI. In the TnI competitive assay (Figure 3), titration of recombinant vectors containing wild-type and mutant TnIs supports this interpretation. This information may be useful in developing gene or protein-based therapeutic strategies for HCM. A possible explanation for the reduced myofilament incorporation of cTnIR146G relative to the other TnI proteins (Figures 1 and 5) is the presence of subtle conformational differences of the mutant TnI that influence the affinity of this protein for the myofilament binding sites. Previously, cTnI and cTnIR146G binding to immobilized TnC were reportedly not different,29 although the use of TnI concentrations associated with maximal TnC binding may have obscured differences in affinity. Regardless of the mechanism involved in reducing myofilament incorporation of this mutant TnI, our results indicate there is a potential treatment strategy available to minimize incorporation of mutant TnI in the sarcomere. Experimental approaches could involve gene or protein-based delivery/expression of normal TnI and/or partial suppression of the mutant allele. In addition, abolishing the pH sensitivity of cTnI through gene transfer may prevent maladaptive hypertrophy associated with mutations in different contractile proteins.

Molecular Switch Functions of TnI
The R145G mutation in human cTnI lies within the inhibitory peptide (IP; Figure 1A), a region postulated to act as an important molecular switch within TnI that toggles from actin to troponin C in the presence of Ca2+.30 The IP region is highly conserved among TnI isoforms, with a single substitution of Pro in ssTnI for Thr in cTnI at codon 144 in the rat sequence (Figure 1A). Previous studies on the IP region indicated this proline substitution does not change Ca2+-activated force properties.31 In contrast, functional results obtained in the present study indicate a single amino acid substitution (R->G), with a net decrease in positive charge, is sufficient to change myofilament Ca2+ sensitivity of tension (Figure 3). The heightened acidic pH response observed with cTnIR146G and ssTnIR115G, relative to ssTnI (Figures 3 and 4), indicates loss of positive charge at this residue also may influence myofilament pH sensitivity in an isoform-independent manner. Other amino acid differences between cTnI and ssTnI may be involved in producing a similar change in myofilament Ca2+ and pH sensitivities of tension. The similar Ca2+ sensitivity and enhanced pH sensitivity observed in myocytes expressing ssTnIR115G or cTnIR146G relative to ssTnI-expressing myocytes support this view.


*    Acknowledgments
 
This work is supported by grants from the National Institutes of Health and American Heart Association (to J.M.M.). J.M. Metzger is an Established Investigator of the American Heart Association, and M.V. Westfall is the recipient of a Scientist Development grant from the American Heart Association. We appreciate helpful comments from Dan Michele on earlier versions of this manuscript.

Received April 8, 2002; revision received August 7, 2002; accepted August 12, 2002.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Seidman JG, Seidman C. The genetic basis of cardiomyopathy: From mutation identification to mechanistic paradigms. Cell. 2001; 104: 557–567.[CrossRef][Medline] [Order article via Infotrieve]

2. Marian A, Roberts R. The molecular genetic basis for hypertrophic cardiomyopathy. J Mol Cell Cardiol. 2001; 33: 655–670.[CrossRef][Medline] [Order article via Infotrieve]

3. Hernandez O, Housmans PR, Potter JD. Pathophysiology of cardiac muscle contraction and relaxation as a result of alterations in thin filament regulation. J Appl Physiol. 2001; 90: 1125–1136.[Abstract/Free Full Text]

4. Westfall MV, Rust EM, Metzger JM. Slow skeletal troponin I gene transfer, expression, and myofilament incorporation enhances adult cardiac myocyte contractile function. Proc Natl Acad Sci U S A. 1997; 94: 5444–5449.[Abstract/Free Full Text]

5. Kimura A, Harada H, Park JE, Nishi H, Satoh M, Takahashi M, Hiroi S, Sasaoka T, Ohbuchi N, Nakamura T, Koyanagi T, Hwang TH, Choo JA, Chung KS, Hasegawa A, Nagai R, Okasaki O, Nakamura H, Matsuzaki M, Sakamoto T, Toshima H, Koga Y, Imaizumi T, Sasazuki T. Mutations in the cardiac troponin I gene associated with hypertrophic cardiomyopathy. Nat Genet. 1997; 16: 379–382.[CrossRef][Medline] [Order article via Infotrieve]

6. James J, Zhang Y, Osinska H, Sanbe A, Klevitsky R, Hewett TE, Robbins J. Transgenic modeling of a cardiac troponin I mutation linked to familial hypertrophic cardiomyopathy. Circ Res. 2000; 87: 805–811.[Abstract/Free Full Text]

7. Reiser PJ, Westfall MV, Schiaffino S, Solaro RJ. Tension production and thin-filament protein isoforms in developing rat myocardium. Am J Physiol. 1994; 267: H1589–H1596.[Medline] [Order article via Infotrieve]

8. Saggin L, Gorza L, Ausoni S, Schiaffino S. Troponin I switching in the developing heart. J Biol Chem. 1989; 264: 16299–16302.[Abstract/Free Full Text]

9. Fentzke RC, Buck SH, Patel JR, Lin H, Wolska BM, Stojanovic MO, Martin AF, Solaro RJ, Moss RL, Leiden JM. Impaired cardiomyocyte relaxation and diastolic function in transgenic mice expressing slow skeletal troponin I in the heart. J Physiol (Lond). 1999; 517: 143–157.[Abstract/Free Full Text]

10. Jung W-I, Sieverding L, Breuer J, Hoess T, Widmaier S, Schmidt O, Bunse M, vanErckelens R, Apitz J, Lutz O, Dietze GJ. 31P NMR Spectroscopy detects metabolic abnormalities in asymptomatic patients with hypertrophic cardiomyopathy. Circulation. 1998; 97: 2536–2542.[Abstract/Free Full Text]

11. Orchard CH, Kentish JC. Effects of changes of pH on the contractile function of cardiac muscle. Am J Physiol. 1990; 258: C967–C981.[Medline] [Order article via Infotrieve]

12. Ebus JP, Stienen GJ, Elzinga G. Influence of phosphate and pH on myofibrillar ATPase activity and force in skinned cardiac trabeculae from rat. J Physiol (Lond). 1994; 476: 501–516.[Abstract/Free Full Text]

13. Steenbergen C, Deleeuw G, Rich T, Williamson J. Effects of acidosis and ischemia on contractility and intracellular pH of rat heart. Circ Res. 1977; 41: 849–857.[Free Full Text]

14. Westfall MV, Albayya FP, Metzger JM. Functional analysis of troponin I regulatory domains in the intact myofilament of adult single cardiac myocytes. J Biol Chem. 1999; 274: 22508–22516.[Abstract/Free Full Text]

15. Michele DE, Albayya FP, Metzger JM. Thin filament protein dynamics in fully differentiated adult cardiac myocytes: toward a model of sarcomere maintenance. J Cell Biol. 1999; 145: 1483–1495.[Abstract/Free Full Text]

16. Graham FL, Prevec L. Manipulation of Adenovirus Vectors. Methods Molec Biol. 1991; 7: 109–128.

17. Westfall MV, Rust EM, Albayya F, Metzger JM. Adenovirus-mediated myofilament gene transfer into adult cardiac myocytes. Methods Cell Biol. 1997; 52: 307–322.[Medline] [Order article via Infotrieve]

18. Westfall MV, Samuelson LC, Metzger JM. Troponin I isoform expression is developmentally regulated in differentiating embryonic stem cell-derived cardiac myocytes. Dev Dyn. 1996; 206: 24–38.[CrossRef][Medline] [Order article via Infotrieve]

19. Metzger JM. Myosin binding-induced cooperative activation of the thin filament in cardiac myocytes and skeletal muscle fibers. Biophys J. 1995; 68: 1430–1442.[Medline] [Order article via Infotrieve]

20. Fabiato A. Computer programs for calculating total from specified free or free from specified total ionic concentrations in aqueous solutions containing multiple metals and ligands. Meth Enzymol. 1988; 157: 378–417.[Medline] [Order article via Infotrieve]

21. Robbins J. Remodeling the cardiac sarcomere using transgenesis. Ann Rev Physiol. 2000; 62: 261–287.[CrossRef][Medline] [Order article via Infotrieve]

22. Elliott PM, Rosano GMC, Gill JS, Poole-Wilson PA, Kaski JC, McKenna WJ. Changes in coronary sinus pH during dipyridamole stress in patients with hypertrophic cardiomyopathy. Heart. 1996; 75: 179–183.[Abstract/Free Full Text]

23. Harjai K, Cheriif J, Murgo JP. Ischemia and atherosclerotic coronary artery disease in patients with hypertrophic cardiomyopathy: a review of incidence, pathophysiological mechanisms, clinical implications and management strategies. Coron Art Dis. 1996; 7: 183–187.[Medline] [Order article via Infotrieve]

24. Watkins H. Sudden death in hypertrophic cardiomyopathy. N Engl J Med. 2000; 342: 422–424.[Free Full Text]

25. Yoshida N, Ikeda H, Wada T, Matsumoto A, Maki S, Muro A, Shibata A, Imaizumi T. Exercise-induced abnormal blood pressure responses are related to subendocardial ischemia in hypertrophic cardiomyopathy. J Am Coll Cardiol. 1998; 32: 1938–1942.[Abstract/Free Full Text]

26. Freeman K, Lerman I, Kranias EG, Bohlmeyer T, Bristow MR, Lefkowitz RJ, Iaccarino G, Koch WJ, Leinwand LA. Alterations in cardiac adrenergic signaling and calcium cycling differentially affect the progression of cardiomyopathy. J Clin Invest. 2001; 107: 967–974.[Medline] [Order article via Infotrieve]

27. Deng Y, Schmidtmann A, Redlich A, Westerdorf B, Jaquet K, Thieleczek R. Effects of phosphorylation and mutation R145G on human cardiac troponin I function. Biochemistry. 2001; 40: 14593–14602.[CrossRef][Medline] [Order article via Infotrieve]

28. Pi Y, Kemnitz KR, Zhang D, Kranias EG, Walker JW. Phosphorylation of troponin I controls cardiac twitch dynamics. Circ Res. 2002; 90: 649–656.[Abstract/Free Full Text]

29. Elliott K, Watkins H, Redwood CS. Altered regulatory properties of human cardiac troponin I mutants that cause hypertrophic cardiomyopathy. J Biol Chem. 2000; 275: 22069–22074.[Abstract/Free Full Text]

30. Van Eyk JE, Hodges RS, The biological importance of each amino acid residue of the troponin I inhibitory sequence 104-115 in the interaction with troponin C and tropomyosin-actin. J Biol Chem. 1988; 263: 1726–1732.[Abstract/Free Full Text]

31. Strauss JD, Van Eyk JE, Barth Z, Kluwe L, Wiesner RJ, Maeda K, Ruegg JC. Recombinant troponin I substitution and calcium responsiveness in skinned cardiac muscle. Eur J Physiol. 1996; 431: 853–862.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
FASEB J.Home page
N. J. Palpant, L. G. D'Alecy, and J. M. Metzger
Single histidine button in cardiac troponin I sustains heart performance in response to severe hypercapnic respiratory acidosis in vivo
FASEB J, May 1, 2009; 23(5): 1529 - 1540.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
J. Davis, M. V. Westfall, D. Townsend, M. Blankinship, T. J. Herron, G. Guerrero-Serna, W. Wang, E. Devaney, and J. M. Metzger
Designing Heart Performance by Gene Transfer
Physiol Rev, October 1, 2008; 88(4): 1567 - 1651.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wen, J. R. Pinto, A. V. Gomes, Y. Xu, Y. Wang, Y. Wang, J. D. Potter, and W. G. L. Kerrick
Functional Consequences of the Human Cardiac Troponin I Hypertrophic Cardiomyopathy Mutation R145G in Transgenic Mice
J. Biol. Chem., July 18, 2008; 283(29): 20484 - 20494.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S.-i. Yasuda, P. Coutu, S. Sadayappan, J. Robbins, and J. M. Metzger
Cardiac Transgenic and Gene Transfer Strategies Converge to Support an Important Role for Troponin I in Regulating Relaxation in Cardiac Myocytes
Circ. Res., August 17, 2007; 101(4): 377 - 386.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. Jagatheesan, S. Rajan, N. Petrashevskaya, A. Schwartz, G. Boivin, G. M. Arteaga, R. John Solaro, S. B. Liggett, and D. F. Wieczorek
Rescue of tropomyosin-induced familial hypertrophic cardiomyopathy mice by transgenesis
Am J Physiol Heart Circ Physiol, August 1, 2007; 293(2): H949 - H958.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Davis, H. Wen, T. Edwards, and J. M. Metzger
Thin Filament Disinhibition by Restrictive Cardiomyopathy Mutant R193H Troponin I Induces Ca2+-Independent Mechanical Tone and Acute Myocyte Remodeling
Circ. Res., May 25, 2007; 100(10): 1494 - 1502.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kobayashi and R. J. Solaro
Increased Ca2+ Affinity of Cardiac Thin Filaments Reconstituted with Cardiomyopathy-related Mutant Cardiac Troponin I
J. Biol. Chem., May 12, 2006; 281(19): 13471 - 13477.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. V. Westfall, A. M. Lee, and D. A. Robinson
Differential Contribution of Troponin I Phosphorylation Sites to the Endothelin-modulated Contractile Response
J. Biol. Chem., December 16, 2005; 280(50): 41324 - 41331.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Sanbe, J. James, V. Tuzcu, S. Nas, L. Martin, J. Gulick, H. Osinska, S. Sakthivel, R. Klevitsky, K. S. Ginsburg, et al.
Transgenic Rabbit Model for Human Troponin I-Based Hypertrophic Cardiomyopathy
Circulation, May 10, 2005; 111(18): 2330 - 2338.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M Kruger, S Zittrich, C Redwood, N Blaudeck, J James, J Robbins, G Pfitzer, and R Stehle
Effects of the mutation R145G in human cardiac troponin I on the kinetics of the contraction-relaxation cycle in isolated cardiac myofibrils
J. Physiol., April 15, 2005; 564(2): 347 - 357.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Kedar, H. McDonough, R. Arya, H.-H. Li, H. A. Rockman, and C. Patterson
Muscle-specific RING finger 1 is a bona fide ubiquitin ligase that degrades cardiac troponin I
PNAS, December 28, 2004; 101(52): 18135 - 18140.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Y. M. Liou and J. C. H. Chang
Differential pH Effect on Calcium-Induced Conformational Changes of Cardiac Troponin C Complexed with Cardiac and Fast Skeletal Isoforms of Troponin I and Troponin T
J. Biochem., November 1, 2004; 136(5): 683 - 692.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. A. Kass, J. G.F. Bronzwaer, and W. J. Paulus
What Mechanisms Underlie Diastolic Dysfunction in Heart Failure?
Circ. Res., June 25, 2004; 94(12): 1533 - 1542.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. Layland, D. J. Grieve, A. C. Cave, E. Sparks, R J. Solaro, and A. M. Shah
Essential role of troponin I in the positive inotropic response to isoprenaline in mouse hearts contracting auxotonically
J. Physiol., May 1, 2004; 556(3): 835 - 847.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. B. Marston and C. S. Redwood
Modulation of Thin Filament Activation by Breakdown or Isoform Switching of Thin Filament Proteins: Physiological and Pathological Implications
Circ. Res., December 12, 2003; 93(12): 1170 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. M. Murphy
Troponin I: In Sickness and In Health--and Normal Development
Circ. Res., September 20, 2002; 91(6): 449 - 450.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
91/6/525    most recent
01.RES.0000034710.46739.C0v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Westfall, M. V.
Right arrow Articles by Metzger, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Westfall, M. V.
Right arrow Articles by Metzger, J. M.
Related Collections
Right arrow Contractile function
Right arrow Pathophysiology
Right arrow Myocardial cardiomyopathy disease