Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Circulation Research. 2002;91:1135-1141
Published online before print November 7, 2002, doi: 10.1161/01.RES.0000046236.20251.FA
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
91/12/1135    most recent
01.RES.0000046236.20251.FAv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holzknecht, Z. E.
Right arrow Articles by Platt, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holzknecht, Z. E.
Right arrow Articles by Platt, J. L.
Related Collections
Right arrow Other Vascular biology
Right arrow CV surgery: transplantation, ventricular assistance, cardiomyopathy
Right arrow Transplantation
(Circulation Research. 2002;91:1135.)
© 2002 American Heart Association, Inc.

Molecular Medicine

Apoptosis and Cellular Activation in the Pathogenesis of Acute Vascular Rejection

Zoie E. Holzknecht, Karisha L. Kuypers, Timothy B. Plummer, Josie Williams, Matilda Bustos, Gregory J. Gores, Gregory J. Brunn, Jeffrey L. Platt

From the Departments of Surgery (Z.E.H., K.L.K., T.B.P., J.W., G.J.B., J.L.P.), Gastroenterology (G.J.G.), Pediatrics (J.L.P.), and Immunology (J.L.P.), Mayo Clinic, Rochester, Minn, and the Division of Hepatology and Gene Therapy (M.B.), Universidad de Navarra, Pamplona, Spain.

Correspondence to Jeffrey L. Platt, MD, Transplantation Biology, Medical Sciences Building, Room 2-66, Mayo Clinic, 200 First St Southwest, Rochester, MN 55905. E-mail platt.jeffrey{at}mayo.edu


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMaterials and Methods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Acute vascular or humoral rejection, a vexing outcome of organ transplantation, has been attributed by some to activation and by others to apoptosis of endothelial cells in the graft. We asked which of these processes causes acute vascular rejection by tracing the processes during the development of acute vascular rejection in porcine cardiac xenografts performed in baboons. Apoptosis, assayed by terminal deoxynucleotidyl transferase–mediated dUTP nick end-labeling (TUNEL), expression of activated caspase-3, and proapoptotic genes Bax and Bcl-xL, was not detected until acute vascular rejection was well advanced, and even then, apoptosis was largely confined to myocytes. Activation of the endothelium, as evidenced by expansion of rough endoplasmic reticulum and increased ribosomal antigen and phospho-p70 S6 kinase, occurred early in the course of acute vascular rejection and progressed through the disease process. These findings suggest that acute vascular rejection is caused by an active metabolic process and not by apoptosis in the endothelium.


Key Words: apoptosis • endothelial cells • xenotransplantation • cardiac transplantation


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMaterials and Methods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Acute vascular, or humoral, rejection is the occasional cause of irreversible rejection of allografts1–4 and a frequent cause of irreversible rejection of xenografts.5–8 Studies in human subjects,9–13 nonhuman primates,14,15 and rodents16–19 suggest that acute vascular rejection is initiated when antibodies and possibly natural killer cells, platelets, and macrophages directed by antibodies of the recipient react with the endothelial lining of blood vessels in the graft, inducing pathophysiological changes in the cells. A critical question is how antibodies, natural killer cells, macrophages, or other elements interacting with the blood vessels of an organ transplant cause rejection.

The pathogenesis of acute vascular rejection has been ascribed to two pathogenetic mechanisms that would seem, in principal, to be mutually exclusive. One mechanism involves the activation of endothelial cells in the graft.6,16,20 Activation of endothelium leads to de novo expression of tissue factor and plasminogen activator inhibitor type I,21,22 causing endothelial cells to become procoagulant, and to the elaboration of cytokines, such as interleukin-1, and cell adhesion molecules, such as E-selectin,23–25 which promote inflammation. Activation of the endothelium might be caused by xenoreactive antibodies and complement,26–28 platelets,13 or inflammatory cells,16,17,29 thus leading to ischemia, thrombosis, and inflammation, the cardinal features of acute vascular rejection. Involvement of endothelial cell activation in the pathogenesis of acute vascular rejection is supported by studies associating the expression of interleukin-1ß–converting enzyme, interleukin-2, interferon-{gamma}, tumor necrosis factor-{alpha}, and tissue factor with the rejection of xenografts in rodents.30,31

Another pathogenic mechanism for acute vascular rejection involves the apoptosis of endothelial cells in the graft. In rodents30 and nonhuman primates,32 apoptosis of endothelial cells can be induced by ischemia, cytokines, or inflammatory cells and can cause the release of endothelial cells from the underlying matrix,33 loss of vascular integrity, and exposure of the matrix to coagulation and inflammatory elements in the blood. Apoptosis also deprives the endothelium of normal functions, such as inhibition of coagulation and inflammation,34–36 thus inducing ischemia, inflammation, and thrombosis through a pathway distinct from endothelial cell activation. Preservation injury, which has some morphological features in common with acute vascular rejection, is associated with apoptosis,37–40 and therapeutic manipulations that avert acute vascular rejection are associated with the expression of antiapoptotic proteins such as Bcl-2, Bcl-xL, and the zinc finger protein A20.30

Although it is formally possible that endothelial cell activation and apoptosis might occur simultaneously in distinct regions of blood vessels, the predominance of one mechanism over the other would have important implications for understanding how humoral immunity incites disease and what therapies might be effective. Accordingly, we asked whether acute vascular rejection in xenografts might be associated predominantly with activation or apoptosis of the endothelium of xenografts.


*    Materials and Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Materials and Methods
down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Cardiac Transplantation
Animal care and procedures were in accord with NIH and institutional guidelines. Heterotopic cardiac transplants (n=3) from Hartley guinea pigs (200 to 250 g) into Lewis rat recipients (250 to 350 g) (Charles River, Raleigh, NC) were performed as described previously31 by aortic-aortic and pulmonary artery–inferior vena cava anastomosis in an end-to-side manner. To prevent hyperacute rejection, the recipients were given purified cobra venom factor (Quidel) intravenously at a dosage of 60 U/kg at 24 hours before transplantation and 30 U/kg daily thereafter. To prevent cellular rejection, recipients were given cyclosporine (Sandoz) at a dosage of 20 mg/kg daily.

Heterotopic cardiac transplants from pigs into baboons (Papio anubus; Southwest Research, San Antonio, Tex) were performed as previously described.14 Some transplants (n=4) were transgenic for human CD59 and human decay-accelerating factor.14,41,42 The recipients were treated with methylprednisolone (8 mg/kg per day and tapered to 1 mg/kg per day), azathioprine (2 mg/kg per day after a loading dose of 8 mg/kg), and cyclosporine (5 mg/kg per day after a loading dose of 15 mg/kg), as previously described.43 Two recipients of unmodified porcine hearts were treated with cobra venom factor (60 U/kg per day) and with immunosuppression as described above. Some baboons were depleted of anti–Gal{alpha}1-3Gal antibodies using a Baxter Autopheresis-C plasmapheresis device with Gal{alpha}1-3Galß1-4GlcNAc Sepharose columns, as previously described,15,44 3 to 6 days before and at various times after transplantation. Baboons from which antibody was depleted were treated with methylprednisolone (10 mg/kg per day tapered by 1 mg/kg per day to a maintenance dose of 1 mg/kg per day), cyclosporine (5 mg/kg per day after a loading dose of 15 mg/kg), and cyclophosphamide (1 to 5 mg/kg per day after a loading dose of 10 mg/kg per day for 2 to 3 days), as described in detail.15,44

Immunopathology
Immunopathology was performed as previously described.15,44 Baboon and rat fibrinogen was detected using FITC-conjugated goat anti-human fibrinogen or FITC-goat anti-rat fibrinogen (ICN), respectively. Baboon fibrin monomer was detected using mouse monoclonal anti-human fibrinogen ß-chain (American Diagnostica, Inc). C4 and the membrane attack complex were detected using FITC-goat anti-human C4 (ICN) and mouse anti-human C5b-9 (clone MBM5, generously provided by Dr A.F. Michael, University of Minnesota, Minneapolis). Porcine major histocompatibility complex (MHC) class II was detected using mouse monoclonal antibodies (generously provided by Dr D. Sachs, Massachusetts General Hospital, Boston). Baboon platelets were detected using a mouse monoclonal anti-human CD41 (clone 5B12, Dako Corp). Mouse monoclonal antibodies were detected using affinity-isolated FITC-goat F(ab')2 anti-mouse IgG (ICN) absorbed with human and porcine sera and affinity-isolated FITC-rabbit F(ab')2–anti-goat IgG (ICN) absorbed with human and porcine sera. Porcine ribosomes were detected with human anti-ribosomal P antigen (Immunovision) detected with FITC-goat anti-human IgG (ICN) absorbed with porcine serum and FITC-rabbit anti-goat IgG (ICN) absorbed with porcine and human serum. Activated p70 S6 kinase was detected with affinity-purified rabbit anti–phospho-p70 S6 kinase (Thr421/Ser424, Cell Signaling Technology, Inc) and FITC-goat anti-rabbit IgG (ICN) absorbed with porcine and human serum and FITC-rabbit anti-goat IgG absorbed with porcine and human serum.

Activated caspase-3 was detected using rabbit anti-human active caspase-3 (Promega Corp) detected with affinity-purified FITC-goat F(ab')2–anti-rabbit IgG (ICN) and rabbit anti-goat IgG absorbed with porcine and human serum. Slides were studied using an epifluorescence microscope (DMRD, Leica) equipped with appropriate excitation and emission filters. Digital images were obtained using a high-resolution CCD digital camera (SPOT II, Diagnostic Instruments) and SPOT II software.

Electron Microscopy
Tissue samples were fixed in 1% glutaraldehyde and 4% formaldehyde in 0.1 mol/L phosphate buffer (pH 7.2), rinsed in PBS (pH 7.2), and postfixed in phosphate-buffered 1% osmium tetroxide for 1 hour. Samples were rinsed in distilled water and stained en bloc with 2% uranyl acetate for 30 minutes at 60°C. Samples were rinsed in distilled water, dehydrated in progressively increasing amounts of ethanol in propylene oxide, and embedded in multicomponent epoxy resin (Spurr kit). Sections of 90 nm were cut and stained with lead citrate.

TUNEL Assay
Endothelial cells were assayed for apoptosis by terminal deoxynucleotidyl transferase–mediated dUTP nick end-labeling (TUNEL) analysis as follows: Confluent endothelial cells, grown on chamber slides, were incubated with human sera (described above), tumor necrosis factor-{alpha} (10 ng/mL, Life Technologies, Inc), synthetic melittin (0.75 µmol/L, Sigma Chemical Co), or mouse anti-human {alpha}vß3 IgG (33 µg/mL, Chemicon International) in culture medium. Any traces of endotoxin were depleted using END-X B15 affinity resin (Associates of Cape Cod, Inc). After treatment, the cells were washed briefly in PBS with 2 mmol/L CaCl2 and 2 mmol/L MgCl2 and then fixed with 1% paraformaldehyde in PBS (pH 7.4) for 10 minutes at room temperature and assayed for apoptosis by labeling free 3' DNA termini with digoxigenin nucleotides using terminal deoxynucleotidyl transferase (Intergen Co). Labeled DNA was then detected using rhodamine-conjugated anti-digoxigenin antibodies.

Polymerase Chain Reactions
Total cellular RNA from porcine tissues was reverse-transcribed using AMV Reverse Transcriptase (Boehringer-Mannheim) into single-stranded cDNA with an oligo-p(dT)15 primer. Polymerase chain reactions (PCRs) using porcine specific primers were performed after samples were equalized for ß-actin. The sequences of primers were as follows: ß-actin, ATGTTTGAGACCTTCAACAC and CACGTCACACTTCATGATGGA; Bax, CGAGAGGTCTTYTTCCGRGTGGCGGG and GCACAGGGCCTTGAGCAC; interleukin-1ß–converting enzyme, GCACACCGCCCAGAGCACAAGAC and CCACGGCAKGCCTGRAYRATGAT; porcine inhibitor of apoptosis protein, AGATGTGGCCATTGACCTTTC and CAGATTCCCAACACCTCAGC; heme oxygenase-1, TTAAGCTGGTGATGGCGTCCT and AGGGCCTTCTGAGCAATCTTC; and Bcl-xL, GGGACTGAATCAGAAGCGGAA and ATCCCGGAAGAGTTCGTTCAA. Ampli-Taq DNA polymerase (Perkin Elmer) was used. Samples were electrophoresed in 1% agarose gels, and bands were quantified using Gel Doc 2000 and Quantity One 4.0.3 software (Bio-Rad Laboratories).


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMaterials and Methods
 *Results
down arrowDiscussion
 down arrowReferences
 
Apoptosis in Acute Vascular Rejection
We first sought to determine whether apoptosis occurs in cardiac xenografts during the course of acute vascular rejection. To ensure that the results were not peculiar to one treatment regimen, we studied wild-type porcine xenografts in recipients depleted of complement with cobra venom factor or of xenoreactive antibodies by adsorption with Gal{alpha}1-3Gal, and we also studied xenografts transgenic for human CD59 and decay acceleration factor transplanted into baboons depleted of neither xenoreactive antibodies nor complement. The development of acute vascular rejection was traced as previously described14,31 by visualizing the deposition of fibrinogen and fibrin monomer in biopsies obtained at various times after transplantation (Figure 1). In hearts destined to undergo acute vascular rejection, fibrin deposition began during the first day and increased progressively until the fifth day (rejection occurred on day 5) after transplantation. However, TUNEL analysis revealed very few apoptotic cells early in the course of acute vascular rejection (Figure 1). Figure 1 clearly indicates that deposition of fibrin precedes the detection of apoptotic cells by several days. Although the kinetics of the development of acute vascular rejection and the time of rejection varied from experiment to experiment, the deposition of fibrin always preceded the appearance of apoptotic cells.



View larger version (88K):
[in this window]
[in a new window]
  		Figure 1. Tracing the occurrence of apoptosis during the development of acute vascular rejection in porcine hearts transplanted into baboons. Porcine hearts transplanted into baboons underwent acute vascular rejection in 5 to 14 days. Biopsies obtained from the hearts were stained with hematoxylin and eosin (H&E first row, original magnification x400), FITC–anti-human fibrinogen (second row, original magnification x200), FITC–anti-human fibrin monomer (third row, original magnification x200), and rhodamine isothiocyanate–conjugated anti-digoxigenin (TUNEL; bottom row, original magnification x400). In the example shown, representative of 5 transplants studied, the first manifestations of rejection (ischemia and formation of fibrin thrombi) can be seen on day 1; however, TUNEL-positive cells are not seen until day 5, the day of rejection.

Because apoptotic cells do not appear in acute vascular rejection until areas of focal necrosis are also detected, we sought to determine whether apoptosis and necrosis were colocalized. To do so, we asked whether cells had lost membrane integrity, taking advantage of the fact that cells maintain membrane integrity throughout the apoptotic cell death pathway, whereas membrane integrity is lost in necrotic cell death.45 Thus, porcine cardiac xenografts in baboons depleted of anti–Gal{alpha}1-3Gal antibodies and xenografts transgenic for human CD59 and decay-accelerating factor in baboons depleted of neither xenoreactive antibodies nor complement were dual-labeled for free 3' DNA termini (apoptosis) using rhodamine-conjugated reagents and for complement component C4 and the membrane attack complex (elements of blood that we commonly detect in necrotic cells) using fluorescein-conjugated reagents. As shown in Figure 2, TUNEL-positive cells were located mainly in regions of focal necrosis, identified by intracellular complement (Figure 2). This would suggest that necrotic cell death precedes apoptotic cell death and may actually be the stimulus for apoptosis.33



View larger version (34K):
[in this window]
[in a new window]
  		Figure 2. Localizing apoptosis and necrosis in acute vascular rejection of porcine hearts transplanted into baboons. Biopsies from porcine cardiac xenografts were stained with FITC antibodies specific for human C4 or the membrane attack complex (MAC) of complement, which we commonly detect in necrotic cells because of the loss of cell membrane integrity. The tissues were costained with rhodamine-conjugated anti-digoxigenin (TUNEL). The results shown are representative of 4 transplants studied and suggest that apoptotic cells (TUNEL-positive cells) are mostly found in areas of focal necrosis and that necrosis proceeds apoptosis by at least 4 days. Original magnification x400.

Because the pathogenesis of acute vascular rejection has also been studied in rodent models17,19,20,46 and might conceivably differ in such models, we traced the occurrence of apoptosis in guinea pig hearts transplanted into rats treated with cobra venom factor. Figure 3 shows that these xenografts had significant amounts of fibrin within 1 day, but apoptosis was not seen until 3 days after transplantation, when acute vascular rejection was severe (Figure 3).



View larger version (59K):
[in this window]
[in a new window]
  		Figure 3. Tracing the occurrence of apoptosis during the development of acute vascular rejection of guinea pig hearts transplanted into rats. Guinea pig hearts transplanted into rats underwent acute vascular rejection in 2 or 3 days. Biopsies obtained from the hearts were stained with H&E (top row, original magnification x400), goat anti-human fibrinogen (middle row, original magnification x200), and anti-digoxigenin (TUNEL; bottom row, original magnification x400). In the example shown, representative of three transplants studied, the manifestations of rejection (ischemia and formation of fibrin thrombi) can be seen on day 1; however, TUNEL-positive cells are not seen until day 3, the day of rejection.

It is possible that apoptosis of donor endothelial cells occurred early in the course of acute vascular rejection but was not detected by TUNEL. To explore this possibility, we first determined whether tissues obtained early in the course of acute vascular rejection had an increased amount of activated caspase-3, an enzyme involved in apoptotic DNA cleavage.47 Tissue samples from all three porcine xenotransplant models as early as 2 days after transplantation had only focal areas of elevated caspase-3 activity, mainly in myocytes, and many fields were entirely free of caspase-3 activity. Thereafter, caspase-3 activity increased until rejection. Figure 4 shows small vessels representative of the time course of acute vascular rejection from one transplant. Caspase-3 activity was seen very rarely and weakly in endothelium; thus, it is not shown in Figure 4 because it would not represent the vast majority of vessels that were studied.



View larger version (75K):
[in this window]
[in a new window]
  		Figure 4. Localization of activated caspase-3 in porcine cardiac xenografts. Biopsies obtained from porcine hearts transplanted into baboons were stained with rabbit antibodies specific for a neoantigen of activated caspase-3. The tissues were costained with rabbit anti–basement membrane antibodies (top row, original magnification x400) or with H&E (bottom row, original magnification x200). In the example shown, representative of 6 transplants studied, activation of caspase-3 is seen as early as 1 day after transplantation; however, the enzyme is not found in graft blood vessels but rather in myocytes. Arrows denote small blood vessels.

Detecting a Loss of Cells From the Vasculature
Apoptosis of endothelial cells early in the course of acute vascular rejection might have evaded detection if apoptotic cells were shed from blood vessels33 or engulfed by adjacent cells.48 To test whether apoptotic cells were shed, we examined tissues from all three porcine xenotransplant models obtained early in the course of acute vascular rejection for evidence of disruption of the endothelial lining. As Figure 5A shows, MHC class II antigen, which is expressed constitutively on porcine endothelium, was continually expressed during the time course of acute vascular rejection (rejection occurred on day 7), and CD41, a platelet antigen, was not detected in spaces between endothelial cells or attached to basement membranes, suggesting that endothelial cells were not shed. In contrast, tissue from cardiac xenografts undergoing hyperacute rejection, a condition in which a focal loss of endothelium typically occurs, revealed a focal loss of MHC class II continuity and a focal increase in platelet antigen along inner walls of blood vessels (Figure 5B). The possibility that apoptotic cells were rapidly cleared from xenotransplants cannot be absolutely excluded; however, the absence of inflammatory cells, which would ingest apoptotic cells, and the absence of apoptotic bodies in the cells composing blood vessel walls would argue against this course of events (Figures 1, 2, and 4).



View larger version (40K):
[in this window]
[in a new window]
  		Figure 5. Integrity of endothelium in porcine cardiac xenografts. Whether apoptotic endothelial cells are lost from blood vessels of porcine cardiac xenografts undergoing acute vascular and hyperacute rejection was tested by examining tissues for loss of continuity of MHC class II antigen and presence of platelets in vessel walls. A, Endothelial integrity in acute vascular rejection. Integrity of the endothelium is demonstrated by the presence of undisrupted fluorescence for MHC class II antigen along the endothelium and the absence of platelet deposition (CD41) early in the course of acute vascular rejection, which occurred on day 7. Arrows denote small blood vessels. Original magnification x200. B, Endothelial integrity in hyperacute rejection. Loss of integrity of endothelium is demonstrated by disruption of continuity of MHC class II and deposition of platelets (CD41) along endothelium of grafts undergoing hyperacute rejection at 1.25 hours. Arrows denote small blood vessels. Original magnification x200.

Gene Expression in Acute Vascular Rejection
We and others have previously shown that proinflammatory and procoagulant genes are expressed in the course of acute vascular rejection in rodents16,31 and primates,49 suggesting that at least some endothelial cells become activated. We explored the possibility that endothelial cells might also express genes characteristic of early events in one or more apoptotic pathway in organs undergoing acute vascular rejection. As Figure 6A (which illustrates a transplant rejected relatively late to allow as much time as possible for apoptosis to develop) shows, acute vascular rejection was not associated with an overall change in the mRNA levels of Bax or Bcl-xL. The development of acute vascular rejection was associated with an increase in mRNA for interleukin-1ß–converting enzyme, porcine inhibitor of apoptosis protein (an antiapoptotic protein), and heme oxygenase-1 (Figure 6A); however, these increases were observed only after the lesions of acute vascular rejection were fully manifest (Figure 6B). The increase in interleukin-1ß–converting enzyme and porcine inhibitor of apoptosis protein seen late in the course of acute vascular rejection could represent a cellular response to inflammation, inasmuch as production of the corresponding proteins has been associated with inflammatory events as well as apoptotic events.50 Although the kinetics of rejection varied among the transplants, the morphological and molecular characteristics were quite similar.



View larger version (64K):
[in this window]
[in a new window]
  		Figure 6. Expression of proapoptotic and antiapoptotic genes in porcine cardiac xenografts undergoing acute vascular rejection. Porcine hearts transplanted into baboons underwent acute vascular rejection in 5 to 14 days. RNA from the hearts was tested by PCR for Bcl-xL, Bax, heme oxygenase-1, interleukin-1ß–converting enzyme (ICE), and porcine inhibitor of apoptosis protein (PIAP) (A) and was used for evaluation pathology (B). Results shown are representative of 4 transplants studied. A, Expression of proapoptotic and antiapoptotic genes. Total cellular RNA was tested by PCR for Bcl-xL ({diamond}), Bax ({bullet}), heme oxygenase-1 ({blacktriangleup}), ICE ({triangledown}), and PIAP ({blacksquare}) in samples equalized for ß-actin (not shown). Changes in expression of heme oxygenase-1, ICE, and PIAP can be seen during acute vascular rejection; however, tissue changes characteristic of acute vascular rejection precede changes in proapoptotic and antiapoptotic genes by at least 6 days. B, Pathology of porcine cardiac xenografts. Porcine cardiac tissues were stained with H&E (first row, original magnification x400), anti-human fibrinogen (second row, original magnification x200), or anti-human fibrin monomer (third row, original magnification x200) before transplantation and 1, 7, and 14 days after transplantation. Tissue changes characteristic of acute vascular rejection can be seen by day 1.

Endothelial Cell Metabolism in Acute Vascular Rejection
If acute vascular rejection is associated with endothelial cell activation instead of apoptosis, it is reasonable to predict that endothelium in the graft would exhibit evidence of an assembly of ribosomes (typical of activated endothelial cells)51 but not nuclear condensation (typical of apoptosis).52 Hence, we studied the ultrastructure of tissues from organs undergoing acute vascular rejection. These studies revealed a dramatic expansion of the rough endoplasmic reticulum and an absence of nuclear condensation (Figure 7), a picture consistent with metabolically active cells and not apoptosis,39,52 early in the course of acute vascular rejection.



View larger version (191K):
[in this window]
[in a new window]
  		Figure 7. Ultrastructural analysis of endothelial cells in porcine cardiac xenografts undergoing acute vascular rejection. Tissue from porcine hearts with acute vascular rejection was studied by transmission electron microscopy. A representative micrograph is shown. The endothelial cell nucleus (N) is normal in appearance, and there is an expansion of the rough endoplasmic reticulum (RER), indicating that the endothelium is metabolically active and not undergoing cell death by apoptosis. Original magnification x4000. Inset shows a segment of normal capillary for comparison.

We next sought to determine whether the dramatic assembly of ribosomes seen by electron microscopy is generally characteristic of acute vascular rejection. As Figure 8 (top row) shows, endothelial cells reacted with anti-ribosomal antibody, and reactivity increased progressively during the course of acute vascular rejection of porcine cardiac xenografts. To assess whether the assembly of ribosomes leads to increased protein translation, we sought to determine whether there was a change in the activation of p70 S6 kinase. When phosphorylated, p70 S6 kinase phosphorylates the S6 protein of the 40S ribosomal subunit, which is associated with an enhanced rate of mRNA translation into protein. As shown in Figure 8 (bottom row), endothelial cell reactivity with anti–phospho-p70 S6 kinase antibody increases over the course of acute vascular rejection.



View larger version (39K):
[in this window]
[in a new window]
  		Figure 8. Endothelial cell metabolism in porcine cardiac xenografts undergoing acute vascular rejection. Biopsies from porcine cardiac xenografts were stained for ribosomal P antigen (top row) and anti–phospho-p70 S6 kinase (Thr421/Ser424) (bottom row). An increase in endothelial ribosomal material and activated p70 S6 kinase is seen during the course of acute vascular rejection. Original magnification x860.


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMaterials and Methods
 up arrowResults
 *Discussion
down arrowReferences
 
The pathogenesis of acute vascular rejection has been ascribed to two seemingly contradictory processes. One theory would hold that acute vascular rejection results from the activation of endothelial cells in the graft, causing proinflammatory and procoagulant changes that eventuate in ischemia and thrombosis, the characteristic features of the disease. The second theory would hold that acute vascular rejection results from apoptosis of endothelial cells or other cells in the graft, causing detachment and loss of cells from blood vessels, leading to vasoconstriction (owing to deficiencies of NO) and thrombosis and inflammation (owing to exposure of the underlining matrix to components of the blood). In the present study, we report that the onset and progression of acute vascular rejection is characterized by heightened endothelial cell metabolism, as evidenced by expansion of ribosomal material in the endothelium, and not by endothelial cell apoptosis. Although the kinetics of acute vascular rejection varied between the three transplant models used, the results were the same. As we discuss below, the distinction between activation and apoptosis of endothelium may have important pathogenic and therapeutic implications.

The earliest sign of organ injury in acute vascular rejection is the swelling of endothelial cells and formation of fibrin deposits along the walls of blood vessels within hours of engraftment.14,31 Although these changes could be caused by apoptosis or activation of the endothelium, we show in the present study that only active metabolism (as evidenced by increased number of endothelial cell ribosomes, typical of endothelial cell activation,51 and by an increase in p70 S6 kinase activity, suggesting an increase in protein translation) is detected. Consistent with this observation, we and others have found that early lesions of acute vascular rejection are associated with de novo expression of tissue factor,31 a cell surface receptor for factor VI, and various cytokines.30 Also consistent with this concept are observations that apoptotic cells do not typically exhibit assembly of the rough endoplasmic reticulum,52,53 which we observe as a characteristic feature of acute vascular rejection; indeed, inhibitors of protein synthesis, such as cyclohexamide,54 staurosporine,55 and ribosome-inactivating proteins,56 help initiate apoptosis in several different cell types.

Although we found no evidence that apoptosis of endothelial cells occurs early in the course of acute vascular rejection, that is not to say that apoptosis plays no role in tissue injury or in the immune response to xenotransplantation. Apoptosis clearly occurs in myocytes late in the course of acute vascular rejection and could contribute to the decrease in myocardial function in the final stages of rejection. Furthermore, apoptosis might promote a cross-presentation of autoantigens such as myosin,57 thus explaining how immunity might be directed at myosin in the heterotopic transplants but not in the autologous heart. Finally, although the present study was conducted in xenotransplants, the aforementioned molecular changes occur in homologous systems, suggesting that the results are relevant for allotransplants.


*    Acknowledgments
 
This study was supported by grants from the NIH (HL-46810 and HL-52297).

Received July 11, 2002; revision received October 28, 2002; accepted October 28, 2002.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMaterials and Methods
 up arrowResults
 up arrowDiscussion
 *References
 

  1. Porter KA. Rejection in treated renal allografts. J Clin Pathol. 1967; 20: 518–534.
  2. Andres GA, Accinni L, Hsu KC, Penn I, Porter KA, Rendall JM, Seegal BC, Starzl TE. Human renal transplants, 3: immunopathologic studies. Lab Invest. 1970; 22: 588–604.[Medline] [Order article via Infotrieve]
  3. McKenzie IF, Whittingham S. Deposits of immunoglobulin and fibrin in human allografted kidneys. Lancet. 1968; 2: 1313–1316.[Medline] [Order article via Infotrieve]
  4. Busch GJ, Reynolds ES, Galvanek EG, Braun WE, Dammin GJ. Human renal allografts: the role of vascular injury in early graft failure. Medicine (Baltimore). 1971; 50: 29–83.[Medline] [Order article via Infotrieve]
  5. Leventhal JR, Dalmasso AP, Cromwell JW, Platt JL, Manivel CJ, Bolman RM, Matas AJ. Prolongation of cardiac xenograft survival by depletion of complement. Transplantation. 1993; 55: 857–866.[Medline] [Order article via Infotrieve]
  6. Magee JC, Collins BH, Harland RC, Lindman BJ, Bollinger RR, Frank MM, Platt JL. Immunoglobulin prevents complement mediated hyperacute rejection in swine-to-primate xenotransplantation. J Clin Invest. 1995; 96: 2404–2412.[Medline] [Order article via Infotrieve]
  7. Kobayashi T, Taniguchi S, Neethling FA, Rose AG, Hancock WW, Ye Y, Niekrasz M, Kosanke S, Wright LJ, White DJG, Cooper DKC. Delayed xenograft rejection of pig-to-baboon cardiac transplants after cobra venom factor therapy. Transplantation. 1997; 64: 1255–1261.[CrossRef][Medline] [Order article via Infotrieve]
  8. Cozzi E, Masroor S, Soin B, Vial C, White DJ. Progress in xenotransplantation. Clin Nephrol. 2000; 53: 13–18.[Medline] [Order article via Infotrieve]
  9. Lederer SR, Schneeberger H, Albert E, Johnson JP, Gruber R, Land W, Burkhardt K, Hillebrand G, Feucht HE. Early renal graft dysfunction: the role of preformed antibodies to DR-typed lymphoblastoid cell lines. Transplantation. 1996; 61: 313–319.[CrossRef][Medline] [Order article via Infotrieve]
  10. Trpkov K, Campbell P, Pazderka F, Cockfield S, Solez K, Halloran PF. Pathologic features of acute renal allograft rejection associated with donor-specific antibody. Transplantation. 1996; 61: 1586–1592.[CrossRef][Medline] [Order article via Infotrieve]
  11. Feucht HE, Schneeberger H, Hillebrand G, Burkhardt K, Weiss M, Riethmuller G, Land W, Albert E. Capillary deposition of C4d complement fragment and early renal graft loss. Kidney Int. 1993; 43: 1333–1338.[Medline] [Order article via Infotrieve]
  12. Collins AB, Schneeberger EE, Pascual MA, Saidman SL, Williams WW, Tolkoff-Rubin N, Cosimi AB, Colvin RB. Complement activation in acute humoral renal allograft rejection: diagnostic significance of C4d deposits in peritubular capillaries. J Am Soc Nephrol. 1999; 10: 2208–2214.[Abstract/Free Full Text]
  13. Bustos M, Saadi S, Platt JL. Platelet-mediated activation of endothelial cells: implications for the pathogenesis of transplant rejection. Transplantation. 2001; 72: 509–515.[CrossRef][Medline] [Order article via Infotrieve]
  14. Lin SS, Weidner BC, Byrne GW, Diamond LE, Lawson JH, Hoopes CW, Daniels LJ, Daggett CW, Parker W, Harland RC, Davis RD, Bollinger RR, Logan JS, Platt JL. The role of antibodies in acute vascular rejection of pig-to-baboon cardiac transplants. J Clin Invest. 1998; 101: 1745–1756.[Medline] [Order article via Infotrieve]
  15. Lin SS, Hanaway MJ, Gonzalez-Stawinski GV, Lau CL, Parker W, Davis RD, Byrne GW, Diamond LE, Logan JS, Platt JL. The role of anti-Gal{alpha}1-3Gal antibodies in acute vascular rejection and accommodation of xenografts. Transplantation. 2000; 70: 1667–1674.[Medline] [Order article via Infotrieve]
  16. Blakely ML, Van Der Werf WJ, Berndt MC, Dalmasso AP, Bach FH, Hancock WW. Activation of intragraft endothelial and mononuclear cells during discordant xenograft rejection. Transplantation. 1994; 58: 1059–1066.[Medline] [Order article via Infotrieve]
  17. Bach FH, Winkler H, Ferran C, Hancock WW, Robson SC. Delayed xenograft rejection. Immunol Today. 1996; 17: 379–384.[CrossRef][Medline] [Order article via Infotrieve]
  18. Itescu S, Kwiatkowski P, Artrip JH, Wang SF, Ankersmit J, Minanov OP, Michler RE. Role of natural killer cells, macrophages, and accessory molecule interactions in the rejection of pig-to-primate xenografts beyond the hyperacute period. Hum Immunol. 1998; 59: 275–286.[CrossRef][Medline] [Order article via Infotrieve]
  19. Lin Y, Vandeputte M, Waer M. Contribution of activated macrophages to the process of delayed xenograft rejection. Transplantation. 1997; 64: 1677–1683.[CrossRef][Medline] [Order article via Infotrieve]
  20. Leventhal JR, Matas AJ, Sun LH, Reif S, Bolman RM, Dalmasso AP, Platt JL. The immunopathology of cardiac xenograft rejection in the guinea pig-to-rat model. Transplantation. 1993; 56: 1–8.[Medline] [Order article via Infotrieve]
  21. Stern D, Nawroth P, Handley D, Kisiel W. An endothelial cell-dependent pathway of coagulation. Proc Natl Acad Sci U S A. 1985; 82: 2523–2527.[Abstract/Free Full Text]
  22. Sawdey M, Podor TJ, Loskutoff DJ. Regulation of type 1 plasminogen activator inhibitor gene expression in cultured bovine aortic endothelial cells. J Biol Chem. 1989; 264: 10396–10401.[Abstract/Free Full Text]
  23. Nawroth PP, Handley DA, Esmon CT, Stern DM. Interleukin 1 induces endothelial cell procoagulant while suppressing cell-surface anticoagulant activity. Proc Natl Acad Science U S A. 1986; 83: 3460–3464.[Abstract/Free Full Text]
  24. Bevilacqua MP, Pober JS, Majeau GR, Cotran RS, Gimbrone MA Jr. Interleukin 1 (IL-1) induces biosynthesis and cell surface expression of procoagulant activity in human vascular endothelial cells. J Exp Med. 1984; 160: 618–623.[Abstract/Free Full Text]
  25. Pober JS. Cytokine-mediated activation of vascular endothelium. Am J Pathol. 1988; 133: 426–433.[Abstract]
  26. Hattori R, Hamilton KK, Fugate RD, McEver RP, Sims PJ. Stimulated secretion of endothelial von Willebrand factor is accompanied by rapid redistribution to the cell surface of the intracellular granule membrane protein GMP-140. J Biol Chem. 1989; 264: 7768–7771.[Abstract/Free Full Text]
  27. Sims PJ, Wiedmer T. Induction of cellular procoagulant activity by the membrane attack complex of complement. Semin Cell Biol. 1995; 6: 275–282.[CrossRef][Medline] [Order article via Infotrieve]
  28. Saadi S, Holzknecht RA, Patte CP, Stern DM, Platt JL. Complement-mediated regulation of tissue factor activity in endothelium. J Exp Med. 1995; 182: 1807–1814.[Abstract/Free Full Text]
  29. Malyguine AM, Saadi S, Holzknecht RA, Patte CR, Sud N, Platt JL, Dawson JR. Induction of procoagulant function in porcine endothelial cells by human NK cells. J Immunol. 1997; 159: 4659–4664.[Abstract]
  30. Bach FH, Ferran C, Hechenleitner P, Mark W, Koyamada N, Miyatake T, Winkler H, Badrichani A, Cardinas D, Hancock WH. Accommodation of vascularized xenografts: expression of "protective genes" by donor endothelial cells in a host Th2 cytokine environment. Nat Med. 1997; 3: 196–204.[CrossRef][Medline] [Order article via Infotrieve]
  31. Nagayasu T, Saadi S, Holzknecht RA, Patte CA, Plummer TB, Platt JL. Expression of tissue factor mRNA in cardiac xenografts: clues to the pathogenesis of acute vascular rejection. Transplantation. 2000; 69: 475–482.[CrossRef][Medline] [Order article via Infotrieve]
  32. Shimizu A, Meehan SM, Kozlowski T, Sablinski T, Ierino FL, Cooper DK, Sachs DH, Colvin RB. Acute humoral xenograft rejection: destruction of the microvascular capillary endothelium in pig-to-nonhuman primate renal grafts. Lab Invest. 2000; 80: 815–830.[Medline] [Order article via Infotrieve]
  33. Stefanec T. Endothelial apoptosis: could it have a role in the pathogenesis and treatment of disease? Chest. 2000; 117: 841–854.[Abstract/Free Full Text]
  34. Bombeli T, Karsan A, Tait JF, Harlan JM. Apoptotic vascular endothelial cells become procoagulant. Blood. 1997; 89: 2429–2442.[Abstract/Free Full Text]
  35. Bombeli T, Schwartz BR, Harlan JM. Endothelial cells undergoing apoptosis become proadhesive for nonactivated platelets. Blood. 1999; 93: 3831–3838.[Abstract/Free Full Text]
  36. Schwartz BR, Karsan A, Bombeli T, Harlan JM. A novel ß1 integrin-dependent mechanism of leukocyte adherence to apoptotic cells. J Immunol. 1999; 162: 4842–4848.[Abstract/Free Full Text]
  37. Gao W, Bentley RC, Madden JF, Clavien PA. Apoptosis of sinusoidal endothelial cells is a critical mechanism of preservation injury in rat liver transplantation. Hepatology. 1998; 27: 1652–1660.[CrossRef][Medline] [Order article via Infotrieve]
  38. Yue TL, Ma XL, Wang X, Romanic AM, Liu GL, Louden C, Gu JL, Kumar S, Poste G, Ruffolo RR Jr, Feuerstein GZ. Possible involvement of stress-activated protein kinase signaling pathway and Fas receptor expression in prevention of ischemia/reperfusion-induced cardiomyocyte apoptosis by carvedilol. Circ Res. 1998; 82: 166–174.[Abstract/Free Full Text]
  39. Patel T, Roberts LR, Jones BA, Gores GJ. Dysregulation of apoptosis as a mechanism of liver disease: an overview. Semin Liver Dis. 1998; 18: 105–114.[Medline] [Order article via Infotrieve]
  40. Fliss H, Gattinger D. Apoptosis in ischemic and reperfused rat myocardium. Circ Res. 1996; 79: 949–956.[Abstract/Free Full Text]
  41. Lin SS, Platt JL. The role of immunoabsorption in xenotransplantation. In: Brunkhorst R, Koch KM, Koll R, eds. Klinische Immunadsorption. Stuttgart, Germany: Wissenschaftliche Verlagsgesellschaft mbH; 2000: 133–136.
  42. Byrne GW, McCurry KR, Martin MJ, McClellan SM, Platt JL, Logan JS. Transgenic pigs expressing human CD59 and decay-accelerating factor produce an intrinsic barrier to complement-mediated damage. Transplantation. 1997; 63: 149–155.[CrossRef][Medline] [Order article via Infotrieve]
  43. McCurry KR, Parker W, Cotterell AH, Weidner BC, Lin SS, Daniels LJ, Holzknecht ZE, Byrne GW, Diamond LE, Logan JS, Platt JL. Humoral responses in pig-to-baboon cardiac transplantation: implications for the pathogenesis and treatment of acute vascular rejection and for accommodation. Hum Immunol. 1997; 58: 91–105.[CrossRef][Medline] [Order article via Infotrieve]
  44. Lin SS, Kooyman DL, Daniels LJ, Daggett CW, Parker W, Lawson JH, Hoopes CW, Gullotto C, Li L, Birch P, Davis RD, Diamond LE, Logan JS, Platt JL. The role of natural anti-Gal{alpha}1-3Gal antibodies in hyperacute rejection of pig-to-baboon cardiac xenotransplants. Transplant Immunol. 1997; 5: 212–218.[CrossRef][Medline] [Order article via Infotrieve]
  45. Vermes I, Haanen C, Reutelingsperger C. Flow cytometry of apoptotic cell death. J Immunol Methods. 2000; 243: 167–190.[CrossRef][Medline] [Order article via Infotrieve]
  46. Lin Y, Vandeputte M, Waer M. Natural killer cell- and macrophage-mediated rejection of concordant xenografts in the absence of T and B cell responses. J Immunol. 1997; 158: 5658–5667.[Abstract]
  47. Fernandes-Alnemri T, Litwack G, Alnemri ES. CPP32, a novel human apoptotic protein with homology to Caenorhabditis elegans cell death protein Ced-3 and mammalian interleukin-1ß-converting enzyme. J Biol Chem. 1994; 269: 30761–30764.[Abstract/Free Full Text]
  48. Hengartner MO. Apoptosis: corralling the corpses. Cell. 2001; 104: 325–328.[CrossRef][Medline] [Order article via Infotrieve]
  49. Kalady MF, Lawson JH, Sorrell RD, Platt JL. Decreased fibrinolytic activity in porcine-to-primate cardiac xenotransplantation. Mol Med. 1998; 4: 629–637.[Medline] [Order article via Infotrieve]
  50. Cerretti DP, Kozlosky CJ, Mosley B, Nelson N, Van Ness K, Greenstreet TA, March CJ, Kronheim SR, Druck T, Cannizzaro LA, Huebner K, Black RA. Molecular cloning of the interleukin-1ß converting enzyme. Science. 1992; 256: 97–100.[Abstract/Free Full Text]
  51. Vinals F, Chambard J, Pouyssegur J. Kinase-mediated protein synthesis is a critical step for vascular endothelial cell proliferation. J Biol Chem. 1999; 274: 26776–26782.[Abstract/Free Full Text]
  52. Kerr JF, Wyllie AH, Currie AR. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer. 1972; 26: 239–257.[Medline] [Order article via Infotrieve]
  53. Sen S. Programmed cell death: concept, mechanism and control. Biol Rev Camb Philos Soc. 1992; 67: 287–319.[Medline] [Order article via Infotrieve]
  54. Martin SJ. Protein or RNA synthesis inhibition induces apoptosis of mature human CD4+ T cell blasts. Immunol Lett. 1993; 35: 125–134.[CrossRef][Medline] [Order article via Infotrieve]
  55. Jacobsen MD, Weil M, Raff MC. Role of Ced-3/ICE-family proteases in staurosporine-induced programmed cell death. J Cell Biol. 1996; 133: 1041–1051.[Abstract]
  56. Kim SE, Lee YH, Park JH, Lee SK. Ginsenoside-Rs4, a new type of ginseng saponin concurrently induces apoptosis and selectively elevates protein levels of p53 and p21WAF1 in human hepatoma SK-HEP-1 cells. Eur J Cancer. 1999; 35: 507–511.[CrossRef][Medline] [Order article via Infotrieve]
  57. Fedoseyeva EV, Zhang F, Orr PL, Levin D, Buncke HJ, Benichou G. De novo autoimmunity to cardiac myosin after heart transplantation and its contribution to the rejection process. J Immunol. 1999; 162: 6836–6842.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
A. Shimizu, Y. Hisashi, K. Kuwaki, Y.-L. Tseng, F. J.M.F. Dor, S. L. Houser, S. C. Robson, H.-J. Schuurman, D. K.C. Cooper, D. H. Sachs, et al.
Thrombotic Microangiopathy Associated with Humoral Rejection of Cardiac Xenografts from {alpha}1,3-Galactosyltransferase Gene-Knockout Pigs in Baboons
Am. J. Pathol., June 1, 2008; 172(6): 1471 - 1481.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
P. T. Jindra, A. Hsueh, L. Hong, D. Gjertson, X.-D. Shen, F. Gao, J. Dang, P. S. Mischel, W. M. Baldwin III, M. C. Fishbein, et al.
Anti-MHC Class I Antibody Activation of Proliferation and Survival Signaling in Murine Cardiac Allografts
J. Immunol., February 15, 2008; 180(4): 2214 - 2224.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
A. Shimizu, K. Yamada, S. Yamamoto, J. M. Lavelle, R. N. Barth, S. C. Robson, D. H. Sachs, and R. B. Colvin
Thrombotic Microangiopathic Glomerulopathy in Human Decay Accelerating Factor-Transgenic Swine-to-Baboon Kidney Xenografts
J. Am. Soc. Nephrol., September 1, 2005; 16(9): 2732 - 2745.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
M. Cascalho, B. M. Ogle, and J. L. Platt
Xenotransplantation and the Future of Renal Replacement
J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1106 - 1112.
[Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Ghanekar, M. Mendicino, H. Liu, W. He, M. Liu, R. Zhong, M. J. Phillips, G. A. Levy, and D. R. Grant
Endothelial Induction of fgl2 Contributes to Thrombosis during Acute Vascular Xenograft Rejection
J. Immunol., May 1, 2004; 172(9): 5693 - 5701.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
S. P. Mazer and D. J. Pinsky
Alive and Kicking: Endothelium at the Geographic Nexus of Vascular Rejection
Circ. Res., December 13, 2002; 91(12): 1085 - 1088.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
91/12/1135    most recent
01.RES.0000046236.20251.FAv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holzknecht, Z. E.
Right arrow Articles by Platt, J. L.
Right arrow