Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2002;91:32-37
Published online before print June 20, 2002, doi: 10.1161/01.RES.0000026502.79063.66
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
91/1/32    most recent
01.RES.0000026502.79063.66v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, H.-J.
Right arrow Articles by Galper, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, H.-J.
Right arrow Articles by Galper, J. B.
Related Collections
Right arrow Gene regulation
Right arrow Lipid and lipoprotein metabolism
(Circulation Research. 2002;91:32.)
© 2002 American Heart Association, Inc.


Molecular Medicine

Role of Sterol Regulatory Element Binding Proteins in the Regulation of G{alpha}i2 Expression in Cultured Atrial Cells

Ho-Jin Park*, Ulrike Begley*, Dequan Kong, Haiyan Yu, Liya Yin, F. Bradley Hillgartner, Timothy F. Osborne, Jonas B. Galper

From the Cardiovascular Division (H.-J.P., U.B., D.K., H.Y., J.B.G.), Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, Mass; the Department of Molecular Biology and Biochemistry (T.F.O.), University of California-Irvine, Irvine, Calif; and the Department of Biochemistry and Molecular Pharmacology (L.Y., F.B.H.), School of Medicine, West Virginia University, Morgantown, WV.

Correspondence to Jonas B. Galper, Dept of Medicine, Cardiovascular Division, Brigham and Women’s Hospital, 75 Francis St, Boston, MA 02115. E-Mail Galper@ calvin.bwh.harvard.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
We have previously demonstrated that growth of embryonic chick atrial cells in medium supplemented with lipoprotein-depleted serum (LPDS) resulted in a coordinate increase in the expression of genes involved in the parasympathetic response of the heart (the M2 muscarinic receptor; the {alpha}-subunit of the heterotrimeric G protein, G{alpha}i2; and the inward rectifying K+ channel protein, GIRK1) and a marked increase in the negative chronotropic response of atrial cells to muscarinic stimulation. In the present study, we demonstrate that regulation of G{alpha}i2 promoter activity by LPDS is mediated by the binding of a sterol regulatory element binding protein (SREBP) to a sterol regulatory element (SRE) in the G{alpha}i2 promoter. Deletion and point mutation of this putative SRE interfered with the regulation of the G{alpha}i2 promoter by SREBP and LPDS. Furthermore gel shift assays demonstrated that point mutations in the putative G{alpha}i2 SRE markedly inhibited the binding of purified SREBP to oligonucleotides containing the G{alpha}i2 SRE sequence. The expression of a dominant-negative SREBP mutant interfered with LPDS stimulation of G{alpha}i2 promoter activity. Finally, we demonstrate that SREBP-1 is markedly more potent than SREBP-2 for the stimulation of G{alpha}i2 promoter activity, suggesting that SREBP1 may play a role in the regulation of G{alpha} i2 expression. These are the first data to demonstrate SREBP regulation of a protein not involved in lipid homeostasis and suggest a new relationship between lipid metabolism and the parasympathetic response of the heart.


Key Words: sterol regulatory element binding proteins • parasympathetic response of the heart • G proteins • G{alpha}i2


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The balance between the response of the heart to parasympathetic and sympathetic stimuli determines not only the rate and force of contraction, but may also play a role in regulating cardiac excitability.1 Parasympathetic regulation of heart rate involves the binding of acetylcholine to M2 muscarinic receptors localized primarily on atrial myocytes. Acetylcholine binding results in the dissociation of the heterotrimeric G protein, Gi2, into {alpha}i2 and ß{gamma} subunits and activation of the inward rectifying K+ channel, GIRK, with a resulting increase in diastolic depolarization and a decrease in beat rate.2 The conclusion that the increased expression of G{alpha}i2 might effect cardiac excitability and parasympathetic response is consistent with a recent report in which the overexpression of G{alpha} i2 in the atrioventricular (AV) node of the pig via an adenoviral vector decreased AV conduction and slowed the ventricular response to atrial fibrillation and interfered with the effects of ß-adrenergic stimulation on cardiac excitability.3

We have previously demonstrated that growth of embryonic chick atrial cells in medium supplement by lipoprotein-depleted serum (LPDS) resulted in a marked increase in their response to muscarinic stimulation and a reciprocal decrease in their response to ß -adrenergic stimulation. These effects of LPDS were reversed by adding back the serum LDL fraction to the culture medium.4 The increase in the parasympathetic response in cells cultured in LPDS was associated with an increase in the expression of muscarinic receptors, G{alpha} i2 and GIRK1.4,5 These findings suggested that a unique relationship might exist between lipid metabolism, the regulation of genes involved in the parasympathetic response of the heart and the response of the heart to parasympathetic stimulation.

Sterol regulatory element binding proteins (SREBPs) are a family of 3 transcription factors that regulate gene expression by binding to a sterol regulatory element (SRE). SREBPs are synthesized as {approx}130-kDa proteins that contain 3 distinct domains: an NH2-terminal domain of {approx}480 amino acids that is a transcriptional activator of the basic helix-loop-helix-lucine zipper family; a hairpin membrane anchor domain of {approx}80 amino acids comprising 2 transmembrane segments separated by a short hydrophilic loop; and a carboxy-terminal domain of {approx}590 amino acids that plays a regulatory role. In lipoprotein-depleted cells, the protein is transported into the Golgi by a SREBP cleavage-activating protein where SREBP is sequentially cleaved with release of the NH2-terminal peptide, which is transported into the nucleus.6 The expression and cleavage of SREBPs are subject to feedback regulation by sterols. To date, three SREBPs have been identified: SREBP-1a and 1c, produced from a single gene through the use of alternate promoters, and SREBP-2 from a separate gene. SREBPs have been shown to play a role in lipid homeostasis by regulating the expression of genes coding for enzymes involved in cholesterol and fatty acid synthesis.7 Little is known about the regulation of gene expression by sterols and SREBPs in the heart. The stimulation of G{alpha}i2 expression by lipoprotein depletion suggested that SREBP might play a role in the regulation of G{alpha} i2 expression and the parasympathetic response in the heart. In the present study, we present data that demonstrate that in cultured heart cells SREBP regulates the expression of G{alpha} i2, a protein whose function has not been directly associated with lipid homeostasis.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Preparation of Lipoprotein-Depleted Serum
LPDS was prepared as described previously.5

Primary Culture of Chick Embryonic Heart Cells
Chick atrial myocyte cultures from embryos 14 days in ovo were prepared as described previously8 except that cells were preplated for 45 minutes before plating.

Vectors
The chick G{alpha}i2 promoter (Genbank accession No. L24549) has been described previously.5 G{alpha}i2 deletion luciferase reporter constructs, pGL3-G{alpha} i2-2.2 kb, pGL3-G{alpha} i2-0.8 kb, and pGL3-G{alpha} i2-0.3 kb were derived by restriction digestion of pBS-G{alpha}i2-2.2 kb with the appropriate restriction enzymes followed by ligation to pGL3-Basic (Promega). The pGL3-G{alpha} i2-0.15 kb construct was generated by PCR using pGL3-G{alpha}i2-2.2 kb as template, 5' primer AAACTCGAGTCGCCACGCCCCCTACC and 3' primer AATAAGCTTGATATCGAATTCCTGC. pGL3-G{alpha}i2-0.07 kb was generated similarly except that the 5' primer was AAACTCGATAGGCCCCGCCCCGCCC. PCR products were digested with XhoI-HindIII and ligated into pGL3-Basic. The chick G{alpha}s promoter-luciferase reporter construct, pGL3-G{alpha}s-1.2 kb, was generated by ligating a HindIII fragment of the G{alpha}s-1.9 kb promoter (Genbank accession No. AF480445) into pGL3-Basic. Point mutations in the putative SRE were generated in a 2-step PCR reaction using the pGL3-G{alpha}i2-0.8 kb as template. For the first reaction, the 3' primer was CGGAATGCCAAGCTTACTTA containing a HindIII site and 5' primers, M1, CGCCCGCCCCCAACCCTACAT; M2, CGCCCGCCCCCCAACCTACAT; and M3, CGCCGCCCCCAAACCTACAT (mutated bases are shown in bold). In the second PCR reaction a 5' primer containing a KpnI site, TATCGATAGGTACCGAGCTCT, was added. PCR products were digested with KpnI and HindIII, and ligated to pGL3-Basic. The LDL receptor promoter luciferase reporter and the vectors expressing nuclear SREBP-1a, SREBP-1c, and SREBP-2 have been described previously.9,10 The vector expressing ADD1/SREBP-1 dominant-negative mutant was a gift of B. Spiegelman, Dana-Farber Cancer Institute, Boston, Mass.11

Transfection of Cells
LipofectAMINE Plus (Life Technologies) was used according to the manufacturer’s protocol with slight modifications. A total of 2 µg of plasmid DNA including 0.2 µg of luciferase reporter construct, 0.2 µg of pCMVßgal, 1 µg or indicated amount of the vector expressing the indicated SREBP, and sufficient pBlueScript to maintain total DNA constant, was used to transfect cells cultured in 6-well dishes to 80% confluence. Cells were incubated with the liposome-DNA complex in Opti-Mem I (GIBCO BRL) for 5 hours. Medium supplemented with either 12% FCS or LPDS was added and incubation continued overnight. Medium was removed and cells incubated in fresh medium with 6% FCS or LPDS for 24 hours. Luciferase and ß-galactosidase assays were carried out as described.12 Data were presented as the mean±SEM and analyzed by Students’ t test where indicated.

RNAse Protection Assay
Antisense RNA probes for chicken SREBP-1 and chicken SREBP-2 were generated as described.13 An 18S rRNA probe, which was used as a control for RNA loading, was made from pRTI 18S probe template (Ambion). Labeled RNAs were purified by PAGE. RNA was extracted from chick embryonic atrial cells and embryonic chick hepatocytes by the guanidinium thiocyanate/phenol/chloroform method.12 Total RNA (20 µg) was hybridized to 4x104 cpm of 32P-labeled RNA at 45°C for 16 hours. The sample was then digested with a mixture of RNAse A and RNAse T. Protected fragments were separated on 8 mol/L urea/5% polyacrylamide gels. Gels were dried and subjected to storage phosphor autoradiography. Images were quantified using ImageQuaNT software by Molecular Dynamics.

Preparation of Membrane and Nuclear Extracts and Western Blot Analysis
Nuclear extracts were prepared by the method of Dignam et al.14 Briefly, cells from four 100-mm plates were pooled and centrifuged at 1000g for 5 minutes at 4°C. The pellet was homogenized in buffer (in mmol/L: 10 HEPES, pH 7.9, 10 KCl, 1.5 MgCl2 0.1 EDTA, 0.1 EGTA, 1 dithiothreitol, and protease inhibitor cocktail [1:100 dilution; Sigma]) using 20 strokes of a dounce homogenizer. The homogenate was centrifuged at 1000g for 10 minutes. The nuclear pellet was resuspended in buffer (20 mmol/L HEPES, pH 7.9, 0.4 mol/L NaCl, 2.5% glycerol, 1 mmol/L EDTA, 1 mmol/L EGTA, 1 mmol/L dithiothreitol, and protease inhibitor cocktail [1:100 dilution]). The suspension was rotated for 30 minutes and then centrifuged for 30 minutes at 15 000g. The supernatant was taken as the nuclear extract. The membrane pellet was prepared from the original 1000g supernatant by centrifugation for 1 hour at 100 000g. The resulting membrane pellet was dissolved in (mmol/L) 10 Tris/HCl, pH 6.8, 100 NaCl, 1% SDS, 1 EDTA, 1 EGTA, and 1 dithiothreitol.

Western blot analyses were carried out as described previously.13 Blots were blocked in Blotto (5% nonfat dry milk, 10 mmol/L Tris/HCl, pH 8.0, 0.15 mol/L NaCl containing 0.02% Tween-20) at 4°C overnight and then incubated with monoclonal antibody against SREBP-1 (IgG-2A4 from American Type Culture Collection [ ATCC]) or SREBP-2 (IgG-1D2 from ATCC) diluted to 1 µg/mL in blocking solution for 1 hour at room temperature. Blots were visualized by using anti-mouse IgG conjugated to horseradish peroxidase (1:10 000, Jackson ImmunoResearch) followed by chemiluminescence using Super Signal substrates (Pierce).

Gel-Shift Assays
Gel-shift assays were carried out as described,9 using double stranded oligonucleotides 33 base pairs in length: wild-type, TGCCTCGCCCGCCCCCCACCCTACATCCCCGCC; M1, TGCCTCGCCCGCCCCCAACCCTACATCCCCGCC; M2, TGCCTCGCCCGCCCCCCAACCTACATCCCCGCC; and M2, TGCCTCGCCCGCCCCCAAACCTACATCCCCGCC (mutated bases are shown in bold). Oligonucleotides were end-labeled with 32P and 20 pmol of oligonucleotide incubated on ice with 1 µg of poly (dI.dC), 5% ficoll, 5 µg of nonfat milk protein, and 20 ng of purified recombinant SREBP-1a protein in 20 µL of buffer, 12 mmol/L HEPES, pH 7.6, 1 mmol/L MgCl2, 50 mmol/L KCl, and 10% glycerol for 20 minutes.8 Protein-DNA complexes were separated on a 5% polyacrylamide gel, 0.5xTBE gel at room temperature and visualized by autoradiography.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Effect of SREBP on the Expression of G{alpha} i2
We had previously demonstrated that growth of embryonic chick atrial cells in medium supplemented with LPDS resulted in increased expression of both G{alpha}i2 protein and mRNA.4,5 In order to determine whether SREBP played a role in the induction of G{alpha}i2 expression in response to growth of cells in LPDS, we studied the regulation of the G{alpha} i2 promoter luciferase reporter (G{alpha} i2-Luc) in embryonic chick atrial cells cultured in LPDS and in cells cotransfected with a vector expressing SREBP-1a. Data summarized in Figure 1 demonstrate that in embryonic chick atrial cells transfected with G{alpha} i2-Luc (pGL3-G{alpha} i2-2.2 kb), growth in LPDS resulted in a 2.0±0.1-fold increase (±SEM, n=5; P<0.01) in G{alpha} i2 promoter activity. This effect was specific for G{alpha}i2 as demonstrated by the absence of an effect of LPDS on chick G{alpha}s promoter activity (Figure 1A). A parallel study demonstrated that in cells transfected with an LDL receptor promoter luciferase reporter (LDLR-Luc) growth in LPDS resulted in a 3.0±0.5-fold stimulation (±SEM, n=5; P<0.01) of LDL receptor promoter activity. Cotransfection of cells cultured in media supplemented with FCS with G{alpha}i2-Luc and pcDNA-SREBP-1a resulted in a 2.5±0.1-fold increase (±SEM, n=5; P<0.01) in G{alpha} i2 promoter activity compared with control (Figure 1B), whereas cotransfection with LDLR-Luc and pcDNA-SREBP-1a resulted in a 5.4±0.5-fold increase (±SEM, n=5; P<0.01) in LDL receptor promoter activity. SREBP-1a had no effect on G{alpha}s promoter activity (Figure 1B). Furthermore stimulation of G{alpha} i2 promoter activity by SREBP-1a was concentration dependent as demonstrated by the increase in G{alpha} i2 promoter activity with increased concentration of pcDNA-SREBP-1a in the transfection medium (Figure 1C).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Regulation of G{alpha}i2, LDLR, and G{alpha}s promoter activities by growth of embryonic chick atrial cells in LPDS (A) and by overexpression of SREBP in cells cultured in FCS (B). Effect of increasing concentrations of SREBP on G{alpha}i2 promoter activity in cells cultured in FCS (C). Transfections carried out and luciferase activity normalized to ß-galactosidase activity determined as described in Materials and Methods. Data are typical of 5 experiments carried out in triplicate. Note differences in scale for LDLR.

Effect of LPDS on the Expression and Processing of Chick Atrial SREBPs
Although the growth of liver cells in LPDS has been shown to stimulate the expression and processing of SREBP-1a, SREBP-1c, and SREBP-2, the effect of lipoprotein depletion on the expression and processing of the SREBPs in heart has not been studied. Chick hepatocytes have been shown to express only SREBP-2 and a second SREBP, which is most like SREBP-1a.13 Data summarized in Figure 2A demonstrate that LPDS had no effect on the expression of mRNA coding for either SREBP-2 or SREBP-1 compared with atrial cells from hearts 14 days in ovo cultured in FCS. However, Western blot analysis of SREBP-1 in nuclear extracts and membrane preparations of embryonic chick atrial cells cultured in FCS and LPDS demonstrated that growth in LPDS induced a marked decrease in the level of a 130-kDa membrane-associated SREBP-1 (Figure 2B, left) and a marked increase in the level of the 60-kDa cleavage product of SREBP-1 in nuclear extracts (Figure 2B, right). These data are consistent with the conclusion that LPDS increases SREBP-1 activity via an effect on processing of the membrane-associated precursor. It was not possible to study the effect of LPDS on SREBP-2 processing because of poor cross-reactivity with available antibodies.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 2. Effect of LPDS on expression and processing of SREBPs. A, Total RNA was extracted from chick atrial cells cultured in medium containing FCS (F) or LPDS (L) for 24 hours. SREBP-1 mRNA, SREBP-2 mRNA, and 18S rRNA were measured using an RNase protection assay. As positive control, the abundance of these RNAs was measured in chick embryo hepatocytes treated with insulin and thyroid hormone (T3). All of the SREBP-1 mRNAs in chicken cells are derived from a single promoter, as demonstrated by the failure of 5'-RACE analysis and RNase protection assays using probes from the 5' end of the SREBP-1 cDNA to detect 5'-heterogeneity in SREBP-1 transcripts.13 These data are typical of 3 similar experiments. B, Membrane (P100) and nuclear (NE) extracts of cells cultured in FCS or LPDS for 24 hours were prepared as described in Materials and Methods. PAGE and Western blot analysis were carried out as described using monoclonal antibody IgG-2A4, which is specific for SREBP-1.13 Data are typical of 3 similar experiments.

Demonstration of a Functional SRE in the G{alpha} i2 Promoter
Analysis of the G{alpha}i2 promoter demonstrated the presence of an 8-bp region at position -219 to -212 with the sequence CACCCTAC, which was highly homologous to the SRE consensus sequence CACCSYAC where S is G or C and Y is a pyrimidine. This SRE-like sequence was associated with several adjacent Sp1 sites (Figure 3A). In order to determine whether this SRE was functionally significant, we constructed a series of deletion mutants of the G{alpha}i2 promoter and determined the ability of these mutant promoters to respond to overexpression of SREBP-1a (Figure 3A). Deletions of the G{alpha} i2 promoter upstream of the putative SRE, pGL3-G{alpha}i2-0.8 kb and pGL3-G{alpha} i2-0.3 kb, had no effect on SREBP-1a stimulation of G{alpha}i2 promoter activity (Figure 3B). However, each of these deletions resulted in an increase in basal G{alpha}i2 promoter activity consistent with the presence of a repressor upstream of position -300. The response to SREBP-1a was abolished in cells cotransfected with G{alpha} i2 promoter constructs in which the deletions included the putative SRE, pGL3-G{alpha}i2-0.15 kb and pGL3-G{alpha}i2-0.07 kb (Figure 3B). The specificity of these deletions in pGL3-G{alpha}i2-0.15 kb for abolishing the response to SREBP is supported by the finding that basal G{alpha}i2 promoter activity was unaffected in pGL3-G{alpha}i2-0.15 kb (Figure 3B), thus ruling out the possibility that the loss of the SREBP response reflects the fact that the basal promoter has been deleted to the point where it is no longer functional.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Effect of deletions of the G{alpha}i2 promoter on SREBP stimulation of G{alpha}i2 promoter activity. Deletion constructs of the G{alpha} i2 promoter (A) were generated as described. Sequence of the proximal 300 base region of the G{alpha} i2 promoter is shown. SRE-like sequence is shown underlined and in bold; putative Sp1 sites shown underlined. Effect of serial deletions of the G{alpha}i2 promoter on SREBP stimulation of G{alpha}i2 promoter activity (B). Luciferase activity was determined as described above. Data are typical of 3 experiments carried out in triplicate.

To further determine the function of this SRE-like sequence, a series of point mutations of the putative SRE were generated and their effect on SREBP stimulation of G{alpha} i2 promoter activity determined. All three of these mutations inhibited SREBP stimulation of G{alpha} i2 promoter activity by 70±8.2% (±SEM, n=3, P<0.01; Figure 4A) without effecting basal promoter activity. More importantly each of these mutations completely abolished the ability of LPDS to stimulate G{alpha} i2 promoter activity (Figure 4B).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 4. Effect of point mutations in SRE on SREBP (A) and LPDS stimulated (B) G{alpha}i2 promoter activity. Point mutations and promoter assays were carried out as described. Data are typical of 3 experiments carried out in triplicate. Gel shift assays of the binding of purified SREBP-1a to oligonucleotides containing wt and mutant SREs (C) were carried out as described. Data are typical of 4 experiments. Effect of DN-SREBP mutant on LPDS stimulated G{alpha}i2 promoter activity (D). Experiments were carried out as described above. Data are typical of 3 experiments carried out in triplicate.

Gel shift assays were used to determine whether the effects of point mutations in the putative SRE on SREBP stimulation of G{alpha} i2 promoter activity reflected actual changes in the binding of SREBP-1a. Data summarized in Figure 4C demonstrated that although purified SREBP-1a formed a complex with a [ 32P]-labeled oligonucleotide containing the wild-type sequence, SREBP-1a did not form significant complexes with any of the three oligonucleotides containing mutant SRE sequences. Finally, we determined the effect of the dominant-negative mutant of SREBP-1 on LPDS stimulated G{alpha}i2 promoter activity. Cotransfection of embryonic chick atrial cells with G{alpha}i2-Luc and the DN-SREBP-1 mutant abolished LPDS stimulation of the G{alpha}i2 promoter activity (Figure 4D).

Specificity of SREBP Subtypes for the Stimulation of G{alpha} i2 Promoter Activity
Although we were able to demonstrate that growth of cells in LPDS stimulated the accumulation of SREBP-1 in the nucleus, we were unable to study the effect of LPDS on SREBP-2. In order to determine the relative specificity of SREBP-2 and/or SREBP-1 for the stimulation of G{alpha}i2 promoter activity, we compared G{alpha}i2 promoter activity in cells cotransfected with G{alpha}i2-Luc and increasing concentrations of a construct expressing either SREBP-2, SREBP-1a, or SREBP-1c. Both SREBP-1a and SREBP-1c demonstrated a 2.6±0.2- and 2.2±0.2-fold stimulation (±SEM, n=3) of G{alpha}i2 promoter activity at 1 µg SREBP DNA, respectively, with a similar concentration dependence, whereas SREBP-2 had a minimal effect (1.3±0.1-fold) only at 1 µg (Figure 5, right). This specificity of SREBP for stimulation of G{alpha} i2 promoter activity is in marked contrast to the specificity and concentration dependence of SREBP stimulation of the LDLR promoter in these cells where SREBP-1a gave a 9.1± 0.6-fold response (±SEM, n=3), SREBP-2 gave a 6± 0.8-fold response (±SEM, n=3), and SREBP-1c gave a 3.5±0.5-fold response (±SEM, n=3) at 1 µg SREBP DNA (Figure 5, left).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Specificity of SREBP stimulation of G{alpha} i2 promoter activity. Experiments were carried out as in Figure 1 except that cells were transfected with 0.2 µg of either G{alpha}i2 -Luc or LDLR-Luc and increasing amounts of either SREBP-2, SREBP-1a, or SREBP-1c. Total DNA was maintained constant at 2 µg by adding the appropriate amounts of pBlueScript DNA. Each point is the mean±SEM for 3 replicate determinations. Data are typical of 3 independent experiments.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
These data are consistent with the conclusion that the growth of embryonic chick atrial cells in LPDS stimulated the expression of G{alpha}i2 via the interaction of SREBP with an SRE in the G{alpha}i2 promoter. Given that growth of cells in the absence of lipoproteins stimulated the accumulation of chick SREBP-1 in the nuclear fraction, the finding that overexpression of SREBP mimicked the effect of LPDS on G{alpha} i2 promoter activity and the demonstration of an SRE consensus sequence in the G{alpha}i2 promoter suggested a role for SREBP in the regulation of G{alpha} i2 expression by LPDS. The finding that the deletion of the SRE-like sequence abolished the response of G{alpha} i2 promoter activity to SREBP overexpression further supported this conclusion. Furthermore, point mutations in the SRE-like sequence of the G{alpha}i2 promoter completely abolished the response of G{alpha}i2 to LPDS and interfered with the binding of purified SREBP to the SRE. Taken together with the finding that the DN-SREBP-1 mutant inhibits LPDS-stimulated G{alpha}i2 promoter activity, these data support the conclusion that LPDS stimulation of G{alpha} i2 promoter activity is mediated by SREBP. SREBPs exhibited a specificity for the stimulation of G{alpha} i2 promoter activity, which was significantly different than that for the LDL receptor promoter with a potency SREBP-1a=SREBP-1c>>SREBP-2, whereas LDL receptor promoter activity was stimulated with a potency of SREBP-1a>SREBP-2>> SREBP-1c. These data suggested that SREBP-1 may play a role in the regulation of G{alpha}i2 expression.

The finding that the fold stimulation of G{alpha} i2 promoter activity by SREBP-1 is significantly less than that for the LDL receptor promoter is due to the fact that basal G{alpha}i2 promoter activity is significantly higher than that for the LDL receptor. The critical point is that stimulation of G{alpha}i2 promoter activity by LPDS or SREBP is statistically significant, reproducible, and abolished by mutants of the SRE-like sequence and by a DN-SREBP mutant. It is likely that the high basal level of G{alpha} i2 promoter activity reflects the fact that, unlike the LDL receptor, the cell requires a higher basal level of expression of G{alpha}i2 in order to carry out essential cellular processes. Although Sp1 and NF-1 sites have been shown to play a role in potentiating SREBP signaling, it remains to be determined whether Sp1 sites found adjacent to the SRE in the G{alpha} i2 promoter are involved in SREBP regulation of G{alpha}i2 promoter activity.15,16

Recent studies in hamsters using both HMG-CoA reductase inhibitors and sterol depletion with bile acids have demonstrated that the expression of SREBP-2 and SREBP-1 is differentially regulated.17 Furthermore, in transgenic mice expressing dominant activating forms of SREBP-2 and SREBP-1, SREBP-2 has been shown to be a relatively selective activator of cholesterol synthesis as opposed to fatty acid synthesis,18 whereas SREBP-1 has been shown to be relatively specific for the regulation of enzymes involved in fatty acid biosynthesis.19,20 Recent data have also demonstrated a role for SREBP-1 as a mediator of insulin action on the expression of glucokinase in liver.21 Although little is known regarding the function of SREBP in the heart, these studies demonstrate a mechanism for the regulation of gene expression by SREBP in cardiac tissue. The finding that SREBP-1 rather than SREBP-2 regulates G{alpha}i2 promoter activity is consistent with the observation that SREBP-1 is relatively specific for the regulation of genes not involved in cholesterol biosynthesis.19,20 Furthermore, this is the first demonstration of SREBP regulation of expression of a protein that does not play an obvious role in lipid metabolism, fatty acid synthesis, or the generation of precursors to fatty acids.

We have previously demonstrated that growth of atrial cells in LPDS coordinately stimulated the expression of M2, G{alpha}i2, and GIRK1 and markedly increased the response of atrial myocytes to parasympathetic stimulation.5 Although data for the regulation of M2 and GIRK1 by SREBP are not yet available, our prior observation that LPDS coordinately regulated the expression of all three genes strongly suggests that M2 and GIRK1 might also be regulated by SREBP. Hence, the entire pathway for the regulation of heart rate by parasympathetic stimulation might be regulated by SREBP. Furthermore, the recent finding that expression of G{alpha}i2 in the porcine heart by intracoronary perfusion with an adenovirus expressing G{alpha} i2 resulted in a decrease in atrioventricular conduction, and a decrease in ventricular rate response to atrial fibrillation is consistent with the conclusion that overexpression of G{alpha}i2 might effect cardiac excitability.3 Although no studies of the parasympathetic response of hearts perfused with adenovirus-expressing G{alpha}i2 were reported, the decrease in excitability in response to the expression of G{alpha} i2 could be related to an increase in parasympathetic tone. Finally, given the role of G{alpha} i2 in the inhibition of cAMP production in response to muscarinic stimulation,22 SREBP stimulation of G{alpha} i2 expression could interfere with the response of the heart to sympathetic stimulation. Given data that suggest a relationship between parasympathetic tone and the development of cardiac arrhythmias,1,22 data presented in the present study suggest a possible new relationship between lipid metabolism and cardiac excitability.


*    Acknowledgments
 
This work was supported by NIH grant (RO1 HL54225). H.J.P. is a recipient of Lynn M. Reid, MD, and Eleanor G. Shore, MD, Fellowship from Harvard Medical School.


*    Footnotes
 
*Both authors contributed equally to this work. Back

Received February 13, 2002; revision received June 6, 2002; accepted June 6, 2002.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Schwartz PJ, La Rovere MT, Vanoli E. Autonomic nervous system and sudden cardiac death: experimental basis and clinical observations for post-myocardial infarction risk stratification. Circulation. 1992; 85: I77–I91.[Medline] [Order article via Infotrieve]

2. Logothetis DE, Kurachi Y, Galper J, Neer EJ, Clapham DE. The ß{gamma} subunits of GTP-binding proteins activate the muscarinic K+ channel in heart. Nature. 1987; 325: 321–326.[CrossRef][Medline] [Order article via Infotrieve]

3. Donahue JK, Heldman AW, Fraser H, McDonald AD, Miller JM, Rade JJ, Eschenhagen T, Marban E. Focal modification of electrical conduction in the heart by viral gene transfer. Nat Med. 2000; 6: 1395–1398.[CrossRef][Medline] [Order article via Infotrieve]

4. Haigh LS, Leatherman GF, O’Hara DS, Smith TW, Galper JB. Effects of low density lipoproteins and mevinolin on cholesterol content and muscarinic cholinergic responsiveness in cultured chick atrial cells: regulation of levels of muscarinic receptors and guanine nucleotide regulatory proteins. J Biol Chem. 1988; 263: 15608–15618.[Abstract/Free Full Text]

5. Gadbut AP, Wu L, Tang D, Papageorge A, Watson JA, Galper JB. Induction of the cholesterol metabolic pathway regulates the farnesylation of RAS in embryonic chick heart cells: a new role for ras in regulating the expression of muscarinic receptors and G proteins. EMBO J. 1997; 16: 7250–7260.[CrossRef][Medline] [Order article via Infotrieve]

6. Goldstein JL, Rawson RB, Brown MS. Mutant mammalian cells as tools to delineate the sterol regulatory element-binding protein pathway for feedback regulation of lipid synthesis. Arch Biochem Biophys. 2002; 397: 139–148.[CrossRef][Medline] [Order article via Infotrieve]

7. Brown MS, Ye J, Rawson RB, Goldstein JL. Regulated intramembrane proteolysis: a control mechanism conserved from bacteria to humans. Cell. 2000; 100: 391–398.[CrossRef][Medline] [Order article via Infotrieve]

8. Gadbut AP, Toupin DK, Kilbourne EJ, Galper JB. Low density lipoproteins induce parasympathetic responsiveness in embryonic chick ventricular myocytes in parallel with a coordinate increase in expression of genes coding for the M2 muscarinic receptor, G{alpha}i2, and the acetylcholine-sensitive K+ channel. J Biol Chem. 1994; 269: 30707–30712.[Abstract/Free Full Text]

9. Vallett SM, Sanchez HB, Rosenfeld JM, Osborne TF. A direct role for sterol regulatory element binding protein in activation of 3-hydroxy-3-methylglutaryl coenzyme A reductase gene. J Biol Chem. 1996; 271: 12247–12253.[Abstract/Free Full Text]

10. Magana MM, Koo SH, Towle HC, Osborne TF. Different sterol regulatory element-binding protein-1 isoforms utilize distinct co-regulatory factors to activate the promoter for fatty acid synthase. J Biol Chem. 2000; 275: 4726–4733.[Abstract/Free Full Text]

11. Kim JB, Spotts GD, Halvorsen YD, Shih HM, Ellenberger T, Towle HC, Spiegelman BM. Dual DNA binding specificity of ADD1/SREBP-1 controlled by a single amino acid in the basic helix-loop-helix domain. Mol Cell Biol. 1995; 15: 2582–2588.[Abstract]

12. Ausubel F, Brent M, Kinston R, Moore RE, Seidmann DD, Smith JG, Struhl J, Struhl K. Short Protocols in Molecular Biology. New York, NY: Wiley; 1992.

13. Yin L, Zhang Y, Hillgartner FB. Sterol regulatory element-binding protein-1 (SREBP-1) interacts with the nuclear thyroid hormone receptor to enhance acetyl-CoA carboxylase-{alpha} transcription in hepatocytes. J Biol Chem. 2002; 277: 19554–19565.[Abstract/Free Full Text]

14. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nuclei Acids Res. 1983; 11: 1475–1489.[Abstract/Free Full Text]

15. Sanchez HB, Yieh L, Osborne TF. Cooperation by sterol regulatory element-binding protein and Sp1 in sterol regulation of low density lipoprotein receptor gene. J Biol Chem. 1995; 270: 1161–1169.[Abstract/Free Full Text]

16. Smith JR, Osborne TF, Brown MS, Goldstein JL, Gil G. Multiple sterol regulatory elements in promoter for hamster 3-hydroxy-3-methylglutaryl-coenzyme A synthase. J Biol Chem. 1988; 263: 18480–18487.[Abstract/Free Full Text]

17. Sheng Z, Otani H, Brown MS, Goldstein JL. Independent regulation of sterol regulatory element-binding proteins 1 and 2 in hamster liver. Proc Natl Acad Sci U S A. 1995; 92: 935–938.[Abstract/Free Full Text]

18. Horton JD, Shimomura I, Brown MS, Hammer RE, Goldstein JL, Shimano H. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J Clin Invest. 1998; 101: 2331–2339.[Medline] [Order article via Infotrieve]

19. Shimano H, Horton JD, Shimomura I, Hammer RF, Brown MS, Goldstein JL. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. J Clin Invest. 1997; 99: 846–854.[Medline] [Order article via Infotrieve]

20. Shimano H, Horton JD, Hammer RE, Shimomura I, Brown MS, Goldstein JL. Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a. J Clin Invest. 1996; 98: 1575–1584.[Medline] [Order article via Infotrieve]

21. Foretz M, Guichard C, Ferre F, Foutelle F. Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc Natl Acad Sci U S A. 1999; 96: 12737–12742.[Abstract/Free Full Text]

22. Eschenhagen T, Mende U, Diederich M, Hertle B, Memmesheimer C, Pohl A, Schmitz W, Scholz H, Steinfath M, Bohm M, Michel MC, Brodde OE, Raap A. Chronic treatment with carbachol sensitizes the myocardium to cAMP-induced arrhythmia. Circulation. 1996; 93: 763–771.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Z. Zuberi, L. Birnbaumer, and A. Tinker
The role of inhibitory heterotrimeric G proteins in the control of in vivo heart rate dynamics
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2008; 295(6): R1822 - R1830.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
91/1/32    most recent
01.RES.0000026502.79063.66v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, H.-J.
Right arrow Articles by Galper, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, H.-J.
Right arrow Articles by Galper, J. B.
Related Collections
Right arrow Gene regulation
Right arrow Lipid and lipoprotein metabolism