Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Circulation Research. 2002;90:1012-1019
Published online before print April 4, 2002, doi: 10.1161/01.RES.0000017631.28815.8E
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/9/1012    most recent
01.RES.0000017631.28815.8Ev1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frey, R. S.
Right arrow Articles by Malik, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frey, R. S.
Right arrow Articles by Malik, A. B.
Related Collections
Right arrow Oxidant stress
Right arrow Other Vascular biology
Right arrow Cell signalling/signal transduction
(Circulation Research. 2002;90:1012.)
© 2002 American Heart Association, Inc.

Molecular Medicine

PKC{zeta} Regulates TNF-{alpha}–Induced Activation of NADPH Oxidase in Endothelial Cells

Randall S. Frey*, Arshad Rahman*, John C. Kefer, Richard D. Minshall, Asrar B. Malik

From the Departments of Pharmacology (R.S.F., A.R., J.C.K., R.D.M., A.B.M.) and Anesthesiology (R.D.M.), University of Illinois College of Medicine, Chicago, Ill.

Correspondence to Arshad Rahman, Dept of Pharmacology, The University of Illinois, College of Medicine, 835 South Wolcott Ave (m/c 868), Chicago, IL 60612-7343. E-mail ARahman{at}uic.edu


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMaterials and Methods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Although oxidant generation by NADPH oxidase is known to play an important role in signaling in endothelial cells, the basis of activation of NADPH oxidase is incompletely understood. The atypical isoform of protein kinase C, PKC{zeta}, has been implicated in the mechanism of tumor necrosis factor-{alpha} (TNF-{alpha})–induced oxidant generation in endothelial cells; thus, in the present study, we have addressed the role of PKC{zeta} in regulating NADPH oxidase function. We showed by immunoblotting and confocal microscopy the presence of the major cytosolic NADPH oxidase subunits, p47phox and membrane-bound gp91phox in human pulmonary artery endothelial (HPAE) cells. TNF-{alpha} failed to activate oxidant generation in lung vascular endothelial cells derived from p47phox-/- and gp91phox-/- mice, indicating the requirement of NADPH oxidase in mediating the oxidant generation in endothelial cells. Stimulation of HPAE cells with TNF-{alpha} resulted in the phosphorylation of p47phox and its association with gp91phox. Inhibition of PKC{zeta} by multiple pharmacological and genetic approaches prevented the TNF-{alpha}–induced phosphorylation of p47phox, and its translocation to the membrane. PKC{zeta} was shown to colocalize with p47phox, and inhibition of PKC{zeta} activation prevented the interaction of p47phox with gp91phox induced by TNF-{alpha}. Furthermore, inhibition of association of p47phox with gp91phox prevented the oxidant generation in endothelial cells. These data demonstrate a novel function of PKC{zeta} in signaling oxidant generation in endothelial cells by the activation of NADPH oxidase, which may be important in mediating endothelial activation responses.


Key Words: tumor necrosis factor-&agr • protein kinase C&zgr • NADPH oxidase • endothelial cells


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMaterials and Methods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Oxidant generation in the endothelium may have an important role in signal transduction, gene expression, cell proliferation, apoptosis, and in the pathophysiology of various diseases such as acute respiratory distress syndrome (ARDS) and tissue injury from ischemia/reperfusion.1–7 Studies have shown that oxidant generation is involved in the signaling cascade mediating the tumor necrosis factor-{alpha} (TNF-{alpha})–induced activation of nuclear factor (NF)–{kappa}B and expression of adhesion molecules such as ICAM-1 in endothelial cells.2–4 Despite the requirement of oxidant signaling in these responses, the upstream regulation of oxidant production in endothelial cells is not known.

NADPH oxidase is a highly regulated membrane-bound enzyme complex that catalyzes the 1-electron reduction of oxygen to superoxide anion with the simultaneous oxidation of cytosolic NADPH. Components of NADPH oxidase complex include the membrane-bound cytochromeb558, composed of 2 subunits, p22phox and gp91phox, and 4 cytosolic subunits, p47phox, p67phox, p40phox, and the small GTP-binding protein, Rac1/Rac2.8,9 Assembly of the active NADPH oxidase complex requires the translocation of the cytosolic factors, p47phox, p67phox, and Rac1/Rac2 to the plasma membrane where these components interact with cytochrome b558.8–10 During complex assembly, p47phox first interacts with cytochrome b558.11 Translocation is initiated by signaling events, including the phosphorylation of p47phox, which contains a number of protein kinase C (PKC), protein kinase A (PKA), and mitogen-activated protein kinase (MAPK) phosphorylation sites (RXXS/TXRX, RRXS, and PXSP, respectively).12,13 Although NADPH oxidase has been implicated in oxidant signaling in endothelial cells, there is little information on the regulation of NADPH oxidase activation and the generation of oxidants. In the present study, we addressed the role of PKC, a family of serine/threonine kinases,14–16 in mediating NADPH oxidase activation in endothelial cells. PKC isoforms are classified into three groups based on their structure and activation mechanisms: phosphatidylserine (PS)-, diacylglycerol (DAG)-, and Ca2+-dependent conventional PKC (cPKC; {alpha}, ßI, ßII, and {gamma}), Ca2+-independent novel PKC (nPKC; {delta}, {epsilon}, µ, {theta}, and {eta}) isoforms, and DAG-, and Ca2+-independent atypical PKC (aPKC; {zeta}, and {lambda}/{iota}) isoforms. Tissue distribution of PKC-{alpha}, -{delta}, and -{zeta} is widespread, whereas the others are localized in a tissue- and cell type–specific manner. In addition to PKC-{alpha}, -{delta}, and -{zeta}, endothelial cells also express the PKC-ß, -{epsilon}, -{eta}, and -{theta} isoforms.17,18 In a previous study, we showed that TNF-{alpha}–induced oxidant generation requires the activation of PKC{zeta},18 the atypical PKC isoform abundantly expressed in endothelial cells. In the present study, we investigated mechanisms by which PKC{zeta} induces endothelial oxidant generation. We show that PKC{zeta} is required for signaling oxidant generation in response to TNF-{alpha} and does so through the activation of NADPH oxidase. The mechanism of activation involves PKC{zeta}-induced phosphorylation of p47phox and its targeting to the membrane where it associates with gp91phox to generate the active NADPH oxidase complex.


*    Materials and Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Materials and Methods
down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Materials
Human recombinant TNF-{alpha} with a specific activity of 2.3x107 was purchased from Promega (Madison, Wis). Monoclonal and polyclonal antibodies against p47phox or gp91phox subunit of NADPH oxidase were kindly provided by Ulla G. Knaus and Bernard M. Babior (The Scripps Research Institute, La Jolla, Calif), Michio Nakamura (Nagasaki University, Nagasaki, Japan), and Mark T. Quinn (Montana State University, Bozeman, Mont). The synthetic peptide PR-39, an inhibitor of NADPH oxidase assembly, was a kind gift from Chris Ross (Kansas State University College of Veterinary Medicine, Manhattan, Kans). The following items were purchased: monoclonal antibody to PKC{zeta} (Alexis Biochemicals), secondary Western blotting antibodies (Santa Cruz Biotechnology), nitrocellulose membrane from Bio-Rad Laboratories; phorbol esters (PMA) and calphostin C from Sigma Chemical; chelerythrine from Calbiochem-Novabiochem Corp; bicinchoninic acid (BCA) protein assay reagents were from Pierce. Myristoylated membrane-permeable peptide inhibitor of PKC{zeta} and PKC{theta} were obtained from BioSource International. All other materials were from Sigma.

Endothelial Cell Cultures
Human pulmonary artery endothelial (HPAE; Clonetics, La Jolla, Calif) cells were cultured as described18 in gelatin-coated flasks using endothelial basal medium 2 (EBM2) with bullet kit additives. Mouse lung vascular endothelial cell cultures were obtained from wild-type and p47phox-/- and gp91phox-/- mice. The knockout mice19,20 were provided by Drs Mary C. Dinauer (University of Indiana School of Medicine, Indianapolis, Ind) and Steven M. Holland (NIH, Bethesda, Md). Mice were housed in the University of Illinois Animal Care Facilty in specific pathogen-free conditions with free access to food and water. Studies were performed in accordance with institutional and NIH guidelines and after approval from the Institutional Review Board. Mouse endothelial cells were cultured as described by us.21

Immunoprecipitation and Immunoblotting
HPAE cells were washed with ice-cold TBS and lysed in 10 mmol/L Tris-HCl (pH 7.5), 5 mmol/L EDTA, 10 mmol/L EGTA, 50 µg/mL PMSF, and a mixture of protease inhibitors. Lysates were sonicated for 10 seconds and then ultracentrifuged at 100 000g for 1 hour at 4°C, and the supernatants were collected and designated cytosolic fraction. The remaining pellets were resuspended in the above lysis buffer containing 1% Triton X-100, sonicated, and incubated for 30 minutes at 4°C. These lysates were microfuged at 4°C, and the supernatants were designated membrane fraction. For study of association of p47phox with gp91phox, 300 µg precleared lysates were incubated with 10 µL monoclonal anti-gp91phox IgG for 1 hour at 4°C. Immunocomplexes were Western blotted as described.18

Phosphorylation of p47phox
HPAE cells grown to confluence were washed and incubated with [32P]orthophosphate (100 µCi/dish) in phosphate-free medium overnight. Cells were lysed with 1 mL of lysis buffer (10 mmol/L Tris-HCl, pH 7.5, 1 mmol/L EDTA, 1 mmol/L EGTA, 0.5% NP40, 1 mmol/L Na3VO4, 150 mmol/L NaCl, 50 µg/mL PMSF, 1% Triton X-100, 50 mmol/L NaF, 30 mmol/L NaPPi, and protease inhibitors). p47phox was immunoprecipitated from the lysates as described above. Immunocomplexes were washed and resolved by 4% to 15% SDS/PAGE. Gels were transferred to nitrocellulose, and the phosphorylated form of p47phox was detected by autoradiography.

Immunofluorescence
HPAE cells grown on gelatinized cover slips were treated as indicated, washed with HBSS and fixed in 4% paraformaldehyde, and blocked with 5% goat serum containing 0.2% BSA, 0.01% NaN3, and 0.1% Triton X-100. Thereafter, cells were incubated for 1 hour at room temperature with 1 µg of the indicated primary antibody. After 3 washes in HBSS, 4 µg/mL secondary Ab conjugated with rhodamine or fluorescene (Molecular Probes) was added for an additional 2 hours at room temperature. Cells were extensively washed in HBSS, mounted on glass slides with ProLong Antifade mounting media (Molecular Probes), and images were acquired with the Zeiss LSM 510 confocal microscope.

Oxidant Generation
Oxidant generation in HPAE cells was measured as described18 with slight modifications. After treatment, cells were washed x2 with HBSS and fixed in 4% paraformaldehyde for 20 minutes at room temperature. Cultures were then viewed with fluorescence microscopy.

Transfection of HPAE Cells
Phosphorothioate oligonucleotides to PKC{zeta} sense (ATGCCCAGCAGGACC) and antisense (GGTCCTGCTGGGCAT) have been previously described.22,23 Both are targeted to the translation initiation codon of PKC{zeta} mRNA. Phosphorothioate antisense oligonucleotide to PKC{alpha} (GTTCTCGCTGGTGAGTTTCA) is directed to the 3'-untranslated region of PKC{alpha} mRNA. Oligonucleotides were transfected using Lipofectin (GIBCO-BRL) as described.3,18 The expression vector pcDNA3 containing HA-tagged kinase defective PKC-{zeta}, -{alpha}, and -{epsilon} isoforms and catalytically active PKC{zeta} mutant24 were gifts from Dr Jae-Won Soh (Columbia University, New York, NY) and were transfected as described.22


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMaterials and Methods
 *Results
down arrowDiscussion
 down arrowReferences
 
TNF-{alpha} Induces Phosphorylation and Translocation of p47phox in Endothelial Cells
We determined the phosphorylation status of p47phox, a requirement for activation NADPH oxidase.13,25,26 TNF-{alpha} challenge of HPAE cells induced p47phox phosphorylation in a time-dependent manner. Phosphorylated form of p47phox increased as early as 1 minute, peaked at 5 minutes after TNF-{alpha} challenge, and declined after 15 minutes (Figure 1A). We next determined whether p47phox phosphorylation was accompanied by its translocation to the membrane. Time course of membrane translocation of p47phox was shown to parallel phosphorylation of p47phox, except that remained membrane-associated even at 15 minutes after TNF-{alpha} challenge (Figure 1B) and returned to the basal level by 30 minutes (data not shown).



View larger version (14K):
[in this window]
[in a new window]
  		Figure 1. TNF-{alpha} induces phosphorylation and membrane translocation of p47phox in endothelial cells. A, HPAE cells were metabolically labeled with 32P-orthophosphate, treated for the indicated times with TNF-{alpha} (500 U/mL), and p47phox was immunoprecipitated from cell lysates. Immunoprecipitates were subjected to SDS/PAGE, transferred to nitrocellulose membranes, and autoradiography was performed. B, HPAE cells were treated with TNF-{alpha} (500 U/mL) for the indicated times. Membrane fractions were prepared and equal amounts of protein were analyzed by SDS/PAGE and immunoblotted with the antibody against p47phox. Results are representative of 3 separate experiments.

TNF-{alpha} Induces Association of p47phox With gp91phox
To determine if membrane translocation of p47phox resulted in the association with gp91phox, membrane fractions from control and TNF-{alpha}–treated HPAE cells were immunoprecipitated with an antibody against gp91phox and immunoblotted with an antibody against p47phox. Results showed that TNF-{alpha} promoted the association of p47phox with gp91phox (Figure 2A). Confocal immunofluorescence confirmed the association of p47phox with gp91phox induced by TNF-{alpha} (Figure 2B). In resting cells, p47phox was localized in cytosol (Figure 2B). TNF-{alpha} stimulation of HPAE cells increased the staining of p47phox throughout the cytosol, especially in the perinuclear region (Figure 2B). Double labeling with antibodies against p47phox (red) and cytochrome b558 (green) yielded strong yellow-orange staining in TNF-{alpha}–stimulated HPAE cells (Figure 2B) indicative of colocalization.



View larger version (45K):
[in this window]
[in a new window]
  		Figure 2. TNF-{alpha} induces association of p47phox with gp91phox. A, HPAE cells were stimulated with TNF-{alpha} (500 U/mL) for the indicated times and membrane fractions were prepared. gp91phox was immunoprecipitated, subjected to SDS-PAGE, and then transferred to nitrocellulose membranes. Membranes were immunoblotted with the antibody against p47phox. Bar graph represents the relative binding of p47phox with gp91phox for each condition in A. B, Cells were stimulated with TNF-{alpha} (500 U/mL) for 15 minutes, fixed with 4% paraformaldehyde, and stained with antibodies against p47phox and cytochrome b558 as described in Materials and Methods. Results are representative of 3 separate experiments.

Inhibition of PKC{zeta} Prevents TNF-{alpha}–Induced Phosphorylation and Targeting of p47phox
We used general and isoform-specific inhibitors to delineate the involvement of PKC{zeta} in mediating the translocation of p47phox. Confocal imaging and Western blotting showed that pretreatment of HPAE cells with PKC inhibitors, calphostin C and chelerythrine, prevented TNF-{alpha}–induced translocation of p47phox (Figures 3A and 3B). In another experiment, we observed that depletion of cPKC and nPKC by prolonged exposure of HPAE cells to phorbol esters (500 nmol/L; 20 hours)18 failed to prevent membrane targeting of p47phox induced by TNF-{alpha} (Figure 3C), thus excluding the involvement of cPKC and nPKC in the mechanism of the response.



View larger version (28K):
[in this window]
[in a new window]
  		Figure 3. A and B, Inhibitors of PKC prevent TNF-{alpha}–induced translocation of p47phox. A, HPAE cells were pretreated with 100 nmol/L calphostin C (Cal C) for 30 minutes and stimulated with TNF-{alpha} (500 U/mL) for 15 minutes as described in Materials and Methods. Cells were then fixed and stained with an antibody against p47phox. Results are representative of 3 separate experiments. B, HPAE cells were pretreated with 5 µmol/L chelerythrine chloride for 1 hour before stimulation with TNF-{alpha} (500 U/mL) for 5 minutes. Membrane fractions were prepared and equal amounts of protein were analyzed by SDS/PAGE and immunoblotted with an antibody against p47phox. Results are representative of 2 separate experiments. C, Phorbol ester–induced depletion of cPKC and nPKC isoforms fails to prevent TNF-{alpha}–induced translocation of p47phox. HPAE cells were treated without (-) or with (+) PMA (500 nmol/L in 10% FBS/EBM-2) for 20 hours followed by stimulation with TNF-{alpha} for 15 minutes. Membrane fractions were prepared and equal amounts of protein were analyzed by SDS/PAGE and immunoblotted with the antibody against p47phox. Results are representative of 2 separate experiments.

We next determined the possibility that aPKC isoforms are involved in the mechanism of TNF-{alpha}–induced membrane translocation of p47phox and NADPH oxidase activation. Myristoylated membrane-permeable peptide antagonist or antisense oligonucleotide (which specifically inhibit the function or synthesis of PKC{zeta},18,27 an abundantly expressed aPKC isoform in endothelial cells) was used to address the role of this PKC isoform in mediating the response. Preincubation of cells with PKC{zeta} peptide inhibitor prevented TNF-{alpha}–induced membrane translocation of p47phox (Figures 4A and 4B). The antisense oligonucleotide to PKC{zeta}, which inhibits the expression of PKC{zeta},18 also prevented TNF-{alpha}–induced membrane targeting of p47phox (Figure 4C). In contrast, antisense oligonucleotide to PKC{alpha} failed to modify the TNF-{alpha} response (Figure 4C). We also determined the effects of kinase-defective mutant of PKC{zeta} (PKC{zeta}K281R) on the membrane translocation of p47phox. Expression of PKC{zeta}K281R prevented the TNF-{alpha}–induced membrane targeting of p47phox, whereas in control experiments, inhibition of PKC{alpha} by the kinase-defective mutant (PKC{alpha}K368R) failed to prevent the response (Figure 4D).



View larger version (33K):
[in this window]
[in a new window]
  		Figure 4. A and B, PKC{zeta} peptide inhibitor prevents TNF-{alpha}–induced translocation of p47phox. A, HPAE cells were treated with a myristoylated membrane-permeable peptide antagonist of PKC{zeta} (10 µmol/L) for 0.5 hours followed by stimulation with TNF-{alpha} (500 U/mL) for 15 minutes. Cells were then fixed with 4% paraformaldehyde, stained with anti-p47phox antibody (red) as described in Materials and Methods, and analyzed by confocal microscopy. Cells were also stained with 4',6-diamidino-2-phenylindole (blue) to view the nucleus. B, HPAE cells were treated with PKC{zeta} peptide antagonist (10 µmol/L) for 0.5 hours before stimulation with TNF-{alpha} (500 U/mL) for 5 minutes. Membrane and cytosolic fractions were prepared, and equal amounts of protein were analyzed by SDS/PAGE and immunoblotted with an antibody against p47phox. Results are representative of 2 separate experiments. C, Antisense oligonucleotide to PKC{zeta} inhibits TNF-{alpha}–induced translocation of p47phox. HPAE cells were transfected with 0.25 µmol/L sense or antisense oligonucleotide to PKC{zeta} or antisense oligonucleotide to PKC{alpha} as described in Materials and Methods. After 36 to 48 hours, cells were stimulated for 15 minutes with TNF-{alpha} (500 U/mL). Membrane fractions were prepared and equal amounts of protein were analyzed by SDS/PAGE and immunoblotted with an antibody against p47phox. D, Dominant-negative PKC{zeta} inhibits TNF-{alpha}–induced translocation of p47phox. HPAE cells were transfected with empty vector pcDNA3 or constructs encoding dominant-negative form of PKC{zeta} (PKC{zeta}K281R) or PKC{alpha} (PKC{alpha}K368R) isozymes. Cells were stimulated in the absence or presence of TNF-{alpha} for 15 minutes. Cells were fixed, permeabilized, and stained with antibodies to HA and p47phox and confocal images were taken as described in Materials and Methods. Results are representative of 3 separate experiments. E, Effects of catalytically active PKC{zeta} (PKC{zeta}-CAT) on p47phox staining and translocation. HPAE cells were transfected with 1 µg PKC{zeta}-CAT lacking the regulatory domain of PKC{zeta}. Cells were fixed with 4% paraformaldehyde, stained with a mouse monoclonal HA antibody (green, left) in combination with a rabbit anti-p47phox antibody (red, middle) and 4',6-diamidino-2-phenylindole (blue, right) to view the nucleus. Slides were mounted and analyzed by confocal microscopy. Results are representative of 2 separate experiments.

Expression of kinase-defective mutant of PKC{epsilon} (PKC{epsilon}K437R) also failed to inhibit the response (data not shown). In another experiment, we showed that expression of constitutively active PKC{zeta} mutant induced membrane targeting of p47phox in the absence of TNF-{alpha} challenge (Figure 4E). Thus, these data indicate that PKC{zeta} is required and sufficient to mediate the TNF-{alpha}–induced membrane translocation of p47phox.

As p47phox phosphorylation is required for NADPH oxidase activation,13,25,26 we evaluated whether PKC{zeta} is involved in mediating the phosphorylation of p47phox. Inhibition of PKC{zeta} by the specific peptide antagonist27 prevented TNF-{alpha}– induced p47phox phosphorylation (Figure 5A). In contrast, inhibition of PKC{theta} had no effect on this response (Figure 5A). We determined the ability of PKC{zeta} to associate with p47phox after TNF-{alpha} challenge because this may be required for phosphorylation. Analysis by confocal microscopy showed ubiquitous staining of PKC{zeta} (green) and general cytosolic and perinuclear staining of p47phox (red), without apparent colocalization (Figure 5B). However, TNF-{alpha} stimulation of HPAE cells altered the cellular distribution of both PKC{zeta} and p47phox, resulting in colocalization of PKC{zeta} with p47phox (Figure 5B). In contrast, phorbol esters (PMA) failed to induce the same pattern of colocalization of PKC{zeta} with p47phox (data not shown). In another control experiment, we determined that TNF-{alpha} failed to induce the colocalization of PKC{alpha} with p47phox (data not shown). Thus, activation of PKC{zeta} is involved in the phosphorylation p47phox and its targeting to the membrane in response to TNF-{alpha} challenge of endothelial cells.



View larger version (39K):
[in this window]
[in a new window]
  		Figure 5. A, Inhibition of PKC{zeta} prevents TNF-{alpha}–induced phosphorylation of p47phox. HPAE cells were metabolically labeled with 32P-orthophosphate, treated with peptide antagonist of PKC{zeta} or PKC{theta} for 1 hour before stimulation with TNF-{alpha} (500 U/mL) for 5 minutes. p47phox was immunoprecipitated, subjected to SDS/PAGE, transferred to nitrocellulose membranes, and autoradiography was performed. Results are representative of 2 separate experiments. B, TNF-{alpha} induces association of PKC{zeta} with p47phox. HPAE cells were left untreated (top) or stimulated with TNF-{alpha} (bottom, 500 U/mL; 5 minutes). Cells were fixed with 4% paraformaldehyde, stained with a rabbit polyclonal anti-p47phox antibody (red, left) in combination with a rat monoclonal anti-PKC{zeta} antibody (green, middle) and 4',6-diamidino-2-phenylindole (blue, right) to view the nucleus. Slides were mounted and analyzed by confocal microscopy. TNF-{alpha} stimulation induces the colocalization of p47phox with PKC{zeta} as indicated by orange and yellow staining (right, bottom). Results are representative of 4 separate experiments. Scale bar=10 µm for all panels.

Inhibition of PKC{zeta} Prevents TNF-{alpha}–Induced Association of p47phox With gp91phox and Oxidant Generation
We evaluated the effects of inhibition of PKC{zeta} on TNF-{alpha}–induced association of p47phox with gp91phox and resultant oxidant generation in HPAE cells. Coimmunoprecipitation studies showed that pretreatment of cells with the peptide antagonist of PKC{zeta} inhibited the TNF-{alpha}–induced association of p47phox with gp91phox (Figure 6A). This finding is consistent with the role of PKC{zeta} in phosphorylating and membrane targeting of p47phox as described in Figure 4. We used the fluorescent redox-sensitive dye carboxy-H2DCFDA to determine if the effects of PKC{zeta} inhibition in TNF-{alpha}–induced NADPH oxidase assembly prevented the oxidant generation. Cells were challenged with TNF-{alpha} for 1 hour to allow maximum oxidant accumulation during this period. Control cells showed little fluorescence. In contrast, TNF-{alpha} induced marked oxidant generation (Figure 6B), which was evident as early as 5 minutes after TNF-{alpha} exposure of HPAE cells (data not shown). Inhibition of PKC{zeta} by the peptide antagonist prevented TNF-{alpha}–induced oxidant generation (Figure 6B). In another experiment in lung vascular endothelial cells obtained from p47phox-/- and gp91phox-/- mice, we showed that TNF-{alpha} failed to activate oxidant generation (Figure 7). These data indicate that PKC{zeta} is crucial in signaling NADPH oxidase activation and oxidant generation in endothelial cells.



View larger version (44K):
[in this window]
[in a new window]
  		Figure 6. A, Inhibition of PKC{zeta} prevents TNF-{alpha}–induced association of p47phox with gp91phox. HPAE cells were treated with PKC{zeta} peptide inhibitor for 30 minutes before stimulation for 5 minutes with TNF-{alpha} (500 U/mL). gp91phox was immunoprecipitated, subjected to SDS-PAGE, and then transferred to nitrocellulose membranes. Membranes were immunoblotted with the antibody against p47phox. Results are representative of 2 separate experiments. B, Inhibition of TNF-{alpha}–induced association of p47phox with gp91phox prevents oxidant production. HPAE cells were loaded with 10 µmol/L carboxy-H2DCFDA dye for 1 hour. Cells were washed, treated with or without PKC{zeta} peptide inhibitor for 30 minutes, and then stimulated with TNF-{alpha} for 60 minutes to yield maximum oxidant accumulation. Cells were fixed with 4% paraformaldehyde and analyzed by fluorescence microscopy as described in Materials and Methods. b, Relative fluorescence intensities for each condition in B were determined, compiled, and partitioned into 4 brightness classes1–4 with class 1 representing the lowest fluorescence intensity. Relative fluorescence intensity for cells stimulated with TNF-{alpha} was shifted to the higher fluorescence intensity classes compared with control cells. Pretreatment with PKC{zeta} peptide antagonist inhibited the TNF-{alpha}–induced shift to the higher fluorescence intensity classes. Data are mean±SD; n=3.



View larger version (48K):
[in this window]
[in a new window]
  		Figure 7. TNF-{alpha} fails to induce oxidant generation in lung vascular endothelial cells derived from p47phox-/- or gp91phox-/- mice. Mouse lung vascular endothelial cells were isolated as described in Materials and Methods. Cells were loaded with 10 µmol/L carboxy-H2DCFDA dye for 1 hour, washed, and then stimulated with TNF-{alpha} (500 U/mL). Cells were fixed with 4% paraformaldehyde and analyzed by fluorescence microscopy as described in Materials and Methods. Cells from wild-type (wt) mice showed oxidant accumulation within 20 minutes stimulation with TNF-{alpha}. In contrast, no oxidant production was detected in endothelial cells isolated from p47phox-/- or gp91phox-/- mice even after 60-minute stimulation with TNF-{alpha}. Results are representative of 2 experiments.


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMaterials and Methods
 up arrowResults
 *Discussion
down arrowReferences
 
We investigated the basis of NADPH oxidase activation in endothelial cells because oxidant signaling triggered by this complex has an important function in mediating TNF-{alpha}–induced activation of NF-{kappa}B and resultant expression of adhesion molecules such as ICAM-1.2–4 The present results show that the atypical PKC isoform PKC{zeta} plays a critical role in signaling NADPH oxidase activation and the generation of oxidants in TNF-{alpha}–exposed endothelial cells. The mechanism of NADPH oxidase activation involved PKC{zeta}-induced phosphorylation of p47phox, thus targeting this subunit to endothelial membranes where it associated with gp91phox.

We have used several independent pharmacological and genetic approaches to define the role of the PKC{zeta} isoform in mediating NADPH oxidase activation. First, we showed that chelerythrine and calphostin C, broad spectrum inhibitors of PKC,18 prevented the TNF-{alpha}–induced membrane translocation of p47phox. To exclude the involvement of cPKC and nPKC isoforms in the mechanism, we depleted both cPKC and nPKC (but not the aPKC isoforms) by prolonged exposure of endothelial cells to PMA.18 Depletion of cPKC and nPKC failed to prevent membrane translocation of p47phox in response to TNF-{alpha} challenge. These results pointed to the involvement of aPKC isoform such as PKC{zeta} in the membrane targeting of p47phox. Although the present studies show an important role of PKC{zeta} in the TNF-{alpha}–induced membrane translocation of p47phox and NADPH oxidase activation, it is possible that cPKC and nPKC isoforms signal activation of NADPH oxidase in response to other agonists, such as thrombin, which activate 7 transmembrane G protein–coupled receptors.28 PKC{alpha}, PKCß, and PKC{delta} have been shown to contribute to the assembly and activation of NADPH oxidase in a stimulus- and cell-specific manner.29–31

To delineate the specific role of PKC{zeta} signaling as a requirement for the TNF-{alpha}–induced activation of NADPH oxidase in endothelial cells, we used 3 different approaches in which PKC{zeta} activation was inhibited. First, pretreatment of HPAE cells with a myristoylated membrane-permeable peptide antagonist corresponding to the pseudosubstrate region of PKC{zeta}, known to inhibit protein kinase activity,32 markedly decreased TNF-{alpha}–induced membrane translocation of p47phox. Second, inhibition of PKC{zeta} synthesis by antisense oligonucleotide18,23 also blocked the membrane translocation of p47phox induced by TNF-{alpha}. In contrast, inhibition of PKC{theta} or PKC{alpha} failed to prevent the TNF-{alpha} response. Third, expression of kinase-defective mutant of PKC{zeta} prevented TNF-{alpha}–induced p47phox translocation, whereas expression of the mutants of PKC{alpha} and PKC{epsilon} isoforms had no effect. Finally, in a gain of function experiment, we showed that expression of the constitutively active PKC{zeta} increased p47phox translocation. Taken together, these results show the critical role of PKC{zeta} in signaling TNF-{alpha}–induced p47phox activation.

We next addressed whether the role of PKC{zeta}-induced phosphorylation of p47phox is requirement for NADPH oxidase activation. Studies have shown that phosphorylation causes a conformational change in p47phox, which releases the complexed p47phox and allows its translocation and association to membrane-bound cytochrome b558.33 We observed that TNF-{alpha} induced time-dependent phosphorylation of p47phox, paralleling the membrane translocation of p47phox and activation of NADPH oxidase. These data are in accord with the finding of Dang et al34 showing that p47phox is an in vitro substrate for PKC{zeta}. We also showed that inhibition of PKC{zeta} activation prevented the TNF-{alpha}–induced phosphorylation of p47phox, indicating the causal role of PKC{zeta} in the response.

The finding that PKC{zeta} is required for phosphorylation of p47phox led us to examine if PKC{zeta} directly phosphorylates p47phox or an intermediate kinase is activated that in turn is responsible for phosphorylation. Our results showed that TNF-{alpha} induced the colocalization of PKC{zeta} with p47phox, whereas in control studies PMA failed to produce the same pattern of PKC{zeta} and p47phox association. In another control experiment, TNF-{alpha} failed to cause the colocalization of PKC{alpha} with p47phox. Thus, these data show that activation of PKC{zeta} is involved in the phosphorylation of p47phox and its targeting to the membrane in response to TNF-{alpha} challenge of endothelial cells. The present findings show that p47phox is a substrate of PKC{zeta}; however, it is possible that PKC{zeta} may also phosphorylate p47phox through MAP kinases (ERK1/2 and p38), which are known to signal downstream of PKC{zeta}.35–37

To address the functional effects of phosphorylation of p47phox and its translocation to the membrane, we assessed the assembly of NADPH oxidase complex and its effect on oxidant generation. The data showed that inhibition of phosphorylation and membrane translocation of p47phox induced by blocking PKC{zeta} activation prevented the association of p47phox with gp91phox as well as oxidant generation. Results also showed that pretreatment of HPAE cells with an endogenous proline-arginine (PR)–rich antibacterial peptide, PR-39, known to inhibit NADPH oxidase assembly through interaction with Src homology 3 domains of p47phox, 38 prevented the TNF-{alpha}–induced assembly of NADPH oxidase complex and oxidant generation (data not shown). We further demonstrated that TNF-{alpha} failed to activate oxidant generation in lung vascular endothelial cells derived from p47phox-/- and gp91phox-/- mice. It should be noted that there is a controversy concerning the role of gp91phox in nonphagocytic cells, and on the relative importance of Nox-1, a homologue of gp91phox39, (or other members of Nox family)39 in these cells. However, the present data are consistent with an important role of gp91phox in the mechanism of oxidant generation in endothelial cells.40–42

The site of oxidant generation activated by NADPH oxidase in endothelial cells is unclear. The finding that p47phox fluorescence after TNF-{alpha} challenge did not appear as a ring associated with the plasma membrane suggests an intracellular source of oxidants. The previous finding that endothelial NADPH oxidase components (gp91phox and p22phox) are localized in the endoplasmic reticulum42 supports an intracellular source of oxidants,40,41 whereas other studies have shown extracellular production of superoxide anion (O2·-) in endothelial cells.43,44 Thus in the present study, we cannot exclude that there is also extracellular oxidant generation induced by the NADPH oxidase complex in these cells.

In summary, the present study implicates PKC{zeta} as the critical kinase that signals TNF-{alpha}–induced oxidant generation in endothelial cells through the activation of NADPH oxidase. The activation of NADPH oxidase was dependent on PKC{zeta}-induced phosphorylation of p47phox. Inhibition of PKC{zeta} activity or its expression prevented the TNF-{alpha}–induced NADPH oxidase assembly and oxidant production. Thus, strategies aimed at preventing TNF-{alpha}–induced PKC{zeta} activation and oxidant signaling may be useful in controlling the inflammatory components of diseases such as ARDS and ischemia/reperfusion tissue injury.


*    Acknowledgments
 
This work was supported by National Institutes of Health grants HL27016, HL46350, HL45638, and HL67424.


*    Footnotes
 
*Both authors contributed equally to this work. Back

Received December 12, 2001; revision received March 5, 2002; accepted March 27, 2002.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMaterials and Methods
 up arrowResults
 up arrowDiscussion
 *References
 

  1. Nishida M, Maruyama Y, Tanaka R, Kontani K, Nagao T, Kurose H. G{alpha}i, and G{alpha}o are target proteins of reactive oxygen species. Nature. 2000; 408: 492–495.[CrossRef][Medline] [Order article via Infotrieve]
  2. Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-{kappa}B transcription factor and HIV-1. EMBO J. 1991; 10: 2247–2258.[Medline] [Order article via Infotrieve]
  3. Rahman A, Bando M, Kefer J, Anwar KN, Malik AB. Protein kinase C-activated oxidant generation in endothelial cells signals intercellular adhesion molecule-1 gene transcription. Mol Pharm. 1999; 55: 575–583.[Abstract/Free Full Text]
  4. Rahman A, Kefer J, Bando M, Niles WD, Malik AB. E-selectin expression in human endothelial cells by TNF-{alpha}–induced oxidant generation and NF-{kappa}B activation. Am J Physiol. 1998; 275: L533–L544.[Medline] [Order article via Infotrieve]
  5. Griendling KK, Alexander RW. Endothelial control of the cardiovascular system: recent advances. FASEB J. 1996; 10: 283–292.[Abstract]
  6. Al-Mehdi AB, Zhao G, Dodia C, Tozawa K, Costa K, Muzykantov V, Ross C, Blecha F, Dinauer M, Fisher AB. Endothelial NADPH oxidase as the source of oxidants in lungs exposed to ischemia or high K+. Circ Res. 1998; 83: 730–707.[Abstract/Free Full Text]
  7. Abe JI, Baines CP, Berk BC. Role of mitogen-activated protein kinases in ischemia and reperfusion injury: the good and the bad. Circ Res. 2000; 86: 692–699.[Abstract/Free Full Text]
  8. Abo A, Pick E, Hall A, Totty N, Teahan CG, Segal AW. Activation of the NADPH oxidase involves the small GTP-binding protein p21rac1. Nature. 1991; 353: 668–670.[CrossRef][Medline] [Order article via Infotrieve]
  9. Rotrosen D, Yeung CL, Leto TL, Malech HL, Kwong CH. Cytochrome b558: the flavin-binding component of the phagocyte NADPH oxidase. Science. 1992; 256: 1459–1462.[Abstract/Free Full Text]
  10. Heyworth PG, Curnutte JT, Nauseef WM, Volpp BD, Pearson DW, Rosen H, Clark RA. Neutrophil nicotinamide adenine dinucleotide phosphate oxidase assembly: translocation of p47phox and p67phox requires interaction between p47phox and cytochrome b558. J Clin Invest. 1991; 87: 352–356.[Medline] [Order article via Infotrieve]
  11. Kleinberg ME, Malech HL, Rotrosen D. The phagocyte 47-kilodalton cytosolic oxidase protein is an early reactant in activation of the respiratory burst. J Biol Chem. 1990; 265: 15577–15583.[Abstract/Free Full Text]
  12. El Benna J, Faust LP, Babior BM. The phosphorylation of the respiratory burst oxidase component p47phox during neutrophil activation: phosphorylation of sites recognized by protein kinase C and by proline-directed kinases. J Biol Chem. 1994; 269: 23431–23436.[Abstract/Free Full Text]
  13. El Benna J, Faust RP, Johnson JL, Babior BM. Phosphorylation of the respiratory burst oxidase subunit p47phox as determined by two-dimensional phosphopeptide mapping: phosphorylation by protein kinase C, protein kinase A, and a mitogen-activated protein kinase. J Biol Chem. 1996; 271: 6374–6378.[Abstract/Free Full Text]
  14. Nishizuka Y. Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science. 1992; 258: 607–614.[Abstract/Free Full Text]
  15. Moscat J, Diaz-Meco MT. The atypical protein kinase Cs: functional specificity mediated by specific protein adaptors. EMBO Rep. 2000; 1: 399–403.[CrossRef][Medline] [Order article via Infotrieve]
  16. Mochly-Rosen D, Kauvar LM. Modulating protein kinase C signal transduction. Adv Pharmacol. 1998; 44: 91–145.[Medline] [Order article via Infotrieve]
  17. Krizbai I, Szabo G, Deli M, Maderspach K, Lehel C, Olah Z, Wolff JR, Joo F. Expression of protein kinase C family members in the cerebral endothelial cells. J Neurochem. 1995; 65: 459–462.[Medline] [Order article via Infotrieve]
  18. Rahman A, Anwar KN, Malik AB. Protein kinase C{zeta} mediates TNF-{alpha}–induced ICAM-1 gene transcription in endothelial cells. Am J Physiol Cell Physiol. 2000; 279: C906–C914.[Abstract/Free Full Text]
  19. Jackson SH, Gallin JI, Holland SM. The p47phox mouse knock-out model of chronic granulomatous disease. J Exp Med. 1995; 182: 751–758.[Abstract/Free Full Text]
  20. Pollock JD, Williams DA, Gifford MA, Li LL, Du X, Fisherman J, Orkin SH, Doerschuk CM, Dinauer MC. Mouse model of X-linked chronic granulomatous disease, an inherited defect in phagocyte superoxide production. Nat Genet. 1995; 9: 202–209.[CrossRef][Medline] [Order article via Infotrieve]
  21. Fan J, Frey RS, Rahman A, Malik AB. Role of neutrophil NADPH oxidase in the mechanism of tumor necrosis factor-{alpha}–induced NF-{kappa}B activation and intercellular adhesion molecule-1 expression in endothelial cells. J Biol Chem. 2002; 277: 3404–3411.[Abstract/Free Full Text]
  22. Rahman A, Anwar KN, Uddin S, Xu N, Ye RD, Platanias LC, Malik AB. Protein kinase C{delta} regulates thrombin-induced ICAM-1 gene expression in endothelial cells via activation of p38 mitogen-activated protein kinase. Mol Cell Biol. 2001; 21: 5554–5565.[Abstract/Free Full Text]
  23. Dominguez I, Diaz-Meco MT, Municio MM, Berra E, Garcia de Herreros A, Cornet ME, Sanz L, Moscat J. Evidence for a role of protein kinase C{zeta} subspecies in maturation of Xenopus laevis oocytes. Mol Cell Biol. 1992; 12: 3776–3783.[Abstract/Free Full Text]
  24. Soh JW, Lee EH, Prywes R, Weinstein IB. Novel roles of specific isoforms of protein kinase C in activation of the c-fos serum response element. Mol Cell Biol. 1999; 19: 1313–1324.[Abstract/Free Full Text]
  25. Rotrosen D, Leto TL. Phosphorylation of neutrophil 47-kDa cytosolic oxidase factor: translocation to membrane is associated with distinct phosphorylation events. J Biol Chem. 1990; 265: 19910–19915.[Abstract/Free Full Text]
  26. Inanami O, Johnson JL, McAdara JK, El Benna J, Faust LR, Newburger PE, Babior BM. Activation of the leukocyte NADPH oxidase by phorbol ester requires the phosphorylation of p47phox on serine 303 and 304. J Biol Chem. 1998; 273: 9539–9543.[Abstract/Free Full Text]
  27. Hofmann J. The potential for isoenzyme-selective modulation of protein kinase C. FASEB J. 1997; 11: 649–669.[Abstract]
  28. Holland JA, Meyer JW, Chang MM, O’Donnell RW, Johnson DK, Ziegler LM. Thrombin stimulated reactive oxygen species production in cultured human endothelial cells. Endothelium. 1998; 6: 113–121.[Medline] [Order article via Infotrieve]
  29. Li Q, Subbulakshmi V, Fields AP, Murray NR, Cathcart MK. Protein kinase C{alpha} regulates human monocyte O-2 production and low density lipoprotein lipid oxidation. J Biol Chem. 1999; 274: 3764–3771.[Abstract/Free Full Text]
  30. Korchak HM, Rossi MW, Kilpatrick LE. Selective role for ß-protein kinase C in signaling for O2- generation but not degranulation or adherence in differentiated HL60 cells. J Biol Chem. 1998; 273: 27292–27299.[Abstract/Free Full Text]
  31. Seargeant S, McPhail LC. Opsonized zymosan stimulates the redistribution of protein kinase C isoforms in human neutrophils. J Immunol. 1997; 159: 2877–2885.[Abstract]
  32. House C, Kemp BE. Protein kinase C contains a pseudosubstrate prototype in its regulatory domain. Science. 1987; 238: 1726–1728.[Abstract/Free Full Text]
  33. Sumimoto H, Kage Y, Nunoi H, Sasaki H, Nose T, Fukumaki Y, Ohno M, Minakami S, Takeshige K. Role of Src homology 3 domains in assembly and activation of the phagocyte NADPH oxidase. Proc Natl Acad Sci U S A. 1994; 91: 5345–5349.[Abstract/Free Full Text]
  34. Dang PMC, Fontayne A, Hakim J, El Benna J, Perianin A. Protein kinase C{zeta} phosphorylates a subset of selective sites of the NADPH oxidase component p47phox and participates in formyl peptide-mediated neutrophil respiratory burst. J Immunol. 2001; 166: 1206–1213.[Abstract/Free Full Text]
  35. Kampfer S, Hellbert K, Villunger A, Doppler W, Baier G, Grunicke HH, Uberall F. Transcriptional activation of c-fos by oncogenic Ha-Ras in mouse mammary epithelial cells requires the combined activities of PKC{lambda}, {epsilon} and {zeta}. EMBO J. 1998; 17: 4046–4055.[CrossRef][Medline] [Order article via Infotrieve]
  36. Mizukami Y, Kobayashi S, Uberall F, Hellbert K, Kobayashi N, Yoshida KI. Nuclear mitogen-activated protein kinase activation by protein kinase C{zeta} during reoxygenation after ischemic hypoxia. J Biol Chem. 2000; 275: 19921–19927.[Abstract/Free Full Text]
  37. Rahman A, Anwar KN, Uddin S, Xu N, Ye RD, Platanias LC, Malik AB. Protein kinase C{delta} regulates thrombin-induced ICAM-1 gene expression in endothelial cells via activation of p38 mitogen-activated protein kinase. Mol Cell Biol. 2001; 21: 5554–5565.[Abstract/Free Full Text]
  38. Shi J, Ross CR, Leto TL, Blecha F. PR-39, a proline-rich antibacterial peptide that inhibits phagocyte NADPH oxidase activity by binding to Src homology 3 domains of p47phox. Proc Natl Acad Sci U S A. 1996; 93: 6014–6018.[Abstract/Free Full Text]
  39. Lambeth JD. Nox/Duox family of nicotinamide adenine dinucleotide (phosphate) oxidases. Curr Opinion Hematology. 2002; 9: 11–17.[CrossRef][Medline] [Order article via Infotrieve]
  40. Wagner AH, Schroeter MR, Hecker M. 17ß-Estradiol inhibition of NADPH oxidase in human endothelial cells. FASEB J. 2001; 15: 2121–2130.[Abstract/Free Full Text]
  41. Gorlach A, Brandes RP, Nguyen K, Amidi M, Dehghani F, Busse R. A gp91phox containing NADPH oxidase selectively expressed in endothelial cells is a major source of oxygen radical generation in the arterial wall. Circ Res. 2000; 87: 26–32.[Abstract/Free Full Text]
  42. Bayraktutan U, Blayney L, Shah AM. Molecular characterization and localization of the NAD(P)H oxidase components gp91phox and p22phox in endothelial cells. Arterioscler Thromb Vasc Biol. 2000; 20: 1903–1911.[Abstract/Free Full Text]
  43. Murphy HS, Shyaman JA, Till GO, Mahrougui M, Owens CB, Ryan US, Ward PA. Superoxide responses of endothelial cells to C5a and TNF-{alpha}: divergent signal transduction pathways. Am J Physiol. 1992; 263: L51–L59.[Medline] [Order article via Infotrieve]
  44. Zulueta JJ, Yu FS, Hertig IA, Thannickal VJ, Hassoun PM. Release of hydrogen peroxide in response to hypoxia-reoxygenation: role of an NAD(P)H oxidase-like enzyme in endothelial cell plasma membrane. Am J Respir Cell Mol Biol. 1995; 12: 41–49.[Abstract]



This article has been cited by other articles:


Home page
 Cardiovasc ResHome page
K. Graf
Pulmonary hyperplasia and the two sides of PKC{zeta}
Cardiovasc Res, June 1, 2008; 78(3): 409 - 410.
[Full Text] [PDF]

Home page
 J Am Coll CardiolHome page
R. Dworakowski, S. Walker, A. Momin, J. Desai, A. El-Gamel, O. Wendler, M. T. Kearney, and A. M. Shah
Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase-Derived Superoxide and Vascular Endothelial Dysfunction in Human Heart Failure
J. Am. Coll. Cardiol., April 8, 2008; 51(14): 1349 - 1356.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. V. Usatyuk, L. H. Romer, D. He, N. L. Parinandi, M. E. Kleinberg, S. Zhan, J. R. Jacobson, S. M. Dudek, S. Pendyala, J. G. N. Garcia, et al.
Regulation of Hyperoxia-induced NADPH Oxidase Activation in Human Lung Endothelial Cells by the Actin Cytoskeleton and Cortactin
J. Biol. Chem., August 10, 2007; 282(32): 23284 - 23295.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X.-P. Gao, X. Zhu, J. Fu, Q. Liu, R. S. Frey, and A. B. Malik
Blockade of Class IA Phosphoinositide 3-Kinase in Neutrophils Prevents NADPH Oxidase Activation- and Adhesion-dependent Inflammation
J. Biol. Chem., March 2, 2007; 282(9): 6116 - 6125.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
A. Csiszar, N. Labinskyy, K. Smith, A. Rivera, Z. Orosz, and Z. Ungvari
Vasculoprotective Effects of Anti-Tumor Necrosis Factor-{alpha} Treatment in Aging
Am. J. Pathol., January 1, 2007; 170(1): 388 - 698.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. M. Vogel, J. Orrington-Myers, M. Broman, and A. B. Malik
De novo ICAM-1 synthesis in the mouse lung: model of assessment of protein expression in lungs
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L496 - L501.
[Abstract] [Full Text]