Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2001;88:954-960
Published online before print April 27, 2001, doi: 10.1161/hh0901.090975
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
88/9/954    most recent
hh0901.090975v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parhami, F.
Right arrow Articles by Demer, L. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parhami, F.
Right arrow Articles by Demer, L. L.
Related Collections
Right arrow Pathophysiology
Right arrow Other arteriosclerosis
Right arrow Other Vascular biology
(Circulation Research. 2001;88:954.)
© 2001 American Heart Association, Inc.


Integrative Physiology

Leptin Enhances the Calcification of Vascular Cells

Artery Wall as a Target of Leptin

Farhad Parhami, Yin Tintut, Alex Ballard, Alan M. Fogelman, Linda L. Demer

From the Departments of Medicine (F.P., Y.T., A.B., A.M.F., L.L.D.) and Physiology (L.L.D.), University of California, Los Angeles.

Correspondence to Farhad Parhami, PhD, Division of Cardiology, UCLA School of Medicine, Center for the Health Sciences, Room 47-123, 10833 Le Conte Avenue, Los Angeles, CA 90095. E-mail fparhami{at}mednet.ucla.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Leptin, the product of the ob gene, regulates food intake, energy expenditure, and other physiological functions of the peripheral tissues. Leptin receptors have been identified in the hypothalamus and in extrahypothalamic tissues. Increased circulating leptin levels have been correlated with cardiovascular disease, obesity, aging, infection with bacterial lipopolysaccharide, and high-fat diets. All these conditions have also been correlated with increased vascular calcification, a hallmark of atherosclerotic and age-related vascular disease. In addition, the differentiation of marrow osteoprogenitor cells is regulated by leptin. Thus, we hypothesized that leptin may regulate the calcification of vascular cells. In this report, we tested the effects of leptin on a previously characterized subpopulation of vascular cells that undergo osteoblastic differentiation and calcification in vitro. When treated with leptin, these calcifying vascular cells had a significant 5- to 10-fold increase in alkaline phosphatase activity, a marker of osteogenic differentiation of osteoblastic cells. Prolonged treatment with leptin enhanced the calcification of these cells, further supporting the pro-osteogenic differentiation effects of leptin. Furthermore, the presence of the leptin receptor on calcifying vascular cells was demonstrated using reverse transcriptase polymerase chain reaction, immunocytochemistry, and Western blot analysis. We also identified the presence of leptin receptor in the mouse artery wall, localized to subpopulations of medial and adventitial cells, and the expression of leptin by artery wall cells and atherosclerotic lesions in mice. Taken together, these results suggest that leptin regulates the osteoblastic differentiation and calcification of vascular cells and that the artery wall may be an important peripheral tissue target of leptin action.


Key Words: calcification • calcifying vascular cells • leptin • atherosclerosis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Leptin, the circulating protein product of the ob gene, was recently shown to be a satiety factor regulating food intake and energy expenditure.1 Although it is produced primarily by adipocytes and has a primary effect on the hypothalamus, it is also produced by nonadipocytic cells1 and targets extrahypothalamic tissues.2 3 It has effects on lipid metabolism, hematopoiesis, pancreatic cell function, thermogenesis, and the response to bacterial lipopolysaccharide.4 5 The wide role of leptin is not surprising given the pattern of expression of its receptors in a multitude of tissues, including but not limited to the brain, lung, kidney, spleen, heart, and liver.2 3

Previously characterized leptin receptors, which are all products of alternative splicing of the db gene transcript,6 have differential patterns of expression in different tissues.2 They share identical extracellular and membrane-spanning domains, but the intracellular domain varies in length as a result of the alternative splicing.3 The long form of the receptor (OB-Rb) seems to be responsible for generating the intracellular signals controlling hypothalamic responses to leptin. However, little is known about its role in regulating extrahypothalamic signal transduction.

Circulating leptin concentrations vary with fat mass,7 sex hormone levels,8 exposure to bacterial lipopolysaccharide,5 increased dietary fat,9 10 and age.8 11 12 Collectively, the wide distribution of leptin receptor expression and the multiple regulatory mechanisms and factors involved in the control of leptin levels suggest that leptin is involved in other physiological or pathological conditions. Sierra-Honigmann et al4 and Bouloumie et al13 showed that leptin has angiogenic activity in endothelial cells. Silver et al14 recently showed that leptin regulates the hepatic clearance of high density lipoproteins in mice, hence possibly affecting lipid-associated diseases such as atherosclerosis.

Recently, we and others showed that vascular calcification is an actively regulated process involving a subpopulation of artery wall cells, called calcifying vascular cells (CVC), that undergo osteoblastic differentiation and form hydroxyapatite mineral.15 Both leptin levels and vascular calcification increase with age8 16 and with a high-fat diet.9 17 Because leptin also modulates the differentiation of marrow osteoprogenitor cells,18 we hypothesized that leptin may modulate the differentiation of vascular osteoprogenitor cells. The results in the present report indicate, for the first time, that leptin is a potent inducer of osteoblastic differentiation and calcification of CVC in vitro and that the leptin receptor is expressed by CVC and by subpopulations of cells in the mouse artery wall. In addition, the in vivo expression of leptin in the artery wall and by human aortic endothelial cells and monocyte/macrophages in vitro are shown. The presence of leptin and its receptor in the artery wall suggests that physiological or pathological functions of artery wall cells may be targets of leptin action.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
CVC clones were isolated from cultures of bovine smooth muscle cells harvested from bovine aortic medial explants and cultured as previously described.15 Human aortic endothelial cells were isolated and cultured as previously described.19 Human peripheral blood monocytes were isolated as previously described,20 plated in 30% autologous human serum in Iscove’s modified Dulbecco’s medium (IMDM; Irvine Scientific) supplemented with 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL Fungizone (amphotericin b), 2 mmol/L L-glutamine, and 0.22 U/mL insulin, and cultured for 7 days before RNA extraction. Human adipocytes were kindly provided by Dr Daniel De Ugarte (Department of Surgery, University of California at Los Angeles). Murine recombinant leptin was obtained from BioMol Research Laboratories and was 95% pure by SDS-PAGE, according to the manufacturer.

Alkaline Phosphatase Activity Assay
A cell-associated alkaline phosphatase activity assay was performed as previously described.21

Von Kossa Staining for Calcification
Cell monolayers were fixed in 0.1% glutaraldehyde for 15 minutes at room temperature, followed by staining with silver nitrate, as previously described.21

45Ca Incorporation
45Ca incorporation into matrix of CVC cultures was performed as previously described.21

Reverse Transcriptase Polymerase Chain Reaction
Total RNA from tissue or cells grown in duplicate 60-mm tissue culture dishes was isolated using an RNA isolation kit (Strategene). A total of 3 µg of the total RNA was reverse-transcribed in a 50-µL reaction volume, as described previously.22 Primers were constructed from bovine leptin receptor (accession number U62385) and mouse leptin receptor (accession number MMU58861), homologous to the long form of human leptin receptor OB-Rb, and from mouse leptin (accession number U2421.1). Sequences of the primers, synthesized by Gibco-BRL were as follows: bovine leptin receptor: sense (1-25) 5'-GTGCCAGCAACTACAGATGCTCTAC-3', antisense (356-380) 5'-AGTTCATCCAGGCCTTCTGAGAACG-3'; mouse leptin receptor: sense (2872-2893) 5'-TGAGATGGTCCCAGCAGC-TATG-3', antisense (3260-3239) 5'-CCAAAAGCTCATC-CAACCCCGA-3'; and mouse leptin: sense (7-26) 5'-TGGAGACCCCTGTGTCGG- TT-3', antisense (479-502) 5'-AGCATTCAGGGCTAACAT-CCAACT-3'. Polymerase chain reaction (PCR) was performed as previously described,22 except the annealing temperature was 65°C and the total number of cycles was 45 for bovine leptin receptor, 36 for mouse leptin receptor, and 41 for mouse leptin. PCR products (expected length of 380 base pairs for bovine leptin receptor, 389 base pairs for mouse leptin receptor, and 496 base pairs for mouse leptin) were electrophoresed on an agarose gel and visualized using ethidium bromide stain. All PCR products were sequenced by the University of California at Los Angeles (UCLA) sequencing core laboratory, and the sequencing results were electronically compared with GenBank entries using BLAST NIH software. Bovine leptin receptor PCR product showed the highest similarity to the submitted entry U62385 (Bos taurus obese receptor gene); the mouse leptin receptor PCR product showed the highest similarity to the submitted entry AF098792 (Mus musculus leptin receptor long isoform Rb gene); and the mouse leptin PCR product showed the highest similarity to the submitted entry NM_008493 (Mus musculus leptin mRNA).

Immunocytochemistry
Confluent CVC monolayers were grown in chamber slides and fixed with 4% paraformaldehyde and stained with the polyclonal rabbit anti-mouse leptin receptor antibody OBR-E1 (Torrey Pines Biolabs) at a concentration of 4 µg/mL. This antibody was generated using Escherichia coli–expressed recombinant OB receptor, amino acids 25 to 208, as an immunogen. It was found to react with both recombinant and natural mouse OB receptor (per Torrey Pines Biolabs). As a negative control, nonimmunized rabbit IgG at concentrations equal to the anti-leptin receptor antibody was used. Biotinylated secondary antibody was used for visualization, and counterstaining with hematoxylin was performed.

Western Blot Analysis
CVC grown in duplicate 100-mm plates were scraped and centrifuged, and the cell pellet was resuspended in 1x PBS containing protease inhibitors (0.5 µg/mL leupeptin, 0.7 µg/mL pepstatin, and 0.2 mmol/L phenylmethylsulfonyl fluoride). A partially purified membrane fraction was prepared by freeze-thawing the cells 3 times in a dry ice–ethanol bath. On visualization under light microscope, all cells were ruptured. The membrane fraction was then collected after centrifugation for 10 minutes at 14 000g, resuspended in lysis buffer containing protease inhibitors under reducing conditions, and electrophoresed on 8% Tris-glycine gels (Novex). This was followed by transfer to nitrocellulose membranes, as previously described.22 The blots were probed with 2 µg/mL of either the polyclonal rabbit anti-mouse leptin receptor antibody OBR-E1 (Torrey Pines Biolabs) or with nonimmunized rabbit IgG. Detection of immunoreactive proteins was done by enhanced chemiluminescence (Amersham).

Northern Blot Analysis
A total of 10 µg of total RNA extracted from tissues or cells was electrophoresed through a 1% agarose gel and transblotted to a nylon membrane, as previously described.19 The blot was hybridized with a 32P-labeled human leptin probe generated by PCR using the gene sequence for human leptin (accession No. U43653). The sequences of the primers synthesized by Gibco-BRL were as follows: sense (67-87) 5'-GAACCCTGTGCGGATTCTTGT-3'; antisense (344-367) 5'- AGGTTCTCCAGGTCGTTGGATATT 3'. A PCR product of 301 base pairs was gel-purified and used for Northern analysis. The PCR product was sequenced by the UCLA sequencing core laboratory, and the sequencing results were electronically compared with GenBank entries using BLAST NIH software. They showed the highest similarity to submitted entry XM_004625 (Homo sapiens leptin mRNA).

Leptin RIA
Leptin RIA was performed on conditioned media from cultured human aortic endothelial cells and human monocyte/macrophages. Cells were cultured in 60-mm tissue culture plates as described above for 6 days. The media was then replaced with 3 ml of IMDM for monocyte/macrophages and M199 for endothelial cells, both containing 10% FBS. After 48 hours, conditioned media was collected, centrifuged to remove detached cells, and stored at -70°C. The cell layer was dissolved in 0.4 mol/L NaOH, and the protein concentration was measured using the Bradford protein assay (Bio-Rad). A total of 100 µL of conditioned media from each cell type was used in the human leptin RIA assay from Linco Research according to the manufacturer’s instructions. According the manufacturer’s information, this RIA assay has 100% specificity for human leptin and <0.2% specificity for leptin from other species. The leptin concentrations obtained were normalized to cellular protein content.

Tissue Preparation and Immunohistochemistry
Normal aortas were obtained from 6-month-old, female, C57BL/6J mice. Atherosclerotic aortas were obtained from 6-month-old, female, LDL receptor–null mice fed an atherogenic diet for 4 months or from apoE-null mice, the F2 progeny of a C57BL/6J X DBA/2J intercross (generous gift of Dr Thomas A. Drake, Department of Pathology, UCLA), fed a high-fat atherogenic diet for 4 months. The aortas were surgically removed, embedded in OCT compound (Fisher Scientific), and frozen in liquid nitrogen. Unfixed 8-µm serial sections were incubated in Tris saline solution containing 8 mmol/L Tris-base, 40 mmol/L Tris-HCl, 150 mmol/L NaCl, 5% wt/vol nonfat dry milk, and 1% v/v normal goat serum for 2 hours at room temperature to block nonspecific binding and then stained for leptin receptor using the OBR-E1 polyclonal rabbit anti-mouse antibody (Torrey Pines Biolabs) at 4 µg/mL, for von Willebrand factor using a polyclonal rabbit anti-human antibody (DAKO Corp) at 1 µg/mL, or for leptin using an affinity-purified rabbit anti-mouse polyclonal antibody (OB A-20, Santa Cruz Biotechnology) at 1 µg/mL. To control for possible nonspecific staining, serial sections were stained with leptin antibody neutralized with blocking peptide (Santa Cruz Biotechnology) according to the manufacturer’s instructions. Biotinylated goat anti-rabbit secondary antibody was used to detect the primary antibodies and visualized using the Vectastain ABC kit (Vector Labs) followed by Peroxidase Chromogen AEC kit (Biomeda Corp), according to the manufacturer’s instructions. Tissue sections were counterstained with hematoxylin.

Statistical Analysis
Statistical analyses were performed using ANOVA.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Leptin Induces Calcification in Cultures of CVC
We previously found that CVC undergo a differentiation process similar to that seen in preosteoblasts, including sequential upregulation of several osteoblast-specific markers. Alkaline phosphatase, an early marker of osteoblastic differentiation in CVC and other osteoblastic cells, mediates the differentiation process and provides phosphate ions for calcium phosphate mineral formation.23 24 Treatment of CVC with leptin for 4 days caused a significant, dose-dependent, 5- to 10-fold induction of alkaline phosphatase activity (Figure 1ADown). After 10 days of leptin treatment, calcification in the CVC cultures was also dramatically increased, as shown by von Kossa staining (Figure 1BDown) and a 45Ca incorporation assay (Figure 1CDown). Altogether, these results suggest that leptin strongly induces osteoblastic differentiation and mineralization of CVC in culture. Leptin did not significantly alter proliferation or osteopontin expression in CVC (data not shown). In addition, the above CVC responses to leptin were independent of signal transducer and activator of transcription 3 (STAT3) activation, because treatment with leptin for 15 minutes or 1 hour did not induce phosphorylation of STAT3 in CVC, as determined by Western blot analysis using an antibody to phosphorylated STAT3 (Santa Cruz Biotechnology; data not shown).



View larger version (50K):
[in this window]
[in a new window]
 
Figure 1. Effect of leptin on alkaline phosphatase activity and calcification in calcifying vascular cell cultures. A, CVC were incubated for 4 days with control buffer (0) or the indicated concentrations of leptin in DMEM containing 5% FBS. Alkaline phosphatase activity was measured in total cell homogenates, and the results from a representative of 5 experiments are shown as the mean±SD of quadruplicate determinations. P<0.005 for all leptin vs buffer-treated samples. B, CVC monolayers were treated as described in A for 10 days. Von Kossa silver nitrate staining shows calcification as a black stain. Results from a representative of 3 experiments are shown (phase-contrast magnification, x40). The number in the bottom corner of each panel represents the concentration of leptin used in µg/mL. C, CVC were treated with control buffer or leptin for 10 days, as described above, and then a 45Ca incorporation assay was performed. Results from a representative of 3 experiments are shown as the mean±SD of 6 determinations. P<0.01 for all leptin vs buffer-treated samples.

Leptin Receptor Is Expressed in CVC
To examine the expression of leptin receptor in CVC, we performed reverse transcriptase PCR (RT-PCR) using RNA isolated from confluent cultures of CVC with primers specific for OB-Rb. The presence of a PCR product of the expected size of 380 base pairs indicated that OB-Rb was expressed in CVC (Figure 2ADown). Immunocytochemistry performed on nonpermeabilized confluent cultures of CVC with an antibody to the conserved extracellular domain of leptin receptors showed strong immunoreactivity in 30% to 40% of the cells in the monolayer (Figure 2BDown). No immunoreactivity was found when nonimmune rabbit IgG was used as a control (Figure 2BDown). Western blot analysis of 10 µg of membrane preparation from CVC identified 5 previously described bands (Figure 2CDown).4 13 18 No immunoreactivity was found with control nonimmune rabbit IgG (data not shown).



View larger version (64K):
[in this window]
[in a new window]
 
Figure 2. Expression of leptin receptor in CVC. A, Total RNA from duplicate samples of confluent CVC cultures was examined for expression of OB-Rb by RT-PCR, as described in Materials and Methods. The 380-base pair PCR product represents OB-Rb expression in CVC. No band was found in the control sample lacking cDNA (cont). B, Nonpermeabilized confluent cultures of CVC were fixed with 4% paraformaldehyde and stained for leptin receptor using the OBR-E1 antibody (OB-R), as described in Materials and Methods. Cells stained with nonimmune rabbit IgG are shown as a negative control (IgG). Phase-contrast magnification, x200; inset, x400. C, Western blot analysis for leptin receptor expression in CVC is shown using duplicate membrane preparations and staining with the OBR-E1 antibody, as described in Materials and Methods. Sizes corresponding to molecular weight markers are indicated.

Leptin Receptor Is Expressed in the Artery Wall
To examine the expression of leptin receptor in the artery wall, immunohistochemistry was performed on thoracic aortic specimens from C57BL/6J mice. Immunoreactivity with leptin receptor antibody was found along the outer circumference of the vessel wall (Figure 3ADown), mainly specific to subpopulations of medial and adventitial cells near the external elastic lamina (Figure 3DDown). Immunoreactivity was also found associated with the endothelium of the adventitial vessels but not with the aortic endothelium (Figure 3ADown). Positive staining with von Willebrand factor identified the endothelium of the vessels (Figure 3BDown), and nonimmune rabbit IgG, used as a negative control, showed no reactivity in serial sections (Figure 3CDown). An identical pattern of staining was found in 4 of 4 specimens obtained from separate animals.



View larger version (130K):
[in this window]
[in a new window]
 
Figure 3. Leptin receptor expression in mouse aortic wall. Frozen serial sections of mouse aortas from C57BL/6J mice were stained for (A, D) leptin receptor and (B) von Willebrand factor. C, Negative control using nonimmune rabbit IgG. Counterstaining was done with hematoxylin. Phase-contrast magnification, x100 for A through C and x200 for D.

We further confirmed the expression of the leptin receptor in the artery wall by RT-PCR (Figure 4ADown). Analysis of RNA isolated from 2 separate aortas from C57BL/6J mice showed an expected size band of 389 base pairs, corresponding to the mouse OB-Rb. RNA extracted from mouse liver, which has previously been found to express leptin receptor,2 was used as a positive control.



View larger version (78K):
[in this window]
[in a new window]
 
Figure 4. Gene expression in mouse tissues. Total RNA from 2 separate aortas, liver, and abdominal fat was extracted from C57BL/6 mice and examined for the expression of (A) the long form of the leptin receptor (OB-R) and (B) leptin using RT-PCR, as described in Materials and Methods. A 389-base pair PCR product represents OB-Rb and a 496-base pair PCR product represents leptin. Leptin receptor expression is shown as duplicate lanes per samples, and leptin expression is shown as a single lane per aorta.

Expression of Leptin in Artery Wall and by Artery Wall Cells
To test whether leptin is produced locally in the artery wall, which would expose vascular cells to high leptin concentrations, we tested for its expression in the aorta. RT-PCR using RNA isolated from whole mouse aortas showed expression of leptin mRNA by aortic cells (Figure 4BUp). RNA isolated from abdominal fat was used as a positive control (Figure 4BUp). Furthermore, immunohistochemical analysis using an anti-mouse leptin antibody demonstrated the presence of leptin in atherosclerotic lesions in mice, but substantially less or no expression in normal aortas (Figure 5Down).



View larger version (84K):
[in this window]
[in a new window]
 
Figure 5. Expression of leptin in mouse aortic wall. Frozen serial sections of mouse atherosclerotic aortas from apo-E–null (A, B, and C), LDL receptor–null (D and E), and normal aorta from C57BL/6 (F) mice were stained with anti-mouse leptin antibody in the absence (A, D, and F) or presence (B and E) of blocking peptide, as described in Materials and Methods. Staining with nonimmune rabbit IgG was performed to control for nonspecific staining (C). Counterstaining was done with hematoxylin. Phase-contrast magnification, x100.

To further identify vascular cells capable of expressing leptin, we tested various artery wall cells for the in vitro expression of leptin. Northern blot analysis of total RNA isolated from confluent cultures of human aortic endothelial cells and monocyte/macrophages, as well as human adipocytes used as positive control, showed a 4.5-Kb band corresponding to leptin mRNA25 (Figure 6Down). Furthermore, leptin secretion was quantified by RIA in conditioned media from human aortic endothelial cells and monocyte/macrophages. Results from a representative of 2 experiments performed on quadruplicate samples showed 1.2±0.1 ng of leptin/mg of cell protein in endothelial cells and 3.6±0.6 ng of leptin/mg of cell protein in monocyte/macrophage-conditioned media. Although the conditioned medium contained FBS, which may contain bovine leptin, this assay is specific for human leptin.



View larger version (64K):
[in this window]
[in a new window]
 
Figure 6. Expression of leptin by vascular cells and adipocytes. Total RNA was isolated from duplicate confluent cultures of human aortic endothelial cells, human monocyte/macrophages, or human adipocytes, as described in Materials and Methods. Northern blot analysis was performed using 10 µg of RNA from each sample and examined for leptin and GAPDH mRNA expression.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
The present report demonstrates the expression of leptin and its receptor in the artery wall and by artery wall cells and a direct effect of leptin on osteogenic differentiation of a subpopulation of vascular cells. Leptin receptor expression was found in cultured CVC by RT-PCR, immunocytochemistry, and Western blot analysis. Of the 5 bands identified on Western analysis of CVC for OB-R, all corresponded with previously reported sizes for OB-R in other tissues.4 13 18 Also consistent with our findings, bands with approximate sizes of 240, 200, 120, and 80 kDa were recently identified in testicular tissue.26 The faint band at 120 kDa corresponds to the short form of the leptin receptor.18 The additional band at 170 kDa corresponds to the endothelial cell form of the leptin receptor.4 Leptin receptor expression was also identified in the medial layer of mouse aorta in a subpopulation of medial cells. This is consistent with previous reports indicating the heterogeneity of medial smooth muscle cells with respect to the expression of surface markers and the stage of differentiation.27 28 However, the presence of leptin receptor on medial cells and its pattern of expression among different populations of medial cells have not been previously reported.

In addition to smooth muscle cells, marrow stromal cells, another mesenchymal cell population, have been reported to express leptin receptor; therefore, it is intriguing to speculate that vascular pericytes may be the adventitial cells expressing leptin receptor. Immunoreactivity of small vessel endothelium for the leptin receptor antibody is consistent with the recent report by Sierra-Honigmann et al4 showing leptin receptor expression in microvascular endothelium of human dermis and adipose tissue. Lack of immunostaining for leptin receptor in the aortic endothelium suggests specificity to microvascular endothelium and may prove to be an interesting and physiologically important difference between the endothelium of large and small vessels that deserves further investigation.

Recently, Kang et al29 also identified the leptin receptor in atherosclerotic human arteries, predominantly in foam cells, vascular smooth muscle cells, and the endothelial cells of intimal neovessels. In the present report, we also provide evidence that leptin is produced in vitro by cells of the artery wall and in atherosclerotic lesions. Although leptin protein was not evident on immunohistochemistry of the normal mouse aorta, it is possible that the endothelial cells secreted the protein into the circulation. In contrast, in atherosclerotic lesions, leptin protein may be trapped in the abnormal matrix, and it may also be produced by monocytes and macrophages within the lesion. Altogether, it is clear that the leptin receptor is present on artery wall cells; therefore, the role of leptin in regulating the function of these cells and the artery wall deserves further elucidation. Interestingly, Nishina et al30 reported that mice lacking leptin (ob/ob) or leptin receptor (db/db) had reduced atherosclerotic lesion areas compared with controls, which was partially contributed to by the increased HDL levels in these mice. However, because leptin may regulate inflammation and immunity,31 it is intriguing to speculate that the reduced lesion area reported by Nishina et al30 may by partially due to the absence of leptin and its proinflammatory effects in the mutant mice.

The present results also indicate that leptin regulates the osteogenic differentiation of a subpopulation of vascular cells. Leptin induced alkaline phosphatase activity and subsequent mineralization in CVC. The pro-osteogenic differentiation effects of leptin are consistent with findings of Thomas et al,18 who recently reported that leptin induces the osteoblastic differentiation of marrow stromal cells, which also express leptin receptors.

We also examined the effect of leptin on 2 major signaling molecules, STAT3 and cAMP. Leptin induces the phosphorylation and activation of STAT3 in several cell types, including endothelial cells and oocytes.4 32 However, leptin did not induce the activation of STAT3 in CVC, as indicated by a lack of phosphorylation of STAT3 in leptin-treated cells. We previously reported that the induction of cAMP levels in CVC enhances their osteogenic differentiaton.22 Treating CVC with leptin did not have a significant effect on cAMP levels (data not shown). These results suggest that the pro-osteogenic effects of leptin on CVC are independent of STAT3 or cAMP.

The present report further supports the role of leptin as a regulator of peripheral tissue physiology by providing anatomical evidence of leptin receptor expression in the aortic wall and biological activity promoting the calcification of cells derived from vascular tissue. This is a significant finding given the importance of vascular calcification in the diseases of the artery wall, including atherosclerosis, and the aging-associated impairment of its elastic functions.33 34


*    Acknowledgments
 
This work was supported in part by NIH grant HL30568 and the Laubisch Fund. F. Parhami is a recipient of a Career Development Award from the Claude D. Pepper Older American Independence Center at UCLA. The authors would like to thank Dr Thomas A. Drake for insightful suggestions, Vien Le and Tony Mottino for expert technical assistance, and the UCLA Biomedical Technology Research and Instructional Production Facility for assistance with graphics.


*    Footnotes
 
Original received January 14, 2000; resubmission received November 2, 2000; revised resubmission received March 21, 2001; accepted April 4, 2001.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Tartaglia LA. The leptin receptor. J Biol Chem. 1997;272:6093–6096.

2. Fei H, Okano HJ, Li C, Lee GH, Zhao C, Darnell R, Friedman JM. Anatomic localization of alternatively spliced leptin receptors (Ob-R) in mouse brain and other tissues. Proc Natl Acad Sci U S A. 1997;94:7001–7005.

3. Barr VA, Lane K, Taylor SI. Subcellular localization and internalization of the four human leptin receptor isoforms. J Biol Chem. 1999;274:21416–21424.

4. Sierra-Honigmann MR, Nath AK, Murakami C, Garcia-Cardena G, Papapetropoulos A, Sessa WC, Madge LA, Schechner JS, Schwabb MB, Polverini PJ, Flores-Riveros JR. Biological action of leptin as an angiogenic factor. Science. 1998;281:1683–1686.

5. Francis J, Mohankumar PS, Mohankumar SMJ, Quadri SK. Systemic administration of lipopolysaccharide increases plasma leptin levels. Endocrine. 1999;10:291–295.

6. Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM. Abnormal splicing of the leptin receptor in diabetic mice. Nature. 1996;379:632–635.

7. Moller N, O’Brien P, Nair KS. Disruption of the relationship between fat content and leptin levels with aging in humans. J Clin Endocrinol Metab. 1998;83:931–934.

8. Baumgartner RN, Waters DL, Morley JE, Patrick P, Montoya GD, Garry PJ. Age-related changes in sex hormones affect the sex differences in serum leptin independently of changes in body fat. Metabolism. 1999;48:378–384.

9. Ahren B. Plasma leptin and insulin in C57BL/6J mice on a high-fat diet: relation to subsequent changes in body weight. Acta Physiol Scand. 1999;165:233–240.

10. Ahren B, Mansson S, Gingerich RL, Havel PJ. Regulation of plasma leptin in mice: influence of age, high-fat diet, and fasting. Am J Physiol.. 1997;273:R113–R120.

11. Li H, Matheny M, Tumer N, Scarpace PJ. Aging and fasting regulation of leptin and hypothalamic neuropeptide Y gene expression. Am J Physiol. 1998;275:E405–E411.

12. Li H, Matheny M, Nicolson M, Tumer N, Scarpace PJ. Leptin gene expression increases with age independent of increasing adiposity in rats. Diabetes. 1997;46:2035–2039.

13. Bouloumie A, Drexler CAH, Lafontan M, Busse R. Leptin, the product of Ob gene, promotes angiogenesis. Circ Res. 1998;83:1059–1066.

14. Silver DL, Jiang X, Tall A. Increased high density lipoprotein (HDL), defective hepatic catabolism of Apo A-I and ApoA-II, and decreased ApoA-I mRNA in ob/ob mice. J Biol Chem. 1999;274:4140–4146.

15. Watson KE, Bostrom K, Ravindranath R, Lam T, Norton B, Demer LL. TGF-ß1 and 25-hydroxycholesterol stimulate osteoblast-like vascular cells to calcify. J Clin Invest. 1994;93:2106–2113.

16. Agatston AS, Janowitz WR, Hildner FJ, Zusmer NR, Viamonte M, Detrano R. Quantification of coronary artery calcium using ultrafast computed tomography. J Am Coll Cardiol. 1990;15:827–832.

17. Towler DA, Bidder M, Latifi T, Coleman T, Semenkovich CF. Diet-induced diabetes activates an osteogenic gene regulatory program in the aortas of low density lipoprotein receptor-deficient mice. J Biol Chem. 1998;273:30427–30434.

18. Thomas T, Gori F, Khosla S, Jensen MD, Burguera B, Riggs BL. Leptin acts on human marrow stromal cells to enhance differentiation to osteoblasts and to inhibit differentiation to adipocytes. Endocrinology. 1999;140:1630–1638.

19. Parhami F, Fang ZT, Fogelman AM, Andalibi A, Territo MC, Berliner JA. Minimally modified low density lipoprotein-induced inflammatory responses in endothelial cells are mediated by cyclic adenosine monophosphate. J Clin Invest. 1993;92:471–478.

20. Colotta F, Peri G, Villa A, Mantovani A. A rapid killing of actinomycin D-treated tumor cells by human mononuclear cells. J Immunol. 1984;132:936–944.

21. Parhami F, Morrow AD, Balucan J, Leitinger N, Watson AD, Tintut Y, Berliner JA, Demer LL. Lipid oxidation products have opposite effects on calcifying vascular cell and bone cell differentiation. Arterioscler Thromb Vasc Biol. 1997;17:680–687.

22. Tintut Y, Parhami F, Bostrom K, Jackson SM, Demer LL. cAMP stimulates osteoblast-like differentiation of calcifying vascular cells. J Biol Chem. 1998;273:7547–7553.

23. Anderson HC. Molecular biology of matrix vesicles. Clin Orthop. 1995;314:266–280.

24. Narisawa S, Hofmann MC, Ziomek CA, Millan JL. Embryonic alkaline phosphatase is expressed at M-phase in the spermatogenic lineage of the mouse. Development. 1992;116:159–165.

25. Bradley RL, Kokkotou EG, Maratos-Flier E, Cheatham B. Melanin-concentrating hormone regulates leptin synthesis and secretion in rat adipocytes. Diabetes. 2000;49:1073–1077.

26. El-Hefnawy T, Ioffe S, Dym M. Expression of the leptin receptor during germ cell development in the mouse testis. Endocrinology. 2000;141:2624–2630.

27. Gittenberger-de Groot AC, DeRuiter MC, Bergwerff M, Poelmann RE. Smooth muscle cell origin and its relation to heterogeneity in development and disease. Arterioscler Thromb Vasc Biol. 1999;19:1589–1594.

28. Shanahan CM, Weissberg PL. Smooth muscle cell heterogeneity: patterns of gene expression in vascular smooth muscle cells in vitro and in vivo. Arterioscler Thromb Vasc Biol. 1998;18:333–338.

29. Kang SM, Kwon HM, Hong BK, Kim D, Kim IJ, Choi EY, Jang Y, Kim HS, Kim MS, Kwon HC. Expression of leptin receptor (Ob-R) in human atherosclerotic lesions: potential role in intimal neovascularization. Yonsei Med J. 2000;41:68–75.

30. Nishina PM, Naggert JK, Verstuyft J, Paigen B. Atherosclerosis in genetically obese mice: the mutation obese, diabetes, fat, tubby, and lethal yellow. Metabolism. 1994;43:554–558.

31. Fantuzzi G, Faggioni R. Leptin in the regulation of immunity, inflammation, and hematopoiesis. J Leukocyte Biol. 2000;68:437–446.

32. Matsuoka T, Tahara M, Yokoi T, Masumoto N, Takeda T, Yamaguchi M, Tasaka K, Kurachi H, Murata Y. Tyrosine phosphorylation of STAT3 by leptin through leptin receptor in mouse metaphase 2 stage oocyte. Biochem Biophys Res Commun. 1999;256:480–484.

33. Stanford W, Thompson BH, Weiss RM. Coronary artery calcification: clinical significance and current methods of detection. Am J Radiol. 1993;161:1139–1146.

34. Parhami F, Demer LL. New concepts in regulation of vascular calcification. In: Fuster V, ed. The Vulnerable Plaque: Understanding, Identification, and Modification. Armonk NY: Futura Publishing Co; 1999:383–391.




This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
M. Mizobuchi, D. Towler, and E. Slatopolsky
Vascular Calcification: The Killer of Patients with Chronic Kidney Disease
J. Am. Soc. Nephrol., July 1, 2009; 20(7): 1453 - 1464.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
G. M. London
Bone-Vascular Axis in Chronic Kidney Disease: A Reality?
Clin. J. Am. Soc. Nephrol., February 1, 2009; 4(2): 254 - 257.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
G. M. London, S. J. Marchais, A. P. Guerin, P. Boutouyrie, F. Metivier, and M.-C. de Vernejoul
Association of Bone Activity, Calcium Load, Aortic Stiffness, and Calcifications in ESRD
J. Am. Soc. Nephrol., September 1, 2008; 19(9): 1827 - 1835.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. Qasim, N. N. Mehta, M. G. Tadesse, M. L. Wolfe, T. Rhodes, C. Girman, and M. P. Reilly
Adipokines, insulin resistance, and coronary artery calcification.
J. Am. Coll. Cardiol., July 15, 2008; 52(3): 231 - 236.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
R. Mehrotra, D. Kermah, M. Budoff, I. B. Salusky, S. S. Mao, Y. L. Gao, J. Takasu, S. Adler, and K. Norris
Hypovitaminosis D in Chronic Kidney Disease
Clin. J. Am. Soc. Nephrol., July 1, 2008; 3(4): 1144 - 1151.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. K. Koh, S. M. Park, and M. J. Quon
Leptin and Cardiovascular Disease: Response to Therapeutic Interventions
Circulation, June 24, 2008; 117(25): 3238 - 3249.
[Full Text] [PDF]


Home page
CJASNHome page
P. Raggi and M. Kleerekoper
Contribution of Bone and Mineral Abnormalities to Cardiovascular Disease in Patients with Chronic Kidney Disease
Clin. J. Am. Soc. Nephrol., May 1, 2008; 3(3): 836 - 843.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Fan, Z. Chen, Y. Chen, and Y. Shang
Mechanistic Roles of Leptin in Osteogenic Stimulation in Thoracic Ligament Flavum Cells
J. Biol. Chem., October 12, 2007; 282(41): 29958 - 29966.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
E. L. Schiffrin, M. L. Lipman, and J. F.E. Mann
Chronic Kidney Disease: Effects on the Cardiovascular System
Circulation, July 3, 2007; 116(1): 85 - 97.
[Abstract] [Full Text] [PDF]


Home page
pdiHome page
T. Stompor
AN OVERVIEW OF THE PATHOPHYSIOLOGY OF VASCULAR CALCIFICATION IN CHRONIC KIDNEY DISEASE
Perit. Dial. Int., June 1, 2007; 27(Supplement_2): S215 - S222.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. Fantuzzi and T. Mazzone
Adipose Tissue and Atherosclerosis: Exploring the Connection
Arterioscler. Thromb. Vasc. Biol., May 1, 2007; 27(5): 996 - 1003.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Iribarren, G. Husson, A. S. Go, J. C. Lo, J. M. Fair, G. D. Rubin, M. A. Hlatky, and S. P. Fortmann
Plasma Leptin Levels and Coronary Artery Calcification in Older Adults
J. Clin. Endocrinol. Metab., February 1, 2007; 92(2): 729 - 732.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. C. Johnson, J. A. Leopold, and J. Loscalzo
Vascular Calcification: Pathobiological Mechanisms and Clinical Implications
Circ. Res., November 10, 2006; 99(10): 1044 - 1059.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
A. U. Momin, N. Melikian, A. M. Shah, D. J. Grieve, S. B. Wheatcroft, L. John, A. El Gamel, J. B. Desai, T. Nelson, C. Driver, et al.
Leptin is an endothelial-independent vasodilator in humans with coronary artery disease: evidence for tissue specificity of leptin resistance
Eur. Heart J., October 1, 2006; 27(19): 2294 - 2299.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
X. Qin, M. A. Corriere, L. M. Matrisian, and R. J. Guzman
Matrix Metalloproteinase Inhibition Attenuates Aortic Calcification
Arterioscler. Thromb. Vasc. Biol., July 1, 2006; 26(7): 1510 - 1516.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Ketteler, G. Schlieper, and J. Floege
Calcification and Cardiovascular Health: New Insights Into an Old Phenomenon
Hypertension, June 1, 2006; 47(6): 1027 - 1034.
[Full Text] [PDF]


Home page
ANGIOLOGYHome page
F. Taneli, S. Yegane, C. Ulman, H. Tikiz, A. R. Bilge, Z. Ari, and B. S. Uyanik
Increased Serum Leptin Concentrations in Patients with Chronic Stable Angina Pectoris and ST-Elevated Myocardial Infarction
Angiology, May 1, 2006; 57(3): 267 - 272.
[Abstract] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. Zeidan, D. M. Purdham, V. Rajapurohitam, S. Javadov, S. Chakrabarti, and M. Karmazyn
Leptin Induces Vascular Smooth Muscle Cell Hypertrophy through Angiotensin II- and Endothelin-1-Dependent Mechanisms and Mediates Stretch-Induced Hypertrophy
J. Pharmacol. Exp. Ther., December 1, 2005; 315(3): 1075 - 1084.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. D. Knudson, U. D. Dincer, G. M. Dick, H. Shibata, R. Akahane, M. Saito, and J. D. Tune
Leptin resistance extends to the coronary vasculature in prediabetic dogs and provides a protective adaptation against endothelial dysfunction
Am J Physiol Heart Circ Physiol, September 1, 2005; 289(3): H1038 - H1046.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. R. Berggren, M. W. Hulver, and J. A. Houmard
Fat as an endocrine organ: influence of exercise
J Appl Physiol, August 1, 2005; 99(2): 757 - 764.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
L. Li, J.-C. Mamputu, N. Wiernsperger, and G. Renier
Signaling Pathways Involved in Human Vascular Smooth Muscle Cell Proliferation and Matrix Metalloproteinase-2 Expression Induced by Leptin: Inhibitory Effect of Metformin
Diabetes, July 1, 2005; 54(7): 2227 - 2234.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. D. Knudson, U. D. Dincer, C. Zhang, A. N. Swafford Jr., R. Koshida, A. Picchi, M. Focardi, G. M. Dick, and J. D. Tune
Leptin receptors are expressed in coronary arteries, and hyperleptinemia causes significant coronary endothelial dysfunction
Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H48 - H56.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
T. M. Doherty, L. A. Fitzpatrick, D. Inoue, J.-H. Qiao, M. C. Fishbein, R. C. Detrano, P. K. Shah, and T. B. Rajavashisth
Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification
Endocr. Rev., August 1, 2004; 25(4): 629 - 672.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. P. Reilly, N. Iqbal, M. Schutta, M. L. Wolfe, M. Scally, A. R. Localio, D. J. Rader, and S. E. Kimmel
Plasma Leptin Levels Are Associated with Coronary Atherosclerosis in Type 2 Diabetes
J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 3872 - 3878.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. S.M. Shamsuzzaman, M. Winnicki, R. Wolk, A. Svatikova, B. G. Phillips, D. E. Davison, P. B. Berger, and V. K. Somers
Independent Association Between Plasma Leptin and C-Reactive Protein in Healthy Humans
Circulation, May 11, 2004; 109(18): 2181 - 2185.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. E. Safar, G. M London, and G. E. Plante
Arterial Stiffness and Kidney Function
Hypertension, February 1, 2004; 43(2): 163 - 168.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-S. Shao, S.-L. Cheng, N. Charlton-Kachigian, A. P. Loewy, and D. A. Towler
Teriparatide (Human Parathyroid Hormone (1-34)) Inhibits Osteogenic Vascular Calcification in Diabetic Low Density Lipoprotein Receptor-deficient Mice
J. Biol. Chem., December 12, 2003; 278(50): 50195 - 50202.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
F. Maingrette and G. Renier
Leptin Increases Lipoprotein Lipase Secretion by Macrophages: Involvement of Oxidative Stress and Protein Kinase C
Diabetes, August 1, 2003; 52(8): 2121 - 2128.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
P. K. Chelikani, D. R. Glimm, and J. J. Kennelly
Short Communication: Tissue Distribution of Leptin and Leptin Receptor mRNA in the Bovine
J Dairy Sci, July 1, 2003; 86(7): 2369 - 2372.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
P. Stenvinkel, R. Pecoits-Filho, and B. Lindholm
Coronary Artery Disease in End-Stage Renal Disease: No Longer a Simple Plumbing Problem
J. Am. Soc. Nephrol., July 1, 2003; 14(7): 1927 - 1939.
[Full Text] [PDF]


Home page
CirculationHome page
J. P. Cooke and R. K. Oka
Does Leptin Cause Vascular Disease?
Circulation, October 8, 2002; 106(15): 1904 - 1905.
[Full Text] [PDF]


Home page
CirculationHome page
A. Singhal, I. S. Farooqi, T. J. Cole, S. O'Rahilly, M. Fewtrell, M. Kattenhorn, A. Lucas, and J. Deanfield
Influence of Leptin on Arterial Distensibility: A Novel Link Between Obesity and Cardiovascular Disease?
Circulation, October 8, 2002; 106(15): 1919 - 1924.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. Parhami, B. Basseri, J. Hwang, Y. Tintut, and L. L. Demer
High-Density Lipoprotein Regulates Calcification of Vascular Cells
Circ. Res., October 4, 2002; 91(7): 570 - 576.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Fortuno, A. Rodriguez, J. Gomez-Ambrosi, P. Muniz, J. Salvador, J. Diez, and G. Fruhbeck
Leptin Inhibits Angiotensin II-Induced Intracellular Calcium Increase and Vasoconstriction in the Rat Aorta
Endocrinology, September 1, 2002; 143(9): 3555 - 3560.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. L. Mark and W. I. Sivitz
Uncoupling Metabolism and Coupling Leptin to Cardiovascular Disease
Arterioscler. Thromb. Vasc. Biol., June 1, 2002; 22(6): 881 - 883.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Bernal-Mizrachi, S. Weng, B. Li, L. A. Nolte, C. Feng, T. Coleman, J. O. Holloszy, and C. F. Semenkovich
Respiratory Uncoupling Lowers Blood Pressure Through a Leptin-Dependent Mechanism in Genetically Obese Mice
Arterioscler. Thromb. Vasc. Biol., June 1, 2002; 22(6): 961 - 968.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. A. Lange, E. M. Lange, L. F. Bielak, C. D. Langefeld, S. L. Kardia, P. Royston, S. T. Turner, P. F. Sheedy II, E. Boerwinkle, and P. A. Peyser
Autosomal Genome-Wide Scan for Coronary Artery Calcification Loci in Sibships at High Risk for Hypertension
Arterioscler. Thromb. Vasc. Biol., March 1, 2002; 22(3): 418 - 423.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
88/9/954    most recent
hh0901.090975v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parhami, F.
Right arrow Articles by Demer, L. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parhami, F.
Right arrow Articles by Demer, L. L.
Related Collections
Right arrow Pathophysiology
Right arrow Other arteriosclerosis
Right arrow Other Vascular biology