| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Integrative Physiology |
From the Departments of Medicine (F.P., Y.T., A.B., A.M.F., L.L.D.) and Physiology (L.L.D.), University of California, Los Angeles.
Correspondence to Farhad Parhami, PhD, Division of Cardiology, UCLA School of Medicine, Center for the Health Sciences, Room 47-123, 10833 Le Conte Avenue, Los Angeles, CA 90095. E-mail fparhami{at}mednet.ucla.edu
| Abstract |
|---|
|
|
|---|
Key Words: calcification calcifying vascular cells leptin atherosclerosis
| Introduction |
|---|
|
|
|---|
Previously characterized leptin receptors, which are all products of alternative splicing of the db gene transcript,6 have differential patterns of expression in different tissues.2 They share identical extracellular and membrane-spanning domains, but the intracellular domain varies in length as a result of the alternative splicing.3 The long form of the receptor (OB-Rb) seems to be responsible for generating the intracellular signals controlling hypothalamic responses to leptin. However, little is known about its role in regulating extrahypothalamic signal transduction.
Circulating leptin concentrations vary with fat mass,7 sex hormone levels,8 exposure to bacterial lipopolysaccharide,5 increased dietary fat,9 10 and age.8 11 12 Collectively, the wide distribution of leptin receptor expression and the multiple regulatory mechanisms and factors involved in the control of leptin levels suggest that leptin is involved in other physiological or pathological conditions. Sierra-Honigmann et al4 and Bouloumie et al13 showed that leptin has angiogenic activity in endothelial cells. Silver et al14 recently showed that leptin regulates the hepatic clearance of high density lipoproteins in mice, hence possibly affecting lipid-associated diseases such as atherosclerosis.
Recently, we and others showed that vascular calcification is an actively regulated process involving a subpopulation of artery wall cells, called calcifying vascular cells (CVC), that undergo osteoblastic differentiation and form hydroxyapatite mineral.15 Both leptin levels and vascular calcification increase with age8 16 and with a high-fat diet.9 17 Because leptin also modulates the differentiation of marrow osteoprogenitor cells,18 we hypothesized that leptin may modulate the differentiation of vascular osteoprogenitor cells. The results in the present report indicate, for the first time, that leptin is a potent inducer of osteoblastic differentiation and calcification of CVC in vitro and that the leptin receptor is expressed by CVC and by subpopulations of cells in the mouse artery wall. In addition, the in vivo expression of leptin in the artery wall and by human aortic endothelial cells and monocyte/macrophages in vitro are shown. The presence of leptin and its receptor in the artery wall suggests that physiological or pathological functions of artery wall cells may be targets of leptin action.
| Materials and Methods |
|---|
|
|
|---|
Alkaline Phosphatase Activity
Assay
A cell-associated alkaline phosphatase activity assay
was performed as previously
described.21
Von Kossa Staining for
Calcification
Cell monolayers were fixed in 0.1%
glutaraldehyde for 15 minutes at room temperature,
followed by staining with silver nitrate, as previously
described.21
45Ca
Incorporation
45Ca incorporation into
matrix of CVC cultures was performed as previously
described.21
Reverse Transcriptase Polymerase Chain
Reaction
Total RNA from tissue or cells grown in duplicate
60-mm tissue culture dishes was isolated using an RNA isolation kit
(Strategene). A total of 3 µg of the total RNA was
reverse-transcribed in a 50-µL reaction volume, as described
previously.22 Primers were
constructed from bovine leptin receptor (accession number U62385) and
mouse leptin receptor (accession number MMU58861), homologous to the
long form of human leptin receptor OB-Rb, and from mouse leptin
(accession number U2421.1). Sequences of the primers, synthesized by
Gibco-BRL were as follows: bovine leptin receptor: sense (1-25)
5'-GTGCCAGCAACTACAGATGCTCTAC-3', antisense (356-380)
5'-AGTTCATCCAGGCCTTCTGAGAACG-3'; mouse leptin receptor: sense
(2872-2893) 5'-TGAGATGGTCCCAGCAGC-TATG-3', antisense
(3260-3239) 5'-CCAAAAGCTCATC-CAACCCCGA-3'; and mouse leptin:
sense (7-26) 5'-TGGAGACCCCTGTGTCGG- TT-3', antisense (479-502)
5'-AGCATTCAGGGCTAACAT-CCAACT-3'. Polymerase chain reaction (PCR)
was performed as previously
described,22 except the
annealing temperature was 65°C and the total number of cycles was 45
for bovine leptin receptor, 36 for mouse leptin receptor, and 41 for
mouse leptin. PCR products (expected length of 380 base pairs for
bovine leptin receptor, 389 base pairs for mouse leptin receptor, and
496 base pairs for mouse leptin) were electrophoresed on an agarose gel
and visualized using ethidium bromide stain. All PCR products were
sequenced by the University of California at Los Angeles (UCLA)
sequencing core laboratory, and the sequencing results were
electronically compared with GenBank entries
using BLAST NIH software. Bovine leptin receptor PCR product
showed the highest similarity to the submitted entry U62385 (Bos taurus
obese receptor gene); the mouse leptin receptor PCR product showed
the highest similarity to the submitted entry AF098792 (Mus musculus
leptin receptor long isoform Rb gene); and the mouse leptin PCR
product showed the highest similarity to the submitted entry
NM_008493 (Mus musculus leptin mRNA).
Immunocytochemistry
Confluent CVC monolayers were grown in chamber slides
and fixed with 4% paraformaldehyde and stained with
the polyclonal rabbit anti-mouse leptin receptor antibody OBR-E1
(Torrey Pines Biolabs) at a concentration of 4 µg/mL. This antibody
was generated using Escherichia
coliexpressed recombinant OB receptor, amino acids 25 to
208, as an immunogen. It was found to react with both recombinant and
natural mouse OB receptor (per Torrey Pines Biolabs). As a negative
control, nonimmunized rabbit IgG at concentrations equal to the
anti-leptin receptor antibody was used. Biotinylated secondary antibody
was used for visualization, and counterstaining with hematoxylin was
performed.
Western Blot Analysis
CVC grown in duplicate 100-mm plates were scraped and
centrifuged, and the cell pellet was resuspended in 1x PBS
containing protease inhibitors (0.5 µg/mL leupeptin, 0.7
µg/mL pepstatin, and 0.2 mmol/L phenylmethylsulfonyl
fluoride). A partially purified membrane fraction was prepared
by freeze-thawing the cells 3 times in a dry iceethanol bath. On
visualization under light microscope, all cells were ruptured. The
membrane fraction was then collected after
centrifugation for 10 minutes at
14 000g, resuspended in lysis
buffer containing protease inhibitors under reducing
conditions, and electrophoresed on 8% Tris-glycine gels
(Novex). This was followed by transfer to
nitrocellulose membranes, as previously
described.22 The blots were
probed with 2 µg/mL of either the polyclonal rabbit anti-mouse leptin
receptor antibody OBR-E1 (Torrey Pines Biolabs) or with nonimmunized
rabbit IgG. Detection of immunoreactive proteins was done by enhanced
chemiluminescence
(Amersham).
Northern Blot Analysis
A total of 10 µg of total RNA extracted from
tissues or cells was electrophoresed through a 1% agarose gel and
transblotted to a nylon membrane, as previously
described.19 The blot was
hybridized with a 32P-labeled human leptin
probe generated by PCR using the gene sequence for human leptin
(accession No. U43653). The sequences of the primers synthesized by
Gibco-BRL were as follows: sense (67-87) 5'-GAACCCTGTGCGGATTCTTGT-3';
antisense (344-367) 5'- AGGTTCTCCAGGTCGTTGGATATT 3'. A PCR product
of 301 base pairs was gel-purified and used for Northern
analysis. The PCR product was sequenced by the UCLA
sequencing core laboratory, and the sequencing results were
electronically compared with GenBank entries using BLAST NIH software.
They showed the highest similarity to submitted entry XM_004625
(Homo sapiens leptin
mRNA).
Leptin RIA
Leptin RIA was performed on conditioned media from
cultured human aortic endothelial cells and human
monocyte/macrophages. Cells were cultured in 60-mm tissue
culture plates as described above for 6 days. The media was then
replaced with 3 ml of IMDM for monocyte/macrophages and M199
for endothelial cells, both containing 10% FBS. After
48 hours, conditioned media was collected, centrifuged to
remove detached cells, and stored at -70°C. The cell layer was
dissolved in 0.4 mol/L NaOH, and the protein concentration was
measured using the Bradford protein assay
(Bio-Rad). A total of 100 µL of conditioned
media from each cell type was used in the human leptin RIA assay from
Linco Research according to the manufacturers instructions. According
the manufacturers information, this RIA assay has 100% specificity
for human leptin and <0.2% specificity for leptin from other species.
The leptin concentrations obtained were normalized to cellular protein
content.
Tissue Preparation and
Immunohistochemistry
Normal aortas were obtained from 6-month-old, female,
C57BL/6J mice. Atherosclerotic aortas were obtained from 6-month-old,
female, LDL receptornull mice fed an atherogenic diet for 4 months or
from apoE-null mice, the F2 progeny of a C57BL/6J X DBA/2J intercross
(generous gift of Dr Thomas A. Drake, Department of Pathology,
UCLA), fed a high-fat atherogenic diet for 4 months. The aortas were
surgically removed, embedded in OCT compound
(Fisher Scientific), and frozen in liquid
nitrogen. Unfixed 8-µm serial sections were incubated in Tris saline
solution containing 8 mmol/L Tris-base, 40 mmol/L Tris-HCl,
150 mmol/L NaCl, 5% wt/vol nonfat dry milk, and 1% v/v normal
goat serum for 2 hours at room temperature to block nonspecific binding
and then stained for leptin receptor using the OBR-E1 polyclonal rabbit
anti-mouse antibody (Torrey Pines Biolabs) at 4 µg/mL, for von
Willebrand factor using a polyclonal rabbit anti-human antibody
(DAKO Corp) at 1 µg/mL, or for leptin using an
affinity-purified rabbit anti-mouse polyclonal antibody (OB A-20, Santa
Cruz Biotechnology) at 1 µg/mL. To control for possible nonspecific
staining, serial sections were stained with leptin antibody neutralized
with blocking peptide (Santa Cruz Biotechnology) according to the
manufacturers instructions. Biotinylated goat anti-rabbit secondary
antibody was used to detect the primary antibodies and visualized using
the Vectastain ABC kit (Vector Labs) followed by
Peroxidase Chromogen AEC kit (Biomeda Corp), according to the
manufacturers instructions. Tissue sections were counterstained with
hematoxylin.
Statistical Analysis
Statistical analyses were performed using
ANOVA.
| Results |
|---|
|
|
|---|
|
Leptin Receptor Is Expressed in CVC
To examine the expression of leptin receptor in CVC, we
performed reverse transcriptase PCR (RT-PCR) using RNA isolated from
confluent cultures of CVC with primers specific for OB-Rb. The presence
of a PCR product of the expected size of 380 base pairs indicated
that OB-Rb was expressed in CVC
(Figure 2A
). Immunocytochemistry performed on
nonpermeabilized confluent cultures of CVC with an
antibody to the conserved extracellular domain of leptin receptors
showed strong immunoreactivity in 30% to 40% of the cells in the
monolayer
(Figure 2B
). No immunoreactivity was found when nonimmune
rabbit IgG was used as a control
(Figure 2B
). Western blot analysis of 10 µg of
membrane preparation from CVC identified 5 previously described bands
(Figure 2C
).4 13 18
No immunoreactivity was found with control nonimmune rabbit IgG (data
not shown).
|
Leptin Receptor Is Expressed in the Artery
Wall
To examine the expression of leptin receptor in the
artery wall, immunohistochemistry was performed on thoracic aortic
specimens from C57BL/6J mice. Immunoreactivity with leptin receptor
antibody was found along the outer circumference of the vessel wall
(Figure 3A
), mainly specific to subpopulations of medial and
adventitial cells near the external elastic lamina
(Figure 3D
). Immunoreactivity was also found associated with
the endothelium of the adventitial vessels but not with
the aortic endothelium
(Figure 3A
). Positive staining with von Willebrand
factor identified the endothelium of the vessels
(Figure 3B
), and nonimmune rabbit IgG, used as a negative
control, showed no reactivity in serial sections
(Figure 3C
). An identical pattern of staining was found in 4
of 4 specimens obtained from separate animals.
|
We further confirmed the expression of the leptin receptor
in the artery wall by RT-PCR
(Figure 4A
). Analysis of RNA isolated from 2 separate
aortas from C57BL/6J mice showed an expected size band of 389 base
pairs, corresponding to the mouse OB-Rb. RNA extracted from mouse
liver, which has previously been found to express leptin
receptor,2 was used as a
positive control.
|
Expression of Leptin in Artery Wall and by
Artery Wall Cells
To test whether leptin is produced locally in the
artery wall, which would expose vascular cells to high leptin
concentrations, we tested for its expression in the aorta. RT-PCR using
RNA isolated from whole mouse aortas showed expression of leptin mRNA
by aortic cells
(Figure 4B
). RNA isolated from abdominal fat was used as a
positive control
(Figure 4B
). Furthermore, immunohistochemical
analysis using an anti-mouse leptin antibody demonstrated the
presence of leptin in atherosclerotic lesions in mice, but
substantially less or no expression in normal aortas
(Figure 5
).
|
To further identify vascular cells capable of
expressing leptin, we tested various artery wall cells for the in vitro
expression of leptin. Northern blot analysis of total RNA
isolated from confluent cultures of human aortic
endothelial cells and monocyte/macrophages, as
well as human adipocytes used as positive control, showed a 4.5-Kb band
corresponding to leptin
mRNA25
(Figure 6
). Furthermore, leptin secretion was quantified by
RIA in conditioned media from human aortic endothelial
cells and monocyte/macrophages. Results from a
representative of 2 experiments performed on
quadruplicate samples showed 1.2±0.1 ng of leptin/mg of cell protein
in endothelial cells and 3.6±0.6 ng of leptin/mg of
cell protein in monocyte/macrophage-conditioned media. Although
the conditioned medium contained FBS, which may contain bovine leptin,
this assay is specific for human
leptin.
|
| Discussion |
|---|
|
|
|---|
In addition to smooth muscle cells, marrow stromal cells, another mesenchymal cell population, have been reported to express leptin receptor; therefore, it is intriguing to speculate that vascular pericytes may be the adventitial cells expressing leptin receptor. Immunoreactivity of small vessel endothelium for the leptin receptor antibody is consistent with the recent report by Sierra-Honigmann et al4 showing leptin receptor expression in microvascular endothelium of human dermis and adipose tissue. Lack of immunostaining for leptin receptor in the aortic endothelium suggests specificity to microvascular endothelium and may prove to be an interesting and physiologically important difference between the endothelium of large and small vessels that deserves further investigation.
Recently, Kang et al29 also identified the leptin receptor in atherosclerotic human arteries, predominantly in foam cells, vascular smooth muscle cells, and the endothelial cells of intimal neovessels. In the present report, we also provide evidence that leptin is produced in vitro by cells of the artery wall and in atherosclerotic lesions. Although leptin protein was not evident on immunohistochemistry of the normal mouse aorta, it is possible that the endothelial cells secreted the protein into the circulation. In contrast, in atherosclerotic lesions, leptin protein may be trapped in the abnormal matrix, and it may also be produced by monocytes and macrophages within the lesion. Altogether, it is clear that the leptin receptor is present on artery wall cells; therefore, the role of leptin in regulating the function of these cells and the artery wall deserves further elucidation. Interestingly, Nishina et al30 reported that mice lacking leptin (ob/ob) or leptin receptor (db/db) had reduced atherosclerotic lesion areas compared with controls, which was partially contributed to by the increased HDL levels in these mice. However, because leptin may regulate inflammation and immunity,31 it is intriguing to speculate that the reduced lesion area reported by Nishina et al30 may by partially due to the absence of leptin and its proinflammatory effects in the mutant mice.
The present results also indicate that leptin regulates the osteogenic differentiation of a subpopulation of vascular cells. Leptin induced alkaline phosphatase activity and subsequent mineralization in CVC. The pro-osteogenic differentiation effects of leptin are consistent with findings of Thomas et al,18 who recently reported that leptin induces the osteoblastic differentiation of marrow stromal cells, which also express leptin receptors.
We also examined the effect of leptin on 2 major signaling molecules, STAT3 and cAMP. Leptin induces the phosphorylation and activation of STAT3 in several cell types, including endothelial cells and oocytes.4 32 However, leptin did not induce the activation of STAT3 in CVC, as indicated by a lack of phosphorylation of STAT3 in leptin-treated cells. We previously reported that the induction of cAMP levels in CVC enhances their osteogenic differentiaton.22 Treating CVC with leptin did not have a significant effect on cAMP levels (data not shown). These results suggest that the pro-osteogenic effects of leptin on CVC are independent of STAT3 or cAMP.
The present report further supports the role of leptin as a regulator of peripheral tissue physiology by providing anatomical evidence of leptin receptor expression in the aortic wall and biological activity promoting the calcification of cells derived from vascular tissue. This is a significant finding given the importance of vascular calcification in the diseases of the artery wall, including atherosclerosis, and the aging-associated impairment of its elastic functions.33 34
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Fei H, Okano HJ, Li C, Lee GH, Zhao C, Darnell R, Friedman JM. Anatomic localization of alternatively spliced leptin receptors (Ob-R) in mouse brain and other tissues. Proc Natl Acad Sci U S A. 1997;94:70017005.
3. Barr VA, Lane K, Taylor SI. Subcellular localization and internalization of the four human leptin receptor isoforms. J Biol Chem. 1999;274:2141621424.
4. Sierra-Honigmann MR, Nath AK, Murakami C, Garcia-Cardena G, Papapetropoulos A, Sessa WC, Madge LA, Schechner JS, Schwabb MB, Polverini PJ, Flores-Riveros JR. Biological action of leptin as an angiogenic factor. Science. 1998;281:16831686.
5. Francis J, Mohankumar PS, Mohankumar SMJ, Quadri SK. Systemic administration of lipopolysaccharide increases plasma leptin levels. Endocrine. 1999;10:291295.
6. Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM. Abnormal splicing of the leptin receptor in diabetic mice. Nature. 1996;379:632635.
7. Moller N, OBrien P, Nair KS. Disruption of the relationship between fat content and leptin levels with aging in humans. J Clin Endocrinol Metab. 1998;83:931934.
8. Baumgartner RN, Waters DL, Morley JE, Patrick P, Montoya GD, Garry PJ. Age-related changes in sex hormones affect the sex differences in serum leptin independently of changes in body fat. Metabolism. 1999;48:378384.
9. Ahren B. Plasma leptin and insulin in C57BL/6J mice on a high-fat diet: relation to subsequent changes in body weight. Acta Physiol Scand. 1999;165:233240.
10. Ahren B, Mansson S, Gingerich RL, Havel PJ. Regulation of plasma leptin in mice: influence of age, high-fat diet, and fasting. Am J Physiol.. 1997;273:R113R120.
11. Li H, Matheny M, Tumer N, Scarpace PJ. Aging and fasting regulation of leptin and hypothalamic neuropeptide Y gene expression. Am J Physiol. 1998;275:E405E411.
12. Li H, Matheny M, Nicolson M, Tumer N, Scarpace PJ. Leptin gene expression increases with age independent of increasing adiposity in rats. Diabetes. 1997;46:20352039.
13. Bouloumie A, Drexler CAH, Lafontan M, Busse R. Leptin, the product of Ob gene, promotes angiogenesis. Circ Res. 1998;83:10591066.
14. Silver DL, Jiang X, Tall A. Increased high density lipoprotein (HDL), defective hepatic catabolism of Apo A-I and ApoA-II, and decreased ApoA-I mRNA in ob/ob mice. J Biol Chem. 1999;274:41404146.
15. Watson KE, Bostrom K, Ravindranath R, Lam T, Norton B, Demer LL. TGF-ß1 and 25-hydroxycholesterol stimulate osteoblast-like vascular cells to calcify. J Clin Invest. 1994;93:21062113.
16. Agatston AS, Janowitz WR, Hildner FJ, Zusmer NR, Viamonte M, Detrano R. Quantification of coronary artery calcium using ultrafast computed tomography. J Am Coll Cardiol. 1990;15:827832.
17. Towler DA, Bidder M, Latifi T, Coleman T, Semenkovich CF. Diet-induced diabetes activates an osteogenic gene regulatory program in the aortas of low density lipoprotein receptor-deficient mice. J Biol Chem. 1998;273:3042730434.
18. Thomas T, Gori F, Khosla S, Jensen MD, Burguera B, Riggs BL. Leptin acts on human marrow stromal cells to enhance differentiation to osteoblasts and to inhibit differentiation to adipocytes. Endocrinology. 1999;140:16301638.
19. Parhami F, Fang ZT, Fogelman AM, Andalibi A, Territo MC, Berliner JA. Minimally modified low density lipoprotein-induced inflammatory responses in endothelial cells are mediated by cyclic adenosine monophosphate. J Clin Invest. 1993;92:471478.
20. Colotta F, Peri G, Villa A, Mantovani A. A rapid killing of actinomycin D-treated tumor cells by human mononuclear cells. J Immunol. 1984;132:936944.
21. Parhami F, Morrow AD, Balucan J, Leitinger N, Watson AD, Tintut Y, Berliner JA, Demer LL. Lipid oxidation products have opposite effects on calcifying vascular cell and bone cell differentiation. Arterioscler Thromb Vasc Biol. 1997;17:680687.
22. Tintut Y, Parhami F, Bostrom K, Jackson SM, Demer LL. cAMP stimulates osteoblast-like differentiation of calcifying vascular cells. J Biol Chem. 1998;273:75477553.
23. Anderson HC. Molecular biology of matrix vesicles. Clin Orthop. 1995;314:266280.
24. Narisawa S, Hofmann MC, Ziomek CA, Millan JL. Embryonic alkaline phosphatase is expressed at M-phase in the spermatogenic lineage of the mouse. Development. 1992;116:159165.
25. Bradley RL, Kokkotou EG, Maratos-Flier E, Cheatham B. Melanin-concentrating hormone regulates leptin synthesis and secretion in rat adipocytes. Diabetes. 2000;49:10731077.
26. El-Hefnawy T, Ioffe S, Dym M. Expression of the leptin receptor during germ cell development in the mouse testis. Endocrinology. 2000;141:26242630.
27. Gittenberger-de Groot AC, DeRuiter MC, Bergwerff M, Poelmann RE. Smooth muscle cell origin and its relation to heterogeneity in development and disease. Arterioscler Thromb Vasc Biol. 1999;19:15891594.
28. Shanahan CM, Weissberg PL. Smooth muscle cell heterogeneity: patterns of gene expression in vascular smooth muscle cells in vitro and in vivo. Arterioscler Thromb Vasc Biol. 1998;18:333338.
29. Kang SM, Kwon HM, Hong BK, Kim D, Kim IJ, Choi EY, Jang Y, Kim HS, Kim MS, Kwon HC. Expression of leptin receptor (Ob-R) in human atherosclerotic lesions: potential role in intimal neovascularization. Yonsei Med J. 2000;41:6875.
30. Nishina PM, Naggert JK, Verstuyft J, Paigen B. Atherosclerosis in genetically obese mice: the mutation obese, diabetes, fat, tubby, and lethal yellow. Metabolism. 1994;43:554558.
31. Fantuzzi G, Faggioni R. Leptin in the regulation of immunity, inflammation, and hematopoiesis. J Leukocyte Biol. 2000;68:437446.
32. Matsuoka T, Tahara M, Yokoi T, Masumoto N, Takeda T, Yamaguchi M, Tasaka K, Kurachi H, Murata Y. Tyrosine phosphorylation of STAT3 by leptin through leptin receptor in mouse metaphase 2 stage oocyte. Biochem Biophys Res Commun. 1999;256:480484.
33. Stanford W, Thompson BH, Weiss RM. Coronary artery calcification: clinical significance and current methods of detection. Am J Radiol. 1993;161:11391146.
34. Parhami F, Demer LL. New concepts in regulation of vascular calcification. In: Fuster V, ed. The Vulnerable Plaque: Understanding, Identification, and Modification. Armonk NY: Futura Publishing Co; 1999:383391.
This article has been cited by other articles:
![]() |
M. Mizobuchi, D. Towler, and E. Slatopolsky Vascular Calcification: The Killer of Patients with Chronic Kidney Disease J. Am. Soc. Nephrol., July 1, 2009; 20(7): 1453 - 1464. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. London Bone-Vascular Axis in Chronic Kidney Disease: A Reality? Clin. J. Am. Soc. Nephrol., February 1, 2009; 4(2): 254 - 257. [Full Text] [PDF] |
||||
![]() |
G. M. London, S. J. Marchais, A. P. Guerin, P. Boutouyrie, F. Metivier, and M.-C. de Vernejoul Association of Bone Activity, Calcium Load, Aortic Stiffness, and Calcifications in ESRD J. Am. Soc. Nephrol., September 1, 2008; 19(9): 1827 - 1835. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Qasim, N. N. Mehta, M. G. Tadesse, M. L. Wolfe, T. Rhodes, C. Girman, and M. P. Reilly Adipokines, insulin resistance, and coronary artery calcification. J. Am. Coll. Cardiol., July 15, 2008; 52(3): 231 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mehrotra, D. Kermah, M. Budoff, I. B. Salusky, S. S. Mao, Y. L. Gao, J. Takasu, S. Adler, and K. Norris Hypovitaminosis D in Chronic Kidney Disease Clin. J. Am. Soc. Nephrol., July 1, 2008; 3(4): 1144 - 1151. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Koh, S. M. Park, and M. J. Quon Leptin and Cardiovascular Disease: Response to Therapeutic Interventions Circulation, June 24, 2008; 117(25): 3238 - 3249. [Full Text] [PDF] |
||||
![]() |
P. Raggi and M. Kleerekoper Contribution of Bone and Mineral Abnormalities to Cardiovascular Disease in Patients with Chronic Kidney Disease Clin. J. Am. Soc. Nephrol., May 1, 2008; 3(3): 836 - 843. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Fan, Z. Chen, Y. Chen, and Y. Shang Mechanistic Roles of Leptin in Osteogenic Stimulation in Thoracic Ligament Flavum Cells J. Biol. Chem., October 12, 2007; 282(41): 29958 - 29966. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Schiffrin, M. L. Lipman, and J. F.E. Mann Chronic Kidney Disease: Effects on the Cardiovascular System Circulation, July 3, 2007; 116(1): 85 - 97. [Abstract] [Full Text] [PDF] |
||||
|
|
T. Stompor AN OVERVIEW OF THE PATHOPHYSIOLOGY OF VASCULAR CALCIFICATION IN CHRONIC KIDNEY DISEASE Perit. Dial. Int., June 1, 2007; 27(Supplement_2): S215 - S222. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fantuzzi and T. Mazzone Adipose Tissue and Atherosclerosis: Exploring the Connection Arterioscler. Thromb. Vasc. Biol., May 1, 2007; 27(5): 996 - 1003. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Iribarren, G. Husson, A. S. Go, J. C. Lo, J. M. Fair, G. D. Rubin, M. A. Hlatky, and S. P. Fortmann Plasma Leptin Levels and Coronary Artery Calcification in Older Adults J. Clin. Endocrinol. Metab., February 1, 2007; 92(2): 729 - 732. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Johnson, J. A. Leopold, and J. Loscalzo Vascular Calcification: Pathobiological Mechanisms and Clinical Implications Circ. Res., November 10, 2006; 99(10): 1044 - 1059. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. U. Momin, N. Melikian, A. M. Shah, D. J. Grieve, S. B. Wheatcroft, L. John, A. El Gamel, J. B. Desai, T. Nelson, C. Driver, et al. Leptin is an endothelial-independent vasodilator in humans with coronary artery disease: evidence for tissue specificity of leptin resistance Eur. Heart J., October 1, 2006; 27(19): 2294 - 2299. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Qin, M. A. Corriere, L. M. Matrisian, and R. J. Guzman Matrix Metalloproteinase Inhibition Attenuates Aortic Calcification Arterioscler. Thromb. Vasc. Biol., July 1, 2006; 26(7): 1510 - 1516. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ketteler, G. Schlieper, and J. Floege Calcification and Cardiovascular Health: New Insights Into an Old Phenomenon Hypertension, June 1, 2006; 47(6): 1027 - 1034. [Full Text] [PDF] |
||||
![]() |
F. Taneli, S. Yegane, C. Ulman, H. Tikiz, A. R. Bilge, Z. Ari, and B. S. Uyanik Increased Serum Leptin Concentrations in Patients with Chronic Stable Angina Pectoris and ST-Elevated Myocardial Infarction Angiology, May 1, 2006; 57(3): 267 - 272. [Abstract] [PDF] |
||||
![]() |
A. Zeidan, D. M. Purdham, V. Rajapurohitam, S. Javadov, S. Chakrabarti, and M. Karmazyn Leptin Induces Vascular Smooth Muscle Cell Hypertrophy through Angiotensin II- and Endothelin-1-Dependent Mechanisms and Mediates Stretch-Induced Hypertrophy J. Pharmacol. Exp. Ther., December 1, 2005; 315(3): 1075 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Knudson, U. D. Dincer, G. M. Dick, H. Shibata, R. Akahane, M. Saito, and J. D. Tune Leptin resistance extends to the coronary vasculature in prediabetic dogs and provides a protective adaptation against endothelial dysfunction Am J Physiol Heart Circ Physiol, September 1, 2005; 289(3): H1038 - H1046. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Berggren, M. W. Hulver, and J. A. Houmard Fat as an endocrine organ: influence of exercise J Appl Physiol, August 1, 2005; 99(2): 757 - 764. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li, J.-C. Mamputu, N. Wiernsperger, and G. Renier Signaling Pathways Involved in Human Vascular Smooth Muscle Cell Proliferation and Matrix Metalloproteinase-2 Expression Induced by Leptin: Inhibitory Effect of Metformin Diabetes, July 1, 2005; 54(7): 2227 - 2234. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Knudson, U. D. Dincer, C. Zhang, A. N. Swafford Jr., R. Koshida, A. Picchi, M. Focardi, G. M. Dick, and J. D. Tune Leptin receptors are expressed in coronary arteries, and hyperleptinemia causes significant coronary endothelial dysfunction Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H48 - H56. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Doherty, L. A. Fitzpatrick, D. Inoue, J.-H. Qiao, M. C. Fishbein, R. C. Detrano, P. K. Shah, and T. B. Rajavashisth Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification Endocr. Rev., August 1, 2004; 25(4): 629 - 672. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Reilly, N. Iqbal, M. Schutta, M. L. Wolfe, M. Scally, A. R. Localio, D. J. Rader, and S. E. Kimmel Plasma Leptin Levels Are Associated with Coronary Atherosclerosis in Type 2 Diabetes J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 3872 - 3878. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S.M. Shamsuzzaman, M. Winnicki, R. Wolk, A. Svatikova, B. G. Phillips, D. E. Davison, P. B. Berger, and V. K. Somers Independent Association Between Plasma Leptin and C-Reactive Protein in Healthy Humans Circulation, May 11, 2004; 109(18): 2181 - 2185. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Safar, G. M London, and G. E. Plante Arterial Stiffness and Kidney Function Hypertension, February 1, 2004; 43(2): 163 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Shao, S.-L. Cheng, N. Charlton-Kachigian, A. P. Loewy, and D. A. Towler Teriparatide (Human Parathyroid Hormone (1-34)) Inhibits Osteogenic Vascular Calcification in Diabetic Low Density Lipoprotein Receptor-deficient Mice J. Biol. Chem., December 12, 2003; 278(50): 50195 - 50202. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Maingrette and G. Renier Leptin Increases Lipoprotein Lipase Secretion by Macrophages: Involvement of Oxidative Stress and Protein Kinase C Diabetes, August 1, 2003; 52(8): 2121 - 2128. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Chelikani, D. R. Glimm, and J. J. Kennelly Short Communication: Tissue Distribution of Leptin and Leptin Receptor mRNA in the Bovine J Dairy Sci, July 1, 2003; 86(7): 2369 - 2372. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Stenvinkel, R. Pecoits-Filho, and B. Lindholm Coronary Artery Disease in End-Stage Renal Disease: No Longer a Simple Plumbing Problem J. Am. Soc. Nephrol., July 1, 2003; 14(7): 1927 - 1939. [Full Text] [PDF] |
||||
![]() |
J. P. Cooke and R. K. Oka Does Leptin Cause Vascular Disease? Circulation, October 8, 2002; 106(15): 1904 - 1905. [Full Text] [PDF] |
||||
![]() |
A. Singhal, I. S. Farooqi, T. J. Cole, S. O'Rahilly, M. Fewtrell, M. Kattenhorn, A. Lucas, and J. Deanfield Influence of Leptin on Arterial Distensibility: A Novel Link Between Obesity and Cardiovascular Disease? Circulation, October 8, 2002; 106(15): 1919 - 1924. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Parhami, B. Basseri, J. Hwang, Y. Tintut, and L. L. Demer High-Density Lipoprotein Regulates Calcification of Vascular Cells Circ. Res., October 4, 2002; 91(7): 570 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fortuno, A. Rodriguez, J. Gomez-Ambrosi, P. Muniz, J. Salvador, J. Diez, and G. Fruhbeck Leptin Inhibits Angiotensin II-Induced Intracellular Calcium Increase and Vasoconstriction in the Rat Aorta Endocrinology, September 1, 2002; 143(9): 3555 - 3560. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Mark and W. I. Sivitz Uncoupling Metabolism and Coupling Leptin to Cardiovascular Disease Arterioscler. Thromb. Vasc. Biol., June 1, 2002; 22(6): 881 - 883. [Full Text] [PDF] |
||||
![]() |
C. Bernal-Mizrachi, S. Weng, B. Li, L. A. Nolte, C. Feng, T. Coleman, J. O. Holloszy, and C. F. Semenkovich Respiratory Uncoupling Lowers Blood Pressure Through a Leptin-Dependent Mechanism in Genetically Obese Mice Arterioscler. Thromb. Vasc. Biol., June 1, 2002; 22(6): 961 - 968. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Lange, E. M. Lange, L. F. Bielak, C. D. Langefeld, S. L. Kardia, P. Royston, S. T. Turner, P. F. Sheedy II, E. Boerwinkle, and P. A. Peyser Autosomal Genome-Wide Scan for Coronary Artery Calcification Loci in Sibships at High Risk for Hypertension Arterioscler. Thromb. Vasc. Biol., March 1, 2002; 22(3): 418 - 423. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |