This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xu, S.-Z. Articles by Beech, D. J. Search for Related Content PubMed PubMed Citation Articles by Xu, S.-Z. Articles by Beech, D. J. Related Collections Ion channels/membrane transport

(Circulation Research. 2001;88:84.)
© 2001 American Heart Association, Inc.

Cellular Biology

TrpC1 Is a Membrane-Spanning Subunit of Store-Operated Ca²⁺ Channels in Native Vascular Smooth Muscle Cells

Shang-Zhong Xu, David J. Beech

From the School of Biomedical Sciences, University of Leeds, Leeds, UK.

Correspondence to D.J. Beech, School of Biomedical Sciences, University of Leeds, Leeds LS2 9JT, UK. E-mail d.j.beech{at}leeds.ac.uk

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract—Mammalian counterparts of the Drosophila trp gene have been suggested to encode store-operated Ca²⁺ channels. These specialized channels are widely distributed and may have a general function to reload Ca²⁺ into sarcoplasmic reticulum as well as specific functions, including the control of cell proliferation and muscle contraction. Heterologous expression of mammalian trp genes enhances or generates Ca²⁺ channel activity, but the crucial question of whether any of the genes encode native subunits of store-operated channels remains unanswered. We have investigated if TrpC1 protein (encoded by trp1 gene) is a store-operated channel in freshly isolated smooth muscle cells of resistance arterioles, arteries, and veins from human, mouse, or rabbit. Messenger RNA encoding TrpC1 was broadly expressed. TrpC1-specific antibody targeted to peptide predicted to contribute to the outer vestibule of TrpC1 channels revealed that TrpC1 is localized to the plasma membrane and has an extracellular domain. Peptide-specific binding of the antibody had a functional effect, selectively blocking store-operated Ca²⁺ channel activity. The antibody is a powerful new tool for the study of mammalian trp1 gene product. The study shows that TrpC1 is a novel physiological Ca²⁺ channel subunit in arterial smooth muscle cells.

Key Words: calcium channel • blood vessel • artery • vascular smooth muscle

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Store-operated channels (SOCs) are plasma-membrane Ca²⁺ channels that open when Ca²⁺ levels in sarcoplasmic or endoplasmic reticulum are depleted.^{1 2} They are also referred to as capacitative Ca²⁺ entry channels, and highly Ca²⁺-selective SOCs are called CRAC (Ca²⁺ release–activated Ca²⁺) channels.^{1 2 3} SOCs may serve an essential housekeeping function to refill sarcoplasmic reticulum after Ca²⁺ release.² SOCs may also be involved in muscle contraction,^{1 4} control of proliferation in smooth muscle cells,⁵ and CD95-mediated cell apoptosis.^{6 7}

Knowledge of the molecular basis of SOCs is of fundamental importance for the understanding of Ca²⁺ signaling. One suggestion is that SOCs are products of mammalian trp genes (related to Drosophila trp/trpl genes).^{8 9} Expressed trp3 induces channel activity associated with store depletion, but it requires coactivation of receptors or diacylglycerol.¹⁰ Trp4 is suggested to be an SOC¹¹ but is also described as a receptor-operated channel that cannot be activated by store depletion.¹² Expressed trp1 may behave as an SOC,¹³ but it is also reported to be a basally active channel independent of Ca²⁺ stores¹⁴ and a diacylglycerol-activated channel.¹⁵ These studies indicate that trp gene products are associated with SOCs, but evidence is lacking that they are membrane-spanning subunits or SOCs in native mammalian cells.^{16 17} We sought to determine if TrpC1 (the mammalian trp1 gene product) is a SOC in vascular smooth muscle cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Human left internal mammary arteries (LIMAs) and aortas were obtained with ethical approval from the Leeds Teaching Hospitals Local Research Ethics Committee. Vessels were placed in Hanks’ solution containing (in mmol/L) NaCl 137, KCl 5.4, CaCl₂ 0.01, NaH₂PO₄ 0.34, K₂HPO₄ 0.44, d-glucose 8, and HEPES 5. Other vessels were from male Wistar rats or BalbC mice. Arteriole fragments were obtained from pial membrane.¹⁸ Cells and vessels were stored at 4°C in Hanks’ solution (<13 hours). mRNA was isolated with Dynabeads Oligo (dT)₂₅ (Dynal). Bead complexes were washed and transferred to 20 µL SuperScript RNase H^- Reverse Transcriptase (Gibco-BRL) at 42°C (30 minutes). Primers for trp1 were TGGTATGAAGGGTTGGAAGAC (forward) and GGTATCATTGCTTTGCTGTTC (reverse). Primers for ß-actin detection were TTGTAACCAACTGGGACGATATG (forward) and GATCTTGAT-CTTCATGGTGCTGG (reverse). Thermal cycling was 95°C (5 minutes), 40 cycles at 94°C (30 seconds), 53°C to 60°C (1 minute), 72°C (1 minute), and 72°C (7 minutes). Products were detected on 1.5% agarose gels and directly sequenced for rabbit pial membrane. T1E3 antibody was prepared in rabbit by Sigma-Genosys (UK) and targeted to TrpC1 sequence (Figure 2). Specificity was tested by ELISA, and preimmune serum had no activity. T1E3 antiserum was used at 1:500 dilution, and antigenic peptide was used at 10 µmol/L. For experiments in 100 mmol/L K⁺, antiserum was cleaned on a HiTrap protein A column and used at 1:100 dilution with and without antigenic peptide at 20 µmol/L. For Western blotting, tissues were placed in 100 µmol/L phenylmethylsulphonylfluoride (Sigma) and lysed in SDS buffer containing 100 µmol/L dithiothreitol at 80°C to 100°C (15 minutes). Proteins were separated on 10% SDS-PAGE gels and transferred to nitrocellulose, which was rinsed with PBS and incubated in PBS containing 10% milk for 1 hour (room temperature). Incubation in T1E3 was overnight at 4°C, followed by washes in PBS and incubation in horseradish peroxidase-secondary antibody (1:5000, BioRad) for 1 hour (room temperature). Membranes were washed with PBS, and labeling was detected by ECLplus (Amersham). For immunofluorescence, tissues and cells adhered to poly-l-lysine–coated slides were incubated in 1% BSA/PBS and transferred to T1E3 antibody for 12 hours and secondary antibody (mouse anti-rabbit IgG-FITC, 1:160, Sigma) for 1 hour. Cells were identified with anti–smooth muscle -actin antibody (anti–-SMA-Cy3, 1:200, Sigma). Microscopy images were processed with Openlab software (Improvision). Permeabilized cells were fixed in 2% paraformaldehyde (30 minutes) and immersed in -20°C methanol (1 minute) and 1% BSA with 0.1% Triton X-100 for 1 hour. Ratiometric [Ca²⁺]_i or [Ba²⁺]_i measurements were as described¹⁹ but using 340/380 nm excitation, and background fluorescence was subtracted. The superfusion solution contained (in mmol/L) NaCl 130, KCl 5, MgCl₂ 1.2, CaCl₂ 1.5, HEPES 10, and glucose 8; pH 7.4; flow rate was 5 mL/min. Ca²⁺ was replaced by 0.4 mmol/L EGTA for Ca²⁺-free solution. All solutions included methoxyverapamil (10 µmol/L). For imaging experiments except those in 100 mmol/L K⁺ solution, preincubation with 1:500 T1E3 was for 8 to 12 hours (4°C). When 100 mmol/L KCl replaced 100 mmol/L NaCl in the superfusion solution, arterioles were preincubated with 1:100 cleaned T1E3 for 2 hours (37°C). Antiserum and peptide were not in recording solutions. Recordings were made alternately from test and control cells. Signals were measured from 5 smooth muscle cells in each arteriole. Data are expressed as mean±SEM, and n is the number of cells. Comparisons were made using unpaired Student’s t test.

View larger version (49K): [in this window] [in a new window]   Figure 2. Targeting of T1E3 antibody to the outer vestibule of TrpC1 channels. Sequence alignment of putative pore regions of trp gene products between 5th and 6th membrane-spanning domains (S5 and S6). Accession numbers are AF061266 (rTrpC1), U73625 (mTrpC1), AF170493 (oTrpC1), U31110 (hTrpC1), AF111107 (mTrpC2), U47050 (hTrpC3), AF170456 (hTrpC4), AF029983 (mTrpC5), AF080394 (hTrpC6), and AF139923 (mTrpC7). r indicates rat; m, mouse; h, human; and o, rabbit.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
We probed for trp1 mRNA expression in a range of blood vessels using reverse transcriptase–polymerase chain reaction (RT-PCR) and found that it was present (Figure 1A). It was also detected in single arteriolar smooth muscle cells harvested by a micro-hooking method (Figures 1A and 1B). TrpC1 protein was detected using a polyclonal antibody (T1E3) targeted to a mammalian TrpC1-specific peptide (Figure 2). The peptide was predicted to be extracellular on the basis of results of transmembrane detection algorithms (not shown) and studies of TrpC3 glycosylation²⁰ and Xenopus laevis trp expression.²¹ Western blotting revealed that T1E3 is specific for protein of the mass predicted for TrpC1 (Figure 1C), which is 92 kDa for -splice variant and 87 kDa for ß-deletion (human TrpC1). Labeling by T1E3 was peptide-specific because it was absent after preadsorption to antigenic peptide (Figure 1C). Small variations in the size of labeled proteins may be explained by varying levels of - and ß-variants,¹³ both of which were detected by RT-PCR (S.-Z.X. and D.J.B., unpublished data, April 2000).

View larger version (51K): [in this window] [in a new window]   Figure 1. TrpC1 expressed in blood vessels. A, mRNA detected by RT-PCR in human LIMA, mouse aorta, and rabbit pial membrane (ß-actin and trp1), arteriolar fragments, and single-cell rings. Predicted sizes of the trp1 and ß-actin PCR products were 423 and 763 bp. Products were not detected if reverse transcriptase was omitted, as shown for rabbit pial (no RT). B, Rabbit arteriolar smooth muscle ring stained with anti–-SMA-Cy3. Scale bar=50 µm. C, Western blots with T1E3 antibody for aorta, LIMA, portal vein (PV), and pial membrane. Labeling was competed off by peptide in human vessels and mouse pial membrane (not shown) and PV (shown).

Membrane-inserted TrpC1 protein was labeled with T1E3 as shown by immunofluorescence staining of permeabilized cells in arterioles (Figure 3A). Staining was most intense at the edge of smooth muscle cells in arterioles (Figure 3A) or in cells cultured from human LIMAs (Figure 3D), suggesting plasma membrane localization. Staining was specific because it was absent if T1E3 was preadsorbed to its antigenic peptide (Figures 3B and 3C). T1E3 antibody should also label unpermeabilized cells if the epitope is extracellular. Smooth muscle cells in enzymatically isolated rabbit pial arterioles were incubated with T1E3 before fixation with paraformaldehyde and without Triton-X permeabilization. Specific staining with T1E3 was detected and was most intense at the cell perimeter (Figure 3E). The absence of permeabilization was confirmed by lack of staining by anti–-SMA-Cy3 (data not shown). Fluorescence was absent from rabbit arterioles incubated with secondary antibody but not T1E3 or T1E3+peptide (data not shown). Immunofluorescence studies were performed on rabbit as well as mouse because we could not satisfactorily isolate cells from mouse. Isolated rabbit arterioles are amenable to Ca²⁺ imaging, and we have evidence for SOCs.¹⁹

View larger version (39K): [in this window] [in a new window]   Figure 3. TrpC1 is expressed in native cells and spans the plasma membrane. A, Permeabilized mouse pial arteriole labeled with T1E3 antibody. The edge of one smooth muscle cell is indicated with an arrow. B, Another mouse arteriole stained with anti–-SMA-Cy3. Scale bar=50 µm and applies to images in panels A through D. C, FITC fluorescence from the same arteriole as in panel B, which had also been incubated with T1E3 preadsorbed to antigenic peptide. D, Permeabilized cultured human LIMA smooth muscle cell double-labeled with T1E3 antibody (green) and anti–-SMA-Cy3 (red). E, Live-cell staining of an enzymatically isolated rabbit arteriole stained with T1E3 antibody. Two smooth muscle cells are in the focal plane, and fluorescence is observed only at the perimeter of each cell. Scale bar=5 µm.

Sequence alignments of TrpCs with Shaker K⁺ channel and related channels suggest that TrpCs are channel subunits. These alignments place the T1E3 epitope in the putative outer vestibule of the channel (Figure 2). Because antibodies targeted to this region of K⁺ channels block K⁺ currents,²² we tested whether T1E3 inhibits Ca²⁺ entry. With block of voltage-gated Ca²⁺ channels and after store depletion caused by thapsigargin, reintroduction of extracellular Ca²⁺ caused a lanthanum-sensitive rise in [Ca²⁺]_i (Figure 4A) that was similar to that described previously.¹⁹ The effect of reintroducing Ca²⁺ was significantly larger after thapsigargin treatment (Figure 4B), suggesting a component of Ca²⁺ influx through SOCs. To test the effect of T1E3 on SOCs, arterioles were incubated with T1E3 at 4°C to allow binding of antibody but minimize de novo protein expression. In thapsigargin-treated (but not untreated) arterioles, the [Ca²⁺]_i signal on reapplication of Ca²⁺ was significantly smaller after incubation with T1E3 compared with incubation with T1E3 preadsorbed to antigenic peptide (Figure 4B). Ba²⁺ is permeant in Ca²⁺ channels but is weakly extruded or sequestered by cells. Thus, application of Ba²⁺ may permit a better measure of ion flux through SOCs. Ba²⁺ influx was measured after thapsigargin treatment and was significantly smaller after incubation in T1E3 without antigenic peptide (Figure 4C). The effect of T1E3 did not result from an effect on membrane potential, because T1E3 also inhibited Ba²⁺ influx when arterioles were studied in solution containing 100 mmol/L K⁺, which strongly depolarizes and clamps the membrane potential (data not shown). In this condition, Ba²⁺-induced F₃₄₀/F₃₈₀ was again significantly smaller in the T1E3 compared with the T1E3+peptide group (0.1728±0.0054, n=50 versus 0.2153±0.0112, n=40, P<0.0005). Antigenic peptide alone had no effect on Ba²⁺ flux: F₃₄₀/F₃₈₀ was 0.219±0.007 in control and 0.211±0.008 in peptide (n=75 for each, P>0.05).

View larger version (20K): [in this window] [in a new window]   Figure 4. TrpC1 is a store-operated Ca2+ channel. A, La3+-sensitive Ca2+ entry in a rabbit arteriolar cell after 1 hour in thapsigargin (1 µmol/L) (store-depleted). B, Stores were depleted, and the Ca2+ signal occurring on reintroduction of 1.5 mmol/L Ca2+ (as in panel A) was smaller with T1E3 compared with T1E3+peptide (n=95 each, *P<0.05). Without store depletion, there was no effect of T1E3 (n=70 each). N-nitro-l-arginine methyl ester (0.3 mmol/L) was included in panels A and B to inhibit basal nitric oxide production. C, As in panel A, stores were depleted. The signal occurred after addition of 10 mmol/L Ba2+ (200 seconds), and data are mean±SEM. (n=55 for each). The signal was smaller with T1E3 compared with T1E3+peptide (**P<0.001 at 800 seconds).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
We show that TrpC1 is a novel type of Ca²⁺ channel in mammalian vascular smooth muscle and that a trp gene encodes a native store-operated channel.

That SERCA inhibition increased the intracellular Ca²⁺ signal on reintroduction of extracellular Ca²⁺ is suggestive of SOC activity,¹⁹ although the effect could be explained by the superficial buffer barrier hypothesis²³ with constant background Ca²⁺ entry. We now show the effect of T1E3 on background Ca²⁺ signal alone and the signal plus that induced by SERCA inhibition. Importantly, T1E3 sensitivity depended on thapsigargin treatment. Thus, TrpC1 is not a background Ca²⁺ channel but a Ca²⁺ channel activated by store depletion.

Three observations demonstrate TrpC1 is a plasma-membrane protein spanning the membrane with an extracellular domain. T1E3 labeling is most intense at the cell perimeter. T1E3 labeled cells that were not permeabilized. Incubation of live cells with T1E3 inhibited Ca²⁺ entry. In the latter 2 cases, T1E3 must have bound an extracellular site. The Ca²⁺/Ba²⁺ measurements additionally suggest that TrpC1 is a pore-forming subunit, because the T1E3 epitope is in the predicted outer vestibule of the channel. Although the blocking effect of T1E3 might seem relatively small, the effect was statistically significant in 3 independent data sets. Furthermore, a large block was not expected. First, only part of the Ca²⁺/Ba²⁺ influx was store-operated. Second, a large antibody molecule is unlikely to be an efficient channel blocker. Third, we incubated with T1E3 for relatively short periods (8 to 12 hours at 4°C or 2 hours at 37°C) to minimize changes to native protein levels or cellular localization. Although T1E3 was washed out before Ca²⁺ measurements, it remained bound, as demonstrated by immunostaining and Western blot.

There is evidence in addition to ours suggesting that TrpC1 is a SOC. It has been shown that human submandibular gland (HSG) cells transfected with HA-tagged trp1 express a plasma-membrane localized protein.²⁴ Also, trp1 transfection enhanced the Ca²⁺-reentry signal in HSG cells treated with thapsigargin, and expression of trp1 cDNA in antisense orientation inhibited basal Ca²⁺-reentry signal in nontransfected HSG cells.²⁴ The Xenopus TrpC, which is similar in amino acid sequence to mammalian TrpC1, is localized to the plasma membrane of oocytes and HeLa cells.²¹ Heterologous expression indicates TrpC1 is a channel subunit or that it can enhance activity of native channels, but it is unclear if the activity is that of a SOC.^{13 14 15 24} TrpC1 seems to be a Ca²⁺-permeable cation channel, but it is not highly Ca²⁺-selective, and, thus, it is unlikely to be a CRAC channel. Intriguingly, SOCs in mouse aortic smooth muscle cells are nonselective cation channels like TrpC1 channels.²⁵

There is evidence that Drosophila TRP and TRP/TRPL heteromultimers can form SOCs²⁶ and that the C-terminus of TRP provides thapsigargin sensitivity.²⁷ Intriguingly, TrpC1 is a smaller protein than Drosophila TRP or TRPL, with a shorter C-terminus. For this reason, it was predicted that TrpC1 is unlikely to be an SOC.²⁸ Our conclusions are at odds with this prediction and raise the question as to how TrpC1 couples to Ca²⁺ stores. We suggest, first, that TrpC1 is one pore-forming subunit in an SOC heteromultimer, another subunit having a longer C-terminus. Second, there is more than one mechanism by which SOCs can couple to Ca²⁺ stores, and the mechanism involving TrpC1 is different from that involving Drosophila TRP. There is evidence for TrpC heteromultimers¹⁵ and multiple coupling mechanisms.^{25 29 30}

We describe an antibody that is a powerful tool for studying TrpC1 effects and demonstrate that trp1 gene encodes a novel channel subunit, contributing to store-operated Ca²⁺ channels in native arterial smooth muscle cells. TrpC1 is a potential target for novel drugs to alleviate hypertension or vasospasm or inhibit smooth muscle proliferation in arteriosclerosis and neointimal hyperplasia.

	Acknowledgments

 
This work was supported by an Overseas Research Student’s award and a Tetley & Lupton scholarship (to S.-Z.X.). We thank the Wellcome Trust, British Heart Foundation, and National Heart Research Fund for support and T.J.P. Batchelor for human LIMA samples and cultured LIMA cells.

	Footnotes

 
Original received August 4, 2000; revision received November 8, 2000; accepted November 10, 2000.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Parekh AB, Penner R. Store depletion and calcium influx. Physiol Rev. 1997;77:901–930.

2. Lewis RS. Store-operated calcium channels. Adv Second Messenger Phosphoprotein Res. 1999;33:279–307.

3. Putney JW, McKay RR. Capacitative calcium entry channels. Bioessays. 1999;21:38–46.

4. Gibson A, McFadzean I, Wallace P, Wayman CP. Capacitative Ca²⁺ entry and the regulation of smooth muscle tone. Trends Pharmacol Sci. 1998;19:267–269.

5. Golovina VA. Cell proliferation is associated with enhanced capacitative Ca²⁺ entry in human arterial myocytes. Am J Physiol. 1999;277:C343–C349.

6. Lepple-Wienhues A, Belka C, Laun T, Jekle A, Walter B, Wieland U, Welz M, Heil L, Kun J, Busch G, Weller M, Bamberg M, Gulbins E, Lang F. Stimulation of CD95 (Fas) blocks T lymphocyte calcium channels through sphingomyelinase and sphingolipids. Proc Natl Acad Sci U S A. 1999;96:13795–13800.

7. Jayadev S, Petranka JG, Cheran SK, Biermann JA, Barrett JC, Murphy E. Reduced capacitative calcium entry correlates with vesicle accumulation and apoptosis. J Biol Chem. 1999;274:8261–8268.

8. Birnbaumer L, Zhu X, Jiang M, Boulay G, Peyton M, Vannier B, Brown D, Platano D, Sadeghi H, Stefani E, Birnbaumer M. On the molecular basis and regulation of cellular capacitative calcium entry: roles for Trp proteins. Proc Natl Acad Sci U S A. 1996;93:15195–15202.

9. Harteneck C, Plant TD, Schultz G. From worm to man: three subfamilies of TRP channels. Trends Neurosci. 2000;23:159–166.

10. Ma HT, Patterson RL, van Rossum DB, Birnbaumer L, Mikoshiba K, Gill DL. Requirement of the inositol trisphosphate receptor for activation of store-operated Ca²⁺ channels. Science. 2000;287:1647–1651.

11. Philipp S, Trost C, Warnat J, Rautmann J, Himmerkus N, Schroth G, Kretz O, Nastainczyk W, Cavalie A, Hoth M, Flockerzi V. TRP4(CCE1) is part of native CRAC-like channels in adrenal cells. J Biol Chem. 2000;275:23965–23972.

12. Schaefer M, Plant TD, Obukhov AG, Hofmann T, Gudermann T, Schultz G. Receptor-mediated regulation of the nonselective cation channels TRPC4 and TRPC5. J Biol Chem. 2000;275:17517–17526.

13. Zitt C, Zobel A, Obukhov AG, Harteneck C, Kalkbrenner F, Lückhoff A, Schultz G. Cloning and functional expression of a human Ca²⁺-permeable cation channel activated by calcium store depletion. Neuron. 1996;16:1189–1196.

14. Sinkins WG, Estacion M, Schilling WP. Functional expression of TrpC1: a human homologue of the Drosophila Trp channel. Biochem J. 1998;331:331–339.

15. Lintschinger B, Balzer-Geldsetzer M, Baskaran T, Graier WF, Romanin C, Zhu MX, Groschner K. Coassembly of Trp1 and Trp3 channels generates diacylglycerol and Ca²⁺-sensitive cation channels. J Biol Chem. 2000;275:27799–27805.

16. Putney JW. TRP, inositol 1,4,5-trisphosphate receptors, and capacitative calcium entry. Proc Natl Acad Sci U S A. 1999;96:14669–14671.

17. Berridge MJ, Lipp P, Bootman MD. Signal transduction: the calcium entry pas de deux. Science. 2000;287:1604–1605.

18. Quinn K, Beech DJ. A method for direct patch-clamp recording from smooth muscle cells embedded in functional brain microvessels. Pflügers Arch. 1998;435:564–569.

19. Guibert C, Beech DJ. Positive and negative coupling of the endothelin ET_A receptor to Ca²⁺-permeable channels in rabbit cerebral cortex arterioles. J Physiol. 1999;514:843–856.

20. Vannier B, Zhu X, Brown D, Birnbaumer L. The membrane topology of human transient receptor potential 3 as inferred from glycosylation-scanning mutagenesis and epitope immunocytochemistry. J Biol Chem. 1998;273:8675–8679.

21. Bobanovi LK, Laine M, Petersen CCH, Bennett DL, Berridge MJ, Lipp P, Ripley SJ, Bootman MD. Molecular cloning and immunolocalization of a novel vertebrate trp homologue from Xenopus. Biochem J. 1999;340:593–599.

22. Zhou BY, Ma W, Huang XY. Specific antibodies to the external vestibule of voltage-gated potassium channels block current. J Gen Physiol. 1998;111:555–563.

23. van Breemen C, Chen Q, Laher I. Superficial buffer barrier function of smooth muscle sarcoplasmic reticulum. Trends Pharmacol Sci. 1995;16:98–105.

24. Liu X, Wang W, Singh BB, Lockwith T, Jadlowiec J, O’Connell B, Wellner R, Zhu MX, Ambudkar IS. Trp1, a candidate protein for the store-operated Ca²⁺ influx mechanism in salivary gland cells. J Biol Chem. 2000;275:3403–3411.

25. Trepakova ES, Csutora P, Hunton DL, Marchase RB, Cohen RA, Bolotina VM. Calcium influx factor (CIF) directly activates store-operated cation channels in vascular smooth muscle cells. J Biol Chem. 2000;275:26158–26163.

26. Xu XZS, Li HS, Guggino WB, Montell C. Coassembly of TRP and TRPL produces a distinct store-operated conductance. Cell. 1997;89:1155–1164.

27. Sinkins WG, Vaca L, Hu Y, Kunze DL, Schilling WP. The COOH-terminal domain of Drosophila TRP channels confers thapsigargin sensitivity. J Biol Chem. 1996;271:2955–2960.

28. Montell C. New light on TRP and TRPL. Mol Pharmacol. 1997;52:755–763.

29. Rzigalinski BA, Willoughby KA, Hoffman SW, Falck JR, Ellis EF. Calcium influx factor, further evidence it is 5, 6-epoxyeicosatrienoic acid. J Biol Chem. 1999;274:175–182.

30. Yao Y, Ferrer-Montiel AV, Montal M, Tsien RY. Activation of store-operated Ca²⁺ current in Xenopus oocytes requires SNAP-25 but not a diffusible messenger. Cell. 1999;98:475–485.>

This article has been cited by other articles:

				S. G. Baryshnikov, M. V. Pulina, A. Zulian, C. I. Linde, and V. A. Golovina Orai1, a critical component of store-operated Ca2+ entry, is functionally associated with Na+/Ca2+ exchanger and plasma membrane Ca2+ pump in proliferating human arterial myocytes Am J Physiol Cell Physiol, November 1, 2009; 297(5): C1103 - C1112. [Abstract] [Full Text] [PDF]

				S. E. Atkinson and S. R. Williams Postnatal Development of Dendritic Synaptic Integration in Rat Neocortical Pyramidal Neurons J Neurophysiol, August 1, 2009; 102(2): 735 - 751. [Abstract] [Full Text] [PDF]

				M. Potier, J. C. Gonzalez, R. K. Motiani, I. F. Abdullaev, J. M. Bisaillon, H. A. Singer, and M. Trebak Evidence for STIM1- and Orai1-dependent store-operated calcium influx through ICRAC in vascular smooth muscle cells: role in proliferation and migration FASEB J, August 1, 2009; 23(8): 2425 - 2437. [Abstract] [Full Text] [PDF]

				L. C. Ng, M. D. McCormack, J. A. Airey, C. A. Singer, P. S. Keller, X.-M. Shen, and J. R. Hume TRPC1 and STIM1 mediate capacitative Ca2+ entry in mouse pulmonary arterial smooth muscle cells J. Physiol., June 1, 2009; 587(11): 2429 - 2442. [Abstract] [Full Text] [PDF]

				H.-Y. Kwan, B. Shen, X. Ma, Y.-C. Kwok, Y. Huang, Y.-B. Man, S. Yu, and X. Yao TRPC1 Associates With BKCa Channel to Form a Signal Complex in Vascular Smooth Muscle Cells Circ. Res., March 13, 2009; 104(5): 670 - 678. [Abstract] [Full Text] [PDF]

				R.-W. Guo, H. Wang, P. Gao, M.-Q. Li, C.-Y. Zeng, Y. Yu, J.-F. Chen, M.-B. Song, Y.-K. Shi, and L. Huang An essential role for stromal interaction molecule 1 in neointima formation following arterial injury Cardiovasc Res, March 1, 2009; 81(4): 660 - 668. [Abstract] [Full Text] [PDF]

				J. Li, P. Sukumar, C. J. Milligan, B. Kumar, Z.-Y. Ma, C. M. Munsch, L.-H. Jiang, K. E. Porter, and D. J. Beech Interactions, Functions, and Independence of Plasma Membrane STIM1 and TRPC1 in Vascular Smooth Muscle Cells Circ. Res., October 10, 2008; 103(8): e97 - e104. [Abstract] [Full Text] [PDF]

				I. Jardin, J. J. Lopez, G. M. Salido, and J. A. Rosado Orai1 Mediates the Interaction between STIM1 and hTRPC1 and Regulates the Mode of Activation of hTRPC1-forming Ca2+ Channels J. Biol. Chem., September 12, 2008; 283(37): 25296 - 25304. [Abstract] [Full Text] [PDF]

				R. Berra-Romani, A. Mazzocco-Spezzia, M. V. Pulina, and V. A. Golovina Ca2+ handling is altered when arterial myocytes progress from a contractile to a proliferative phenotype in culture Am J Physiol Cell Physiol, September 1, 2008; 295(3): C779 - C790. [Abstract] [Full Text] [PDF]

				I. N. Bratz, G. M. Dick, J. D. Tune, J. M. Edwards, Z. P. Neeb, U. D. Dincer, and M. Sturek Impaired capsaicin-induced relaxation of coronary arteries in a porcine model of the metabolic syndrome Am J Physiol Heart Circ Physiol, June 1, 2008; 294(6): H2489 - H2496. [Abstract] [Full Text] [PDF]

				S. N. Saleh, A. P. Albert, C. M. Peppiatt-Wildman, and W. A. Large Diverse properties of store-operated TRPC channels activated by protein kinase C in vascular myocytes J. Physiol., May 15, 2008; 586(10): 2463 - 2476. [Abstract] [Full Text] [PDF]

				X. Liu, K. T. Cheng, B. C. Bandyopadhyay, B. Pani, A. Dietrich, B. C. Paria, W. D. Swaim, D. Beech, E. Yildrim, B. B. Singh, et al. Attenuation of store-operated Ca2+ current impairs salivary gland fluid secretion in TRPC1( / ) mice PNAS, October 30, 2007; 104(44): 17542 - 17547. [Abstract] [Full Text] [PDF]

				A. P. Albert, S. N. Saleh, C. M. Peppiatt-Wildman, and W. A. Large Multiple activation mechanisms of store-operated TRPC channels in smooth muscle cells J. Physiol., August 15, 2007; 583(1): 25 - 36. [Abstract] [Full Text] [PDF]

				J. Du, S. Sours-Brothers, R. Coleman, M. Ding, S. Graham, D.-H. Kong, and R. Ma Canonical Transient Receptor Potential 1 Channel Is Involved in Contractile Function of Glomerular Mesangial Cells J. Am. Soc. Nephrol., May 1, 2007; 18(5): 1437 - 1445. [Abstract] [Full Text] [PDF]

				M. Tosun, Y. Erac, C. Selli, and N. Karakaya Sarcoplasmic-endoplasmic reticulum Ca2+-ATPase inhibition prevents endothelin A receptor antagonism in rat aorta Am J Physiol Heart Circ Physiol, April 1, 2007; 292(4): H1961 - H1966. [Abstract] [Full Text] [PDF]

				H. L. Ong, K. T. Cheng, X. Liu, B. C. Bandyopadhyay, B. C. Paria, J. Soboloff, B. Pani, Y. Gwack, S. Srikanth, B. B. Singh, et al. Dynamic Assembly of TRPC1-STIM1-Orai1 Ternary Complex Is Involved in Store-operated Calcium Influx: EVIDENCE FOR SIMILARITIES IN STORE-OPERATED AND CALCIUM RELEASE-ACTIVATED CALCIUM CHANNEL COMPONENTS J. Biol. Chem., March 23, 2007; 282(12): 9105 - 9116. [Abstract] [Full Text] [PDF]

				A. Dalrymple, K. Mahn, L. Poston, E. Songu-Mize, and R.M. Tribe Mechanical stretch regulates TRPC expression and calcium entry in human myometrial smooth muscle cells Mol. Hum. Reprod., March 1, 2007; 13(3): 171 - 179*. [Abstract] [Full Text] [PDF]

				S. Morales, A. Diez, A. Puyet, P. J. Camello, C. Camello-Almaraz, J. M. Bautista, and M. J. Pozo Calcium controls smooth muscle TRPC gene transcription via the CaMK/calcineurin-dependent pathways Am J Physiol Cell Physiol, January 1, 2007; 292(1): C553 - C563. [Abstract] [Full Text] [PDF]

				S. N. Saleh, A. P. Albert, C. M. Peppiatt, and W. A. Large Angiotensin II activates two cation conductances with distinct TRPC1 and TRPC6 channel properties in rabbit mesenteric artery myocytes J. Physiol., December 1, 2006; 577(2): 479 - 495. [Abstract] [Full Text] [PDF]

				S.-Z. Xu, G. Boulay, R. Flemming, and D. J. Beech E3-targeted anti-TRPC5 antibody inhibits store-operated calcium entry in freshly isolated pial arterioles Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2653 - H2659. [Abstract] [Full Text] [PDF]

				W. F. Jackson Vascular smooth muscle store-operated Ca2+ channels: what a TRP! Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2592 - H2594. [Full Text] [PDF]

				D. L. Tharp, B. R. Wamhoff, J. R. Turk, and D. K. Bowles Upregulation of intermediate-conductance Ca2+-activated K+ channel (IKCa1) mediates phenotypic modulation of coronary smooth muscle Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2493 - H2503. [Abstract] [Full Text] [PDF]

				M. A. Spassova, T. Hewavitharana, W. Xu, J. Soboloff, and D. L. Gill A common mechanism underlies stretch activation and receptor activation of TRPC6 channels PNAS, October 31, 2006; 103(44): 16586 - 16591. [Abstract] [Full Text] [PDF]

				C. V. Remillard and J. X.-J. Yuan Transient Receptor Potential Channels and Caveolin-1: Good Friends in Tight Spaces Mol. Pharmacol., October 1, 2006; 70(4): 1151 - 1154. [Abstract] [Full Text] [PDF]

				Z. Hong, F. Hong, A. Olschewski, J. A. Cabrera, A. Varghese, D. P. Nelson, and E. K. Weir Role of Store-Operated Calcium Channels and Calcium Sensitization in Normoxic Contraction of the Ductus Arteriosus Circulation, September 26, 2006; 114(13): 1372 - 1379. [Abstract] [Full Text] [PDF]

				JoseJ. Lopez, G. M. Salido, J. A. Pariente, and J. A. Rosado Interaction of STIM1 with Endogenously Expressed Human Canonical TRP1 upon Depletion of Intracellular Ca2+ Stores J. Biol. Chem., September 22, 2006; 281(38): 28254 - 28264. [Abstract] [Full Text] [PDF]

				M. Kuisle, N. Wanaverbecq, A. L. Brewster, S. G. A. Frere, D. Pinault, T. Z. Baram, and A. Luthi Functional stabilization of weakened thalamic pacemaker channel regulation in rat absence epilepsy J. Physiol., August 15, 2006; 575(1): 83 - 100. [Abstract] [Full Text] [PDF]

				R. Inoue, L. J. Jensen, J. Shi, H. Morita, M. Nishida, A. Honda, and Y. Ito Transient Receptor Potential Channels in Cardiovascular Function and Disease Circ. Res., July 21, 2006; 99(2): 119 - 131. [Abstract] [Full Text] [PDF]

				S. Earley Molecular Diversity of Receptor Operated Channels in Vascular Smooth Muscle: A Role for Heteromultimeric TRP Channels? Circ. Res., June 23, 2006; 98(12): 1462 - 1464. [Full Text] [PDF]

				Y. Maruyama, Y. Nakanishi, E. J. Walsh, D. P. Wilson, D. G. Welsh, and W. C. Cole Heteromultimeric TRPC6-TRPC7 Channels Contribute to Arginine Vasopressin-Induced Cation Current of A7r5 Vascular Smooth Muscle Cells Circ. Res., June 23, 2006; 98(12): 1520 - 1527. [Abstract] [Full Text] [PDF]

				S.-Z. Xu, K. Muraki, F. Zeng, J. Li, P. Sukumar, S. Shah, A. M. Dedman, P. K. Flemming, D. McHugh, J. Naylor, et al. A Sphingosine-1-Phosphate-Activated Calcium Channel Controlling Vascular Smooth Muscle Cell Motility Circ. Res., June 9, 2006; 98(11): 1381 - 1389. [Abstract] [Full Text] [PDF]

				X.-R. Yang, M.-J. Lin, L. S. McIntosh, and J. S. K. Sham Functional expression of transient receptor potential melastatin- and vanilloid-related channels in pulmonary arterial and aortic smooth muscle Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1267 - L1276. [Abstract] [Full Text] [PDF]

				L. I. Brueggemann, D. R. Markun, K. K. Henderson, L. L. Cribbs, and K. L. Byron Pharmacological and Electrophysiological Characterization of Store-Operated Currents and Capacitative Ca2+ Entry in Vascular Smooth Muscle Cells J. Pharmacol. Exp. Ther., May 1, 2006; 317(2): 488 - 499. [Abstract] [Full Text] [PDF]

				J. N. Rao, O. Platoshyn, V. A. Golovina, L. Liu, T. Zou, B. S. Marasa, D. J. Turner, J. X.-J. Yuan, and J.-Y. Wang TRPC1 functions as a store-operated Ca2+ channel in intestinal epithelial cells and regulates early mucosal restitution after wounding Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G782 - G792. [Abstract] [Full Text] [PDF]

				B. Kumar, K. Dreja, S.S. Shah, A. Cheong, S.-Z. Xu, P. Sukumar, J. Naylor, A. Forte, M. Cipollaro, D. McHugh, et al. Upregulated TRPC1 Channel in Vascular Injury In Vivo and Its Role in Human Neointimal Hyperplasia Circ. Res., March 3, 2006; 98(4): 557 - 563. [Abstract] [Full Text] [PDF]

				N. L. Jernigan, B. R. S. Broughton, B. R. Walker, and T. C. Resta Impaired NO-dependent inhibition of store- and receptor-operated calcium entry in pulmonary vascular smooth muscle after chronic hypoxia Am J Physiol Lung Cell Mol Physiol, March 1, 2006; 290(3): L517 - L525. [Abstract] [Full Text] [PDF]

				A. P. Albert, V. Pucovsky, S. A. Prestwich, and W. A. Large TRPC3 properties of a native constitutively active Ca2+-permeable cation channel in rabbit ear artery myocytes J. Physiol., March 1, 2006; 571(2): 361 - 369. [Abstract] [Full Text] [PDF]

				R. Ma, J. Du, S. Sours, and M. Ding Store-Operated Ca2+ Channel in Renal Microcirculation and Glomeruli Experimental Biology and Medicine, February 1, 2006; 231(2): 145 - 153. [Abstract] [Full Text] [PDF]

				N. Ben-Amor, P. C. Redondo, A. Bartegi, J. A. Pariente, G. M. Salido, and J. A. Rosado A role for 5,6-epoxyeicosatrienoic acid in calcium entry by de novo conformational coupling in human platelets J. Physiol., January 15, 2006; 570(2): 309 - 323. [Abstract] [Full Text] [PDF]

				G. K. Rao and N. E. Kaminski Induction of intracellular calcium elevation by {Delta}9-tetrahydrocannabinol in T cells involves TRPC1 channels J. Leukoc. Biol., January 1, 2006; 79(1): 202 - 213. [Abstract] [Full Text] [PDF]

				A. P. Albert and W. A. Large Signal transduction pathways and gating mechanisms of native TRP-like cation channels in vascular myocytes J. Physiol., January 1, 2006; 570(1): 45 - 51. [Abstract] [Full Text] [PDF]

				T. K. Zagranichnaya, X. Wu, and M. L. Villereal Endogenous TRPC1, TRPC3, and TRPC7 Proteins Combine to Form Native Store-operated Channels in HEK-293 Cells J. Biol. Chem., August 19, 2005; 280(33): 29559 - 29569. [Abstract] [Full Text] [PDF]

				S. Bendahhou, C. Marionneau, K. Haurogne, M.-M. Larroque, R. Derand, V. Szuts, D. Escande, S. Demolombe, and J. Barhanin In vitro molecular interactions and distribution of KCNE family with KCNQ1 in the human heart Cardiovasc Res, August 15, 2005; 67(3): 529 - 538. [Abstract] [Full Text] [PDF]

				C. S. Facemire and W. J. Arendshorst Calmodulin mediates norepinephrine-induced receptor-operated calcium entry in preglomerular resistance arteries Am J Physiol Renal Physiol, July 1, 2005; 289(1): F127 - F136. [Abstract] [Full Text] [PDF]

				V. A. Golovina Visualization of localized store-operated calcium entry in mouse astrocytes. Close proximity to the endoplasmic reticulum J. Physiol., May 1, 2005; 564(3): 737 - 749. [Abstract] [Full Text] [PDF]

				D. Mehta, M. Konstantoulaki, G. U. Ahmmed, and A. B. Malik Sphingosine 1-Phosphate-induced Mobilization of Intracellular Ca2+ Mediates Rac Activation and Adherens Junction Assembly in Endothelial Cells J. Biol. Chem., April 29, 2005; 280(17): 17320 - 17328. [Abstract] [Full Text] [PDF]

				A. Bergdahl, M. F. Gomez, A.-K. Wihlborg, D. Erlinge, A. Eyjolfson, S.-Z. Xu, D. J. Beech, K. Dreja, and P. Hellstrand Plasticity of TRPC expression in arterial smooth muscle: correlation with store-operated Ca2+ entry Am J Physiol Cell Physiol, April 1, 2005; 288(4): C872 - C880. [Abstract] [Full Text] [PDF]

				S. Zhang, J. X.-J. Yuan, K. E. Barrett, and H. Dong Role of Na+/Ca2+ exchange in regulating cytosolic Ca2+ in cultured human pulmonary artery smooth muscle cells Am J Physiol Cell Physiol, February 1, 2005; 288(2): C245 - C252. [Abstract] [Full Text] [PDF]

				M Liu, W. Large, and A. Albert Stimulation of {beta}-adrenoceptors inhibits store-operated channel currents via a cAMP-dependent protein kinase mechanism in rabbit portal vein myocytes J. Physiol., January 15, 2005; 562(2): 395 - 406. [Abstract] [Full Text] [PDF]

				N. Kunichika, Y. Yu, C. V. Remillard, O. Platoshyn, S. Zhang, and J. X.-J. Yuan Overexpression of TRPC1 enhances pulmonary vasoconstriction induced by capacitative Ca2+ entry Am J Physiol Lung Cell Mol Physiol, November 1, 2004; 287(5): L962 - L969. [Abstract] [Full Text] [PDF]

				S. Zhang, C. V. Remillard, I. Fantozzi, and J. X.-J. Yuan ATP-induced mitogenesis is mediated by cyclic AMP response element-binding protein-enhanced TRPC4 expression and activity in human pulmonary artery smooth muscle cells Am J Physiol Cell Physiol, November 1, 2004; 287(5): C1192 - C1201. [Abstract] [Full Text] [PDF]

				Y. Yu, I. Fantozzi, C. V. Remillard, J. W. Landsberg, N. Kunichika, O. Platoshyn, D. D. Tigno, P. A. Thistlethwaite, L. J. Rubin, and J. X.-J. Yuan Enhanced expression of transient receptor potential channels in idiopathic pulmonary arterial hypertension PNAS, September 21, 2004; 101(38): 13861 - 13866. [Abstract] [Full Text] [PDF]

				D. J. Beech, K. Muraki, and R. Flemming Non-selective cationic channels of smooth muscle and the mammalian homologues of Drosophila TRP J. Physiol., September 15, 2004; 559(3): 685 - 706. [Abstract] [Full Text] [PDF]

				M.-J. Lin, G. P.H. Leung, W.-M. Zhang, X.-R. Yang, K.-P. Yip, C.-M. Tse, and J. S.K. Sham Chronic Hypoxia-Induced Upregulation of Store-Operated and Receptor-Operated Ca2+ Channels in Pulmonary Arterial Smooth Muscle Cells: A Novel Mechanism of Hypoxic Pulmonary Hypertension Circ. Res., September 3, 2004; 95(5): 496 - 505. [Abstract] [Full Text] [PDF]

				X. Wang, J. L. Pluznick, P. Wei, B. J. Padanilam, and S. C. Sansom TRPC4 forms store-operated Ca2+ channels in mouse mesangial cells Am J Physiol Cell Physiol, August 1, 2004; 287(2): C357 - C364. [Abstract] [Full Text] [PDF]

				V. M. Bolotina Store-Operated Channels: Diversity and Activation Mechanisms Sci. Signal., July 27, 2004; 2004(243): pe34 - pe34. [Abstract] [Full Text] [PDF]

				P. C. Redondo, A. G. S. Harper, G. M. Salido, J. A. Pariente, S. O. Sage, and J. A. Rosado A role for SNAP-25 but not VAMPs in store-mediated Ca2+ entry in human platelets J. Physiol., July 1, 2004; 558(1): 99 - 109. [Abstract] [Full Text] [PDF]

				G. U. Ahmmed, D. Mehta, S. Vogel, M. Holinstat, B. C. Paria, C. Tiruppathi, and A. B. Malik Protein Kinase C{alpha} Phosphorylates the TRPC1 Channel and Regulates Store-operated Ca2+ Entry in Endothelial Cells J. Biol. Chem., May 14, 2004; 279(20): 20941 - 20949. [Abstract] [Full Text] [PDF]

				B. Ay, Y. S. Prakash, C. M. Pabelick, and G. C. Sieck Store-operated Ca2+ entry in porcine airway smooth muscle Am J Physiol Lung Cell Mol Physiol, May 1, 2004; 286(5): L909 - L917. [Abstract] [Full Text] [PDF]

				J. Wang, L. A. Shimoda, and J. T. Sylvester Capacitative calcium entry and TRPC channel proteins are expressed in rat distal pulmonary arterial smooth muscle Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L848 - L858. [Abstract] [Full Text] [PDF]

				A. Dalrymple, D. M. Slater, L. Poston, and R. M. Tribe Physiological Induction of Transient Receptor Potential Canonical Proteins, Calcium Entry Channels, in Human Myometrium: Influence of Pregnancy, Labor, and Interleukin-1{beta} J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1291 - 1300. [Abstract] [Full Text] [PDF]

				C. S. Facemire, P. J. Mohler, and W. J. Arendshorst Expression and relative abundance of short transient receptor potential channels in the rat renal microcirculation Am J Physiol Renal Physiol, March 1, 2004; 286(3): F546 - F551. [Abstract] [Full Text]

				J. R. Ehrlich, M. Pourrier, M. Weerapura, N. Ethier, A. M. Marmabachi, T. E. Hebert, and S. Nattel KvLQT1 Modulates the Distribution and Biophysical Properties of HERG: A NOVEL {alpha}-SUBUNIT INTERACTION BETWEEN DELAYED RECTIFIER CURRENTS J. Biol. Chem., January 9, 2004; 279(2): 1233 - 1241. [Abstract] [Full Text] [PDF]

				I. Fantozzi, S. Zhang, O. Platoshyn, C. V. Remillard, R. T. Cowling, and J. X.-J. Yuan Hypoxia increases AP-1 binding activity by enhancing capacitative Ca2+ entry in human pulmonary artery endothelial cells Am J Physiol Lung Cell Mol Physiol, December 1, 2003; 285(6): L1233 - L1245. [Abstract] [Full Text] [PDF]

				K. Muraki, Y. Iwata, Y. Katanosaka, T. Ito, S. Ohya, M. Shigekawa, and Y. Imaizumi TRPV2 Is a Component of Osmotically Sensitive Cation Channels in Murine Aortic Myocytes Circ. Res., October 31, 2003; 93(9): 829 - 838. [Abstract] [Full Text] [PDF]

				A. Bergdahl, M. F. Gomez, K. Dreja, S.-Z. Xu, M. Adner, D. J. Beech, J. Broman, P. Hellstrand, and K. Sward Cholesterol Depletion Impairs Vascular Reactivity to Endothelin-1 by Reducing Store-Operated Ca2+ Entry Dependent on TRPC1 Circ. Res., October 31, 2003; 93(9): 839 - 847. [Abstract] [Full Text] [PDF]

				Q. Qian, L. W. Hunter, M. Li, M. Marin-Padilla, Y.S. Prakash, S. Somlo, P. C. Harris, V. E. Torres, and G. C. Sieck Pkd2 haploinsufficiency alters intracellular calcium regulation in vascular smooth muscle cells Hum. Mol. Genet., August 1, 2003; 12(15): 1875 - 1880. [Abstract] [Full Text] [PDF]

				S.-c. W. Brazer, B. B. Singh, X. Liu, W. Swaim, and I. S. Ambudkar Caveolin-1 Contributes to Assembly of Store-operated Ca2+ Influx Channels by Regulating Plasma Membrane Localization of TRPC1 J. Biol. Chem., July 11, 2003; 278(29): 27208 - 27215. [Abstract] [Full Text] [PDF]

				M. Poteser, I. Wakabayashi, C. Rosker, M. Teubl, R. Schindl, N. M. Soldatov, C. Romanin, and K. Groschner Crosstalk Between Voltage-Independent Ca2+ Channels and L-Type Ca2+ Channels in A7r5 Vascular Smooth Muscle Cells at Elevated Intracellular pH: Evidence for Functional Coupling Between L-Type Ca2+ Channels and a 2-APB-Sensitive Cation Channel Circ. Res., May 2, 2003; 92(8): 888 - 896. [Abstract] [Full Text] [PDF]

				X. Liu, B. B. Singh, and I. S. Ambudkar TRPC1 Is Required for Functional Store-operated Ca2+ Channels. ROLE OF ACIDIC AMINO ACID RESIDUES IN THE S5-S6 REGION J. Biol. Chem., March 21, 2003; 278(13): 11337 - 11343. [Abstract] [Full Text] [PDF]

				Y. Yu, M. Sweeney, S. Zhang, O. Platoshyn, J. Landsberg, A. Rothman, and J. X.-J. Yuan PDGF stimulates pulmonary vascular smooth muscle cell proliferation by upregulating TRPC6 expression Am J Physiol Cell Physiol, February 1, 2003; 284(2): C316 - C330. [Abstract] [Full Text] [PDF]

				S. O. Sage, S. L. Brownlow, J. A. Rosado, K. S. Authi, S. Hassock, M. X. Zhu, V. Flockerzi, and C. Trost TRP channels and calcium entry in human platelets Blood, December 1, 2002; 100(12): 4245 - 4246. [Full Text] [PDF]

				J. A. Rosado, S. L. Brownlow, and S. O. Sage Endogenously Expressed Trp1 Is Involved in Store-mediated Ca2+ Entry by Conformational Coupling in Human Platelets J. Biol. Chem., October 25, 2002; 277(44): 42157 - 42163. [Abstract] [Full Text] [PDF]

				A. Dalrymple, D.M. Slater, D. Beech, L. Poston, and R.M. Tribe Molecular identification and localization of Trp homologues, putative calcium channels, in pregnant human uterus Mol. Hum. Reprod., October 1, 2002; 8(10): 946 - 951. [Abstract] [Full Text] [PDF]

				D. J Beech SOCs - Store-Operated Channels in Vascular Smooth Muscle? J. Physiol., October 1, 2002; 544(1): 1 - 1. [Full Text] [PDF]

				S. Y Cheranov and J. H Jaggar Sarcoplasmic reticulum calcium load regulates rat arterial smooth muscle calcium sparks and transient KCa currents J. Physiol., October 1, 2002; 544(1): 71 - 84. [Abstract] [Full Text] [PDF]

				S. R. Hassock, M. X. Zhu, C. Trost, V. Flockerzi, and K. S. Authi Expression and role of TRPC proteins in human platelets: evidence that TRPC6 forms the store-independent calcium entry channel Blood, September 26, 2002; 100(8): 2801 - 2811. [Abstract] [Full Text] [PDF]

				R Flemming, A Cheong, A M Dedman, and D J Beech Discrete store-operated calcium influx into an intracellular compartment in rabbit arteriolar smooth muscle J. Physiol., September 1, 2002; 543(2): 455 - 464. [Abstract] [Full Text] [PDF]

				M. Sweeney, Y. Yu, O. Platoshyn, S. Zhang, S. S. McDaniel, and J. X.-J. Yuan Inhibition of endogenous TRP1 decreases capacitative Ca2+ entry and attenuates pulmonary artery smooth muscle cell proliferation Am J Physiol Lung Cell Mol Physiol, July 1, 2002; 283(1): L144 - L155. [Abstract] [Full Text] [PDF]

				C.-H. Lee, D. Poburko, K.-H. Kuo, C. Y. Seow, and C. van Breemen Ca2+ oscillations, gradients, and homeostasis in vascular smooth muscle Am J Physiol Heart Circ Physiol, May 1, 2002; 282(5): H1571 - H1583. [Abstract] [Full Text] [PDF]

				B. Minke and B. Cook TRP Channel Proteins and Signal Transduction Physiol Rev, April 1, 2002; 82(2): 429 - 472. [Abstract] [Full Text] [PDF]

				D. G. Welsh, A. D. Morielli, M. T. Nelson, and J. E. Brayden Transient Receptor Potential Channels Regulate Myogenic Tone of Resistance Arteries Circ. Res., February 22, 2002; 90(3): 248 - 250. [Abstract] [Full Text] [PDF]

				K. Muraki and Y. Imaizumi A novel function of sphingosine-1-phosphate to activate a non-selective cation channel in human endothelial cells J. Physiol., December 1, 2001; 537(2): 431 - 441. [Abstract] [Full Text] [PDF]

				J. M. Nerbonne, C. G. Nichols, T. L. Schwarz, and D. Escande Genetic Manipulation of Cardiac K+ Channel Function in Mice: What Have We Learned, and Where Do We Go From Here? Circ. Res., November 23, 2001; 89(11): 944 - 956. [Abstract] [Full Text] [PDF]

				K. M. Sanders Signal Transduction in Smooth Muscle: Invited Review: Mechanisms of calcium handling in smooth muscles J Appl Physiol, September 1, 2001; 91(3): 1438 - 1449. [Abstract] [Full Text] [PDF]

				M. A. Hill, H. Zou, S. J. Potocnik, G. A. Meininger, and M. J. Davis Signal Transduction in Smooth Muscle: Invited Review: Arteriolar smooth muscle mechanotransduction: Ca2+ signaling pathways underlying myogenic reactivity J Appl Physiol, August 1, 2001; 91(2): 973 - 983. [Abstract] [Full Text] [PDF]

				J. Qu, A. Barbuti, L. Protas, B. Santoro, I. S. Cohen, and R. B. Robinson HCN2 Overexpression in Newborn and Adult Ventricular Myocytes : Distinct Effects on Gating and Excitability Circ. Res., July 6, 2001; 89 (1): e8 - e14. [Abstract] [Full Text] [PDF]

				W. P. Schilling TRP Proteins : Novel Therapeutic Targets for Regional Blood Pressure Control? Circ. Res., February 16, 2001; 88(3): 256 - 259. [Full Text] [PDF]

				V. Denis and M. S. Cyert Internal Ca2+ release in yeast is triggered by hypertonic shock and mediated by a TRP channel homologue J. Cell Biol., January 7, 2002; 156(1): 29 - 34. [Abstract] [Full Text] [PDF]

				S. Jung, R. Strotmann, G. Schultz, and T. D. Plant TRPC6 is a candidate channel involved in receptor-stimulated cation currents in A7r5 smooth muscle cells Am J Physiol Cell Physiol, February 1, 2002; 282(2): C347 - C359. [Abstract] [Full Text] [PDF]

				I. A. Greenwood and S. A. Prestwich Characteristics of hyperpolarization-activated cation currents in portal vein smooth muscle cells Am J Physiol Cell Physiol, April 1, 2002; 282(4): C744 - C753. [Abstract] [Full Text] [PDF]

				C.-H. Lee, R. Rahimian, T. Szado, J. Sandhu, D. Poburko, T. Behra, L. Chan, and C. van Breemen Sequential opening of IP3-sensitive Ca2+ channels and SOC during alpha -adrenergic activation of rabbit vena cava Am J Physiol Heart Circ Physiol, May 1, 2002; 282(5): H1768 - H1777. [Abstract] [Full Text] [PDF]

				D. G. Welsh, A. D. Morielli, M. T. Nelson, and J. E. Brayden Transient Receptor Potential Channels Regulate Myogenic Tone of Resistance Arteries Circ. Res., February 22, 2002; 90(3): 248 - 250. [Abstract] [Full Text] [PDF]

				L. C. Ng and A. M. Gurney Store-Operated Channels Mediate Ca2+ Influx and Contraction in Rat Pulmonary Artery Circ. Res., November 9, 2001; 89(10): 923 - 929. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xu, S.-Z. Articles by Beech, D. J. Search for Related Content PubMed PubMed Citation Articles by Xu, S.-Z. Articles by Beech, D. J. Related Collections Ion channels/membrane transport