Molecular Medicine |
From the Departments of Medicine (Cardiovascular Division) (Y.G., R.Y., S.T., A.W.A., J.A.W.) and Molecular Pharmacology (J.A.W.), Albert Einstein College of Medicine of Yeshiva University, Bronx, NY. Current address for R.Y. is Department of Cardiology, Nara Hospital, Kinki University School of Medicine, Ikoma City, Nara, Japan.
Correspondence to J. Anthony Ware, MD, Cardiovascular Division, Department of Medicine, Albert Einstein College of Medicine of Yeshiva University, 1300 Morris Park Ave, Bronx, NY 10461. E-mail jaware{at}aecom.yu.edu\\ © 2000 American Heart Association, Inc.
| Abstract |
|---|
|
|
|---|
and TPß), both
expressed in human ECs. In this study, we demonstrate that the
TxA2 mimetic IBOP increases apoptosis of human
ECs and inhibits the phosphorylation of Akt kinase, an intracellular
mediator required for cell survival. Treatment with IBOP destroyed EC
networks formed on a basement membrane matrix in vitro. To distinguish
the role of the TP isoforms, each isoform was expressed in TP-null ECs
to create TP
and TPß ECs. IBOP induced apoptosis and inhibited
phosphorylation of Akt kinase in both TP
and TPß. IBOP increased
cAMP levels in TP
but not in TPß. Apoptosis induced by IBOP in
TP
was not affected by either the adenylyl cyclase activator
forskolin or the protein kinase A inhibitor 14-22 amide or H-89,
whereas that in TPß was suppressed by forskolin and enhanced by the
protein kinase A inhibitor 14-22 amide or H-89, suggesting that the TP
isoforms differ in their signal pathways in mediating apoptosis. In
conclusion, apoptosis may be the mechanism by which
TxA2-mediated destruction of vascular structures
in ECs occurs; although both TP isoforms induce apoptosis, possibly via
inhibiting Akt phosphorylation, the signaling differs in each isoform,
in that activation of the adenylyl cyclase pathway prevents apoptosis
caused by TPß, but not by TP
,
stimulation.
Key Words: thromboxane A2 endothelial cells apoptosis Akt kinase cAMP
| Introduction |
|---|
|
|
|---|
TxA2-induced functions are mediated
by TPs that are members of the G proteincoupled receptor family. Thus
far, two TP isoforms have been cloned, one from placenta
(TP
)10 and one
from ECs (TPß).11
These isoforms differ in their alternately spliced cytoplasmic
C-terminal tails. These tails have an important role in regulating TP
signaling and can be phosphorylated (eg, by the cGMP-dependent
kinase).12 The
differences in the cytoplasmic domains have been shown to confer
association with different G proteins. Although both receptors are
linked to
Gq/G11,13
TP
also interacts with Gs to stimulate a
concomitant increase in cAMP after ligand stimulation, whereas TPß
causes a ligand-induced decrease in the elevated cAMP level produced by
an adenylyl cyclase
activator.14 Recent
reports show that the mechanisms and kinetics for desensitization and
internalization differ between these two TP
isoforms,15 16
suggesting that each receptor is linked to a different signal
transduction pathway. Whether each receptor triggers a discrete pathway
in ECs or mediates distinct EC events is unknown. Recently, we reported
that activation of the TP by the TxA2 mimetics
IBOP and U46619 inhibits EC migration in a denudation-injury model and
prevents the formation of vascular networks in human umbilical vein ECs
(HECs) in vitro,17
both of which are fundamental events in angiogenesis and in remodeling.
Because the balance between positive and negative regulators of EC
survival determines vascular formation, we hypothesized that TP
stimulation might be involved in the regulation of EC growth or
survival. It has been established that activation of the
serine/threonine protein kinase Akt, also known as protein kinase B or
Rac kinase, is involved in embryonic vascular development and
neoangiogenesis, and the phosphatidylinositol 3'-kinase
(PI3-kinase)/Akt pathways are the targets of the antiapoptotic effects
of many cytokines and angiogenic growth
factors.18 19
In this study, we demonstrate that TP stimulation degrades capillary formation in ECs in vitro, and that TP stimulation induces EC apoptosis and inhibits phosphorylation of the survival protein kinase Akt. Furthermore, TP isoforms differ in the signal transduction pathway used to cause apoptosis.
| Materials and Methods |
|---|
|
|
|---|
or TPß cDNA were constructed. RECs were transfected
with vector, TP
, or TPß construct using lipofectin (Gibco BRL).
Stable clones were selected by neomycin and sorted by GFP fluorescence
using a FACScan flow cytometer. Expression of TP was determined by
reverse transcriptionpolymerase chain reaction (RT-PCR) using
SuperScript One-Step RT-PCR kit (Gibco BRL). A sense primer, 3AF,
AGACAGTGCTGCGAAACCCG (nucleotides 800 to 819), corresponding to the
conserved region, and three antisense primers were used, 3BR,
TCTTCCAATGTCTGCATGCCC (nucleotides 1315 to 1295) in the TP
-specific
region, and 3CR, TGTAATCCCAGCTGCTCGGGA (nucleotides 1764 to 1745), and
4AS, GGAGTCTCACTCTGTGGCCCA (nucleotides 1006 to 987), representing the
portion of the cytoplasmic tail common to both isoforms after
TP
-specific region. TP binding sites were determined as
described.15
[Ca2+]i responding
to IBOP stimulation was measured using fura 2based digital imaging
microscopy as
described.22
In Vitro Tube Formation Assay
Cells (1.5x105/well) were
seeded on Matrigel in 12-well plates for 13 hours to allow tube
formation, then stimulated with different concentrations of IBOP alone
or plus SQ29548 for an additional 24 hours. The number of enclosed
networks of tubes was determined as
described.17
Incomplete networks were not counted.
Analysis of EC Apoptosis
Cells (1x106) were
harvested and stained by either fluorescein isothiocyanateconjugated
annexin V (for HECs) or annexin V-biotin/streptavidin-allophycocyanin
(for RECs) and propidium iodide dye following the manufacturers
protocol (PharMingen). Apoptotic cells were determined by flow
cytometry. For morphology, HECs on Matrigel were stained in situ with
Hoechst 33342 for 10 minutes and fixed with 3.7% formaldehyde in PBS
for 15 minutes. Images were captured using a Nikon Eclipse 600
microscope with a Nikon Coolpix 950 digital camera attached. For
quantification of apoptotic cells, tubular networks formed on Matrigel
were liberated by dispase (1 mL/well) digestion for 2 hours. The
dispase was then inactivated by 10 mmol/L EDTA. The dispersed cells
were collected by centrifuging at 200g for 5 minutes.
To determine DNA content, liberated cells were incubated with 100 µL
Hoechst 33342 (1 mmol/L in PBS) for 30 minutes on ice and analyzed by
flow cytometry. The number of apoptotic cells was estimated as the
percentage of total cells to the left of the
G0/G1
peak.
Akt Phosphorylation Assay
Akt phosphorylation was analyzed with the
phosphospecific Akt (Ser473) antibody (New England BioLabs) by Western
blotting.21
cAMP Enzyme Immunoassay (EIA)
Measurement
cAMP measurements of the cell lysates were performed
by an enzyme immunoassay (EIA) according to the manufacturers
instruction (Amersham).
Statistical Analysis
One- or two-way ANOVA was performed. Post hoc test
was performed by Fishers least significant difference method.
Differences were considered significant at values of
P<0.01.
| Results |
|---|
|
|
|---|
and TPß
(Figure 1A
and TPß expressed a similar number of receptors
(Bmax=125.2±7.8 and 135.1±9.2 fmol/million
cells, respectively). There was no significant difference in the
Kd between TP
and TPß
(11.2±1.3 and 10.2±1.7 nmol/L, respectively). Endogenous TP
expression in HECs was also confirmed by
[3H]SQ29548 binding
(Bmax=14.6±2.5 fmol/million cells,
Kd=9.8±1.2 nmol/L). As a
functional index,
[Ca2+]i levels
after IBOP stimulation were measured in
Figure 1C
and TPß showed significant
increase in [Ca2+]i
on IBOP stimulation. Thus, we demonstrated that both TP isoforms were
expressed in HECs, and we created ECs that separately express each TP
isoform to study what differences, if any, existed in their ability to
modulate EC function.
|
Reversal of Angiogenesis In Vitro and Apoptosis
of HECs by TxA2
HECs were incubated with IBOP on the Matrigel as
described in Materials and Methods. Loss of preformed EC tubes after
IBOP treatment was observed in a concentration-dependent manner. This
degradation of the tubes was specifically prevented by the TP
antagonist SQ29548
(Figure 2A
), indicating that this effect resulted from
stimulation of the TP. A representative experiment of degradation of EC
tubes on the Matrigel is shown in
Figure 2B
. To determine whether IBOP-induced apoptosis might
be the cause, we examined whether IBOP-treated ECs demonstrated
evidence of apoptosis. IBOP increased HEC apoptosis 2-fold after 24
hours
(Figure 3A
, left) and >3-fold after 48 hours
(Figure 3A
, right), as determined by flow cytometry. The TP
antagonist SQ29548
(Figure 3
) also blocked these effects. Apoptosis of HECs from
Matrigel was determined morphologically by Hoechst 33342 stain and also
by flow cytometry. IBOP-treated HECs from Matrigel did not form tubes
and exhibited a random arrangement of cells with either condensed or
fragmented nuclei
(Figure 3B
), which were considered apoptotic, and the number
of apoptotic cells was increased 55% compared with untreated cells
(Figure 3C
). Thus, IBOP mediated the degradation of preformed
capillary tubes in vitro and induced apoptosis in
HECs.
|
|
Reversal of Angiogenesis In Vitro and Apoptosis
in REC TP
and TPß by TxA2
To determine whether the TP isoforms had different
effects in IBOP-induced tube degradation and apoptosis, we tested
whether IBOP causes tube degradation and apoptosis in only TP
ECs or
TPß ECs or both. IBOP degraded formed tubes and induced apoptosis in
both TP
and TPß ECs, which was specifically blocked by SQ29548
(Figures 4
and 5
). Vector-transfected cells did not show tube
degradation or increased apoptosis with IBOP. Thus, these results
suggest that either TP isoform can mediate IBOP-induced reversal of
angiogenesis in vitro and EC apoptosis.
|
|
TxA2 Inhibits
Phosphorylation of Akt Kinase
Given that the Akt signal pathway is an important
determinant of EC survival, we determined whether IBOP induces
apoptosis by counteracting serum-induced Akt activation. Akt
phosphorylation was analyzed by Western blotting with a specific
phospho-Akt antibody, which has been shown to correlate with its enzyme
activity.19 In the
presence of serum, apoptosis is inhibited and Akt is phosphorylated and
activated. Stimulation with IBOP in HECs
(Figure 6A
) and in RECs expressing either TP isoform
(Figure 6B
) markedly decreased the amount of phosphorylated
Akt. TP antagonist SQ29548 specifically blocked the dephosphorylation
of Akt by IBOP. These results suggest that IBOP induces apoptosis in
ECs, probably via inhibiting the Akt signal transduction
pathway.
|
Effect of Adenylyl Cyclase Stimulation or
Inhibition on Apoptosis Induced by TxA2
Previous reports suggested that the TP isoforms have
distinct effects on cAMP
metabolism,14 and
changes in cAMP levels are associated with apoptosis in different kinds
of
cells.23 24 25 26
Thus, we determined whether the cAMP-dependent pathway contributes to
IBOP-induced apoptosis by each TP isoform.
Figure 7
demonstrates a differential response in cAMP levels
after IBOP in each of the ECs. TP
ECs showed a
concentration-dependent increase in cAMP levels, whereas neither TPß
ECs nor vector ECs showed a significant change in cAMP levels. To test
whether modification of the cAMP pathway affects apoptosis in either
TP
or TPß ECs, cells were treated with either the adenylyl cyclase
activator forskolin or the cell-permeable myristoylated PKA inhibitor
14-22 amide and H-89. Neither forskolin nor the two PKA inhibitors
affected IBOP-induced apoptosis in TP
cells
(Figure 8A
). On the other hand, forskolin suppressed
IBOP-induced apoptosis, and both of the PKA inhibitors enhanced
IBOP-induced apoptosis in TPß cells
(Figure 8B
). These results suggest that the inhibition of
adenylyl cyclase by TPß stimulation may have an important role in
inducing EC apoptosis, but that TP
stimulation, although it affects
cAMP metabolism, may induce apoptosis by a separate
mechanism.
|
|
| Discussion |
|---|
|
|
|---|
What is the mechanism(s) by which TP stimulation induces apoptosis and reverses vascular tube formation? One possibility is that EC tubes on Matrigel require growth factors, such as basic fibroblast growth factor (FGF), for their maintenance and survival. Reversal of angiogenesis was recently noted in HECs after deprivation of basic FGF, which was followed by apoptosis.28 Increasing evidence of crosstalk between G protein and tyrosine kinase receptors29 suggests that one of the possible mechanisms for our observations is that TxA2-derived signals may interact with and inhibit such a growth factor survival signaling pathway.
A second possibility, not necessarily mutually exclusive, is based on the effect of TxA2 on Akt. Akt is a growth factorregulated serine/threonine kinase that contains a pleckstrin homology (PH) domain and is activated by a mechanism involving PI3-kinase. Binding of PI3-kinase products to the PH domain results in translocation of Akt to the plasma membrane where it is activated by phosphorylation by upstream kinases including PI3-kinase. Activated Akt provides a universal survival signal to protect cells from apoptosis induced by various stresses.19 30 In this study, we have demonstrated that IBOP markedly reduces the phosphorylation of Akt in ECs. Phosphorylation of Akt correlates with its kinase activity, which, in turn, is proportional to its ability to inhibit apoptosis and promote survival.19 31 Thus, these results suggest that TxA2 may induce apoptosis by inhibiting the Akt signal pathway.
As noted above, human TP exists as at least two isoforms
(TP
and TPß). Both isoforms are expressed in a number of tissues
and cells including platelets, placenta, and ECs. To test the
differential role of TP isoforms in mediating EC apoptosis, we
expressed each isoform in RECs, which have no native functional TP.
Both TP
and TPß ECs showed enhanced apoptosis and decreased
phospho-Akt level after IBOP stimulation, suggesting that both TP
isoforms mediate EC apoptosis, although it is not clear how these
isoforms are regulated in vivo.
The next hypothesis that we tested is that the TP isoforms
induced apoptosis using different intracellular mediators. Each TP
isoform uses a signaling pathway with some features that are shared,
and at least some that differ. Hirata et
al14 reported that
in human platelets TP
was functionally coupled to
Gs whereas TPß was coupled to
Gi. Thus, in addition to differences in
desensitization15
and
internalization,16
the TP isoforms have contrasting effects on cAMP
mobilization.
There are data to suggest that these changes in cAMP may be
related to the ability of TxA2 to induce
apoptosis; in tissues other than ECs, such changes in cAMP levels have
been linked to this process. No consistent direction for the
association of cAMP changes with apoptosis has been established. In
some cases, increased cAMP
promotes,23 24
and in others
prevents,25 26
apoptosis. In vascular ECs, TxA2 causes vascular
EC damage (as estimated by adenine release), and a phosphodiesterase
inhibitor, which increases cAMP levels, prevents this
TxA2-induced damage, although whether the
effects of TxA2 resulted from apoptosis in that
study is unknown.32
In the present study, we sought to determine whether PKA inhibition
could be responsible for the apoptosis in TPß ECs, or whether PKA
activation could mediate IBOP-induced apoptosis in TP
ECs. The
adenylyl cyclase activator forskolin suppressed and the PKA inhibitors
increased TxA2-induced apoptosis in TPß,
suggesting that the inhibition of PKA (a decrease of the cAMP level)
may promote apoptosis in these cells. On the other hand, the PKA
inhibitors did not block TxA2-induced apoptosis
in TP
, nor was such apoptosis enhanced by forskolin. These results
indicate that PKA inhibition induced by the TPß isoform might mediate
the proapoptotic effect of TP, but that PKA activation induced by the
TP
might not be related to apoptosis in ECs. These data suggest that
stimulation of each TP isoform may induce apoptosis via a different
downstream pathway, only one of which (TPß) appears to be associated
with cAMP.
In disease states such as myocardial infarction and pregnancy-induced hypertension, an elevated number of TPs has been found in platelets,4 7 and there are also increased levels of circulating TxA2.3 6 Our finding that TxA2 damages ECs suggests that the eicosanoid might further aggravate these diseases by lessening the thromboresistant and vasodilatory properties of ECs. In addition, TxA2 might prevent and reverse angiogenesis or collateral development in ischemic hearts, a process that protects hearts from further ischemia and promotes recovery.33 Thus, we speculate that a TxA2 receptor blocker and/or TxA2 synthase inhibitor might promote angiogenesis and improve the process of remodeling of the tissue over several weeks.
In conclusion, we demonstrate TP-mediated reversal of tube formation in vitro and also a possible mechanism for this phenomenon: TP-mediated apoptosis of HECs at least partially through dephosphorylation of Akt kinase. TP isoforms mediate apoptosis through at least two separate signal transduction pathways. These observations suggest that TP stimulation of ECs may have an important effect on pathophysiological conditions marked by TxA2 release that requires vascular growth or repair.
| Acknowledgments |
|---|
This work was supported by HL47032 and HL51043 from the National Institutes of Health. Dr Yokota was partly supported by the program JSPS Fellowship for Research at Centers of Excellence Abroad under the sponsorship of the Japan Society for the Promotion of Science. We thank Drs Weixin Zhao and George J. Christ for measuring the intracellular calcium concentrations.
| Footnotes |
|---|
Received May 23, 2000; revision received August 14, 2000; accepted August 29, 2000.
| References |
|---|
|
|
|---|
2.
Ali S,
Davis MG, Becker MW, Dorn GW. Thromboxane A2
stimulates vascular smooth muscle hypertrophy by up-regulating the
synthesis and release of endogenous basic fibroblast growth factor.
J Biol Chem. 1993;268:1739717403.
3. Fitzgerald DJ, Roy L, Catella F, FitzGerald GA. Platelet activation in unstable coronary disease. N Engl J Med. 1986;315:983989.[Abstract]
4.
Dorn GW,
Liel N, Trask JL, Mais DE, Assey ME, Halushka PV. Increased platelet
thromboxane A2/prostaglandin
H2 receptors in patients with acute myocardial
infarction. Circulation. 1990;81:212218.
5.
Fitzgerald
DJ, FitzGerald GA. Role of thrombin and thromboxane
A2 in reocclusion following coronary
thrombolysis with tissue-type plasminogen activator. Proc Natl
Acad Sci U S A. 1989;86:75857589.
6.
Meagher
EA, FitzGerald GA. Disordered eicosanoid formation in pregnancy-induced
hypertension. Circulation. 1993;88:13241333.
7. Liel N, Nathan I, Yermiyahu T, Zolotov Z, Lieberman JR, Dvilansky A, Halushka PV. Increased platelet thromboxane A2/prostaglandin H2 receptors in patients with pregnancy induced hypertension. Thromb Res. 1993;70:205210.[Medline] [Order article via Infotrieve]
8.
Kent KC,
Collins LJ, Schwerin FT, Raychowdhury MK, Ware JA. Identification of
functional PGH2/TxA2
receptors on human endothelial cells. Circ Res. 1993;72:958965.
9.
Miggin
SM, Kinsella BT. Expression and tissue distribution of the mRNAs
encoding the human thromboxane A2 receptor (TP)
and ß isoforms. Biochim Biophys Acta. 1998;1425:543559.
10. Hirata M, Hayashi Y, Ushikubi F, Yokota Y, Kageyama R, Nakanishi S, Narumiya S. Cloning and expression of cDNA for a human thromboxane A2 receptor. Nature. 1991;349:617620.[Medline] [Order article via Infotrieve]
11.
Raychowdhury
MK, Yukawa M, Collins LJ, McGrail SH, Kent KC, Ware JA. Alternative
splicing produces a divergent cytoplasmic tail in the human endothelial
thromboxane A2 receptor [published erratum
appears in J Biol Chem. 1995;:270:7011].
J Biol Chem. 1994;269:1925619261.
12.
Wang
GR, Zhu Y, Halushka PV, Lincoln TM, Mendelsohn ME. Mechanism of
platelet inhibition by nitric oxide: in vivo phosphorylation of
thromboxane receptor by cyclic GMP-dependent protein kinase.
Proc Natl Acad Sci
U S A. 1998;95:48884893.
13.
Shenker
A, Goldsmith P, Unson CG, Spiegel AM. The G protein coupled to the
thromboxane A2 receptor in human platelets is a
member of the novel Gq family. J
Biol Chem. 1991;266:93099313.
14. Hirata T, Ushikubi F, Kakizuka A, Okuma M, Narumiya S. Two thromboxane A2 receptor isoforms in human platelets: opposite coupling to adenylyl cyclase with different sensitivity to Arg60 to Leu mutation. J Clin Invest. 1996;97:949956.[Medline] [Order article via Infotrieve]
15.
Yukawa
M, Yokota R, Eberhardt RT, von Andrian L, Ware JA. Differential
desensitization of thromboxane A2 receptor
subtypes. Circ Res. 1997;80:551556.
16.
Parent
JL, Labrecque P, Orsini MJ, Benovic JL. Internalization of the
TXA2 receptor
nd ß ßsoforms: role of
the differentially spliced COOH terminus in agonist-promoted receptor
internalization. J Biol Chem. 1999;274:89418948.
17.
Ashton
AW, Yokota R, John G, Zhao S, Suadicani SO, Spray DC, Ware JA.
Inhibition of endothelial cell migration, intercellular communication,
and vascular tube formation by thromboxane A2.
J Biol Chem. 1999;274:3556235570.
18.
Gerber
HP, McMurtrey A, Kowalski J, Yan M, Keyt BA, Dixit V, Ferrara N.
Vascular endothelial growth factor regulates endothelial cell survival
through the phosphatidylinositol 3'-kinase/Akt signal transduction
pathway: requirement for Flk-1/KDR activation. J Biol
Chem. 1998;273:3033630343.
19. Kandel ES, Hay N. The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB. Exp Cell Res. 1999;253:210229.[Medline] [Order article via Infotrieve]
20.
Tang
S, Morgan KG, Parker C, Ware JA. Requirement for protein kinase C
or cell cycle progression and formation of actin stress fibers and
filopodia in vascular endothelial cells. J Biol
Chem. 1997;272:2870428711.
21.
Tang
S, Gao Y, Ware JA. Enhancement of endothelial cell migration and in
vitro tube formation by TAP20, a novel ß5
integrin-modulating, PKC
-dependent protein. J Cell
Biol. 1999;147:10731084.
22. Zhao W, Christ GJ. Endothelin-1 as a putative modulator of erectile dysfunction, II: calcium mobilization in cultured human corporal smooth muscle cells. J Urol. 1995;154:15711579.[Medline] [Order article via Infotrieve]
23.
Taga
S, Carlier K, Mishal Z, Capoulade C, Mangeney M, Lecluse Y, Coulaud D,
Tetaud C, Pritchard LL, Tursz T, Wiels J. Intracellular signaling
events in CD77-mediated apoptosis of Burkitts lymphoma cells.
Blood. 1997;90:27572767.
24.
Srivastava
RK, Srivastava AR, Korsmeyer SJ, Nesterova M, Cho-Chung YS, Longo DL.
Involvement of microtubules in the regulation of Bcl2 phosphorylation
and apoptosis through cyclic AMP-dependent protein kinase. Mol
Cell Biol. 1998;18:35093517.
25. Michel PP, Agid Y. Chronic activation of the cyclic AMP signaling pathway promotes development and long-term survival of mesencephalic dopaminergic neurons. J Neurochem. 1996;67:16331642.[Medline] [Order article via Infotrieve]
26.
Parvathenani
LK, Buescher ES, Chacon-Cruz E, Beebe SJ. Type I cAMP-dependent protein
kinase delays apoptosis in human neutrophils at a site upstream of
caspase-3. J Biol Chem. 1998;273:67366743.
27. Reale M, Barbacane RC, Frydas S, Anogianakis G, Trakatellis A, Dimitriadou D, Vacalis D, Placido FC, De Fazio P, Porreca E, Di Febbo C, Conti P. Human recombinant interleukin-1ß induces thromboxane A2 release in polymorphonuclear leukocytes, macrophages and platelets: effect of IL-1 receptor antagonist. Mol Cell Biochem. 1996;159:163168.[Medline] [Order article via Infotrieve]
28. Satake S, Kuzuya M, Ramos MA, Kanda S, Iguchi A. Angiogenic stimuli are essential for survival of vascular endothelial cells in three-dimensional collagen lattice. Biochem Biophys Res Commun. 1998;244:642646.[Medline] [Order article via Infotrieve]
29. Ptasznik A, Gewirtz AM. Crosstalk between G protein-coupled receptors and tyrosine kinase signaling: Src take centre stage. Arch Immunol Ther Exp. 2000;48:2730.
30.
Kennedy
SG, Wagner AJ, Conzen SD, Jordan J, Bellacosa A, Tsichlis PN, Hay N.
The PI 3-kinase/Akt signaling pathway delivers an anti-apoptotic
signal. Genes Dev. 1997;11:701713.
31. Bellacosa A, Chan TO, Ahmed NN, Datta K, Malstrom S, Stokoe D, McCormick F, Feng J, Tsichlis P. Akt activation by growth factors is a multiple-step process: the role of the PH domain. Oncogene. 1998;17:313325.[Medline] [Order article via Infotrieve]
32. Kishi Y, Numano F. In vitro study of vascular endothelial injury by activated platelets and its prevention. Atherosclerosis. 1989;76:95101.[Medline] [Order article via Infotrieve]
33. Ware JA, Simons M. Angiogenesis in ischemic heart disease. Nat Med. 1997;3:158164.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
S. E. Iismaa, B. M. Mearns, L. Lorand, and R. M. Graham Transglutaminases and Disease: Lessons From Genetically Engineered Mouse Models and Inherited Disorders Physiol Rev, July 1, 2009; 89(3): 991 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Song, M. Zhang, S. Wang, J. Xu, H. C. Choi, and M.-H. Zou Thromboxane A2 Receptor Activates a Rho-associated Kinase/LKB1/PTEN Pathway to Attenuate Endothelium Insulin Signaling J. Biol. Chem., June 19, 2009; 284(25): 17120 - 17128. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Benndorf, E. Schwedhelm, A. Gnann, R. Taheri, G. Kom, M. Didie, A. Steenpass, S. Ergun, and R. H. Boger Isoprostanes Inhibit Vascular Endothelial Growth Factor-Induced Endothelial Cell Migration, Tube Formation, and Cardiac Vessel Sprouting In Vitro, As Well As Angiogenesis In Vivo via Activation of the Thromboxane A2 Receptor: A Potential Link Between Oxidative Stress and Impaired Angiogenesis Circ. Res., October 24, 2008; 103(9): 1037 - 1046. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Mir and G. C. Le Breton A Novel Nuclear Signaling Pathway for Thromboxane A2 Receptors in Oligodendrocytes: Evidence for Signaling Compartmentalization during Differentiation Mol. Cell. Biol., October 15, 2008; 28(20): 6329 - 6341. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Sellers and J. N. Stallone Sympathy for the devil: the role of thromboxane in the regulation of vascular tone and blood pressure Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H1978 - H1986. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Alfranca, M. A. Iniguez, M. Fresno, and J. M. Redondo Prostanoid signal transduction and gene expression in the endothelium: Role in cardiovascular diseases Cardiovasc Res, June 1, 2006; 70(3): 446 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Michel, J.-S. Silvestre, L. Waeckel, S. Corda, T. Verbeuren, J. P. Vilaine, M. Clergue, M. Duriez, and B. I. Levy Thromboxane A2/Prostaglandin H2 Receptor Activation Mediates Angiotensin II-Induced Postischemic Neovascularization Arterioscler. Thromb. Vasc. Biol., March 1, 2006; 26(3): 488 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Quiniou, F. Sennlaub, M. H. Beauchamp, D. Checchin, I. Lahaie, S. Brault, F. Gobeil Jr., M. Sirinyan, A. Kooli, P. Hardy, et al. Dominant Role for Calpain in Thromboxane-Induced Neuromicrovascular Endothelial Cytotoxicity J. Pharmacol. Exp. Ther., February 1, 2006; 316(2): 618 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Wassmer, J. B. de Souza, C. Frere, F. J. Candal, I. Juhan-Vague, and G. E. Grau TGF-{beta}1 Released from Activated Platelets Can Induce TNF-Stimulated Human Brain Endothelium Apoptosis: A New Mechanism for Microvascular Lesion during Cerebral Malaria J. Immunol., January 15, 2006; 176(2): 1180 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li, K.-R. Chiou, A. Bugayenko, K. Irani, and D. A. Kass Reduced Wall Compliance Suppresses Akt-Dependent Apoptosis Protection Stimulated by Pulse Perfusion Circ. Res., September 16, 2005; 97(6): 587 - 595. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Pidgeon, R. Tamosiuniene, G. Chen, I. Leonard, O. Belton, A. Bradford, and D. J. Fitzgerald Intravascular Thrombosis After Hypoxia-Induced Pulmonary Hypertension: Regulation by Cyclooxygenase-2 Circulation, October 26, 2004; 110(17): 2701 - 2707. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Iismaa and R. M. Graham Dissecting Cardiac Hypertrophy and Signaling Pathways: Evidence for an Interaction Between Multifunctional G Proteins and Prostanoids Circ. Res., May 30, 2003; 92(10): 1059 - 1061. [Full Text] [PDF] |
||||
![]() |
Z. Zhang, R. Vezza, T. Plappert, P. McNamara, J. A. Lawson, S. Austin, D. Pratico, M. S.-J. Sutton, and G. A. FitzGerald COX-2-Dependent Cardiac Failure in Gh/tTG Transgenic Mice Circ. Res., May 30, 2003; 92(10): 1153 - 1161. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Belton and D. Fitzgerald Cyclooxygenase-2 inhibitors and atherosclerosis J. Am. Coll. Cardiol., May 21, 2003; 41(10): 1820 - 1822. [Full Text] [PDF] |
||||
![]() |
X. Peng, S. Haldar, S. Deshpande, K. Irani, and D. A. Kass Wall Stiffness Suppresses Akt/eNOS and Cytoprotection in Pulse-Perfused Endothelium Hypertension, February 1, 2003; 41(2): 378 - 381. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Miggin and B. T. Kinsella Regulation of Extracellular Signal-Regulated Kinase Cascades by alpha - and beta -Isoforms of the Human Thromboxane A2 Receptor Mol. Pharmacol., April 1, 2002; 61(4): 817 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-H. Zou, C. Shi, and R. A. Cohen High Glucose via Peroxynitrite Causes Tyrosine Nitration and Inactivation of Prostacyclin Synthase That Is Associated With Thromboxane/Prostaglandin H2 Receptor-Mediated Apoptosis and Adhesion Molecule Expression in Cultured Human Aortic Endothelial Cells Diabetes, January 1, 2002; 51(1): 198 - 203. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shizukuda and P. M. Buttrick Protein kinase C-zeta modulates thromboxane A2-mediated apoptosis in adult ventricular myocytes via Akt Am J Physiol Heart Circ Physiol, January 1, 2002; 282(1): H320 - H327. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |