Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2000;87:739-745

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, Y.
Right arrow Articles by Ware, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, Y.
Right arrow Articles by Ware, J. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow Angiogenesis
Right arrow Apoptosis
Right arrow Cell signalling/signal transduction
Right arrow Endothelium/vascular type/nitric oxide
(Circulation Research. 2000;87:739.)
© 2000 American Heart Association, Inc.


Molecular Medicine

Reversal of Angiogenesis In Vitro, Induction of Apoptosis, and Inhibition of Akt Phosphorylation in Endothelial Cells by Thromboxane A2

Yunling Gao1, Ryoji Yokota1, Shaoqing Tang, Anthony W. Ashton, J. Anthony Ware

From the Departments of Medicine (Cardiovascular Division) (Y.G., R.Y., S.T., A.W.A., J.A.W.) and Molecular Pharmacology (J.A.W.), Albert Einstein College of Medicine of Yeshiva University, Bronx, NY. Current address for R.Y. is Department of Cardiology, Nara Hospital, Kinki University School of Medicine, Ikoma City, Nara, Japan.

Correspondence to J. Anthony Ware, MD, Cardiovascular Division, Department of Medicine, Albert Einstein College of Medicine of Yeshiva University, 1300 Morris Park Ave, Bronx, NY 10461. E-mail jaware{at}aecom.yu.edu\\ © 2000 American Heart Association, Inc.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Thromboxane A2 (TxA2) causes platelet aggregation, vasoconstriction, and inhibition of endothelial cell (EC) migration and prevents vascular tube formation via its specific receptors (TP), of which there are two isoforms (TP{alpha} and TPß), both expressed in human ECs. In this study, we demonstrate that the TxA2 mimetic IBOP increases apoptosis of human ECs and inhibits the phosphorylation of Akt kinase, an intracellular mediator required for cell survival. Treatment with IBOP destroyed EC networks formed on a basement membrane matrix in vitro. To distinguish the role of the TP isoforms, each isoform was expressed in TP-null ECs to create TP{alpha} and TPß ECs. IBOP induced apoptosis and inhibited phosphorylation of Akt kinase in both TP{alpha} and TPß. IBOP increased cAMP levels in TP{alpha} but not in TPß. Apoptosis induced by IBOP in TP{alpha} was not affected by either the adenylyl cyclase activator forskolin or the protein kinase A inhibitor 14-22 amide or H-89, whereas that in TPß was suppressed by forskolin and enhanced by the protein kinase A inhibitor 14-22 amide or H-89, suggesting that the TP isoforms differ in their signal pathways in mediating apoptosis. In conclusion, apoptosis may be the mechanism by which TxA2-mediated destruction of vascular structures in ECs occurs; although both TP isoforms induce apoptosis, possibly via inhibiting Akt phosphorylation, the signaling differs in each isoform, in that activation of the adenylyl cyclase pathway prevents apoptosis caused by TPß, but not by TP{alpha}, stimulation.


Key Words: thromboxane A2 • endothelial cells • apoptosis • Akt kinase • cAMP


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The eicosanoid thromboxane A2 (TxA2) is released from activated platelets, monocytes, and damaged vessel wall and causes platelet aggregation, vasoconstriction, and hypertrophy of vascular smooth muscle.1 2 TxA2 and its receptor (TP) are known mediators of unstable coronary disease,3 acute myocardial infarction,4 reocclusion after coronary thrombolysis,5 pregnancy-induced hypertension,6 7 and ischemia of multiple organs.1 The expression of TPs8 9 in the vasculature is widespread, but whether TxA2 affects the growth or survival of endothelial cells (ECs) is unknown.

TxA2-induced functions are mediated by TPs that are members of the G protein–coupled receptor family. Thus far, two TP isoforms have been cloned, one from placenta (TP{alpha})10 and one from ECs (TPß).11 These isoforms differ in their alternately spliced cytoplasmic C-terminal tails. These tails have an important role in regulating TP signaling and can be phosphorylated (eg, by the cGMP-dependent kinase).12 The differences in the cytoplasmic domains have been shown to confer association with different G proteins. Although both receptors are linked to Gq/G11,13 TP{alpha} also interacts with Gs to stimulate a concomitant increase in cAMP after ligand stimulation, whereas TPß causes a ligand-induced decrease in the elevated cAMP level produced by an adenylyl cyclase activator.14 Recent reports show that the mechanisms and kinetics for desensitization and internalization differ between these two TP isoforms,15 16 suggesting that each receptor is linked to a different signal transduction pathway. Whether each receptor triggers a discrete pathway in ECs or mediates distinct EC events is unknown. Recently, we reported that activation of the TP by the TxA2 mimetics IBOP and U46619 inhibits EC migration in a denudation-injury model and prevents the formation of vascular networks in human umbilical vein ECs (HECs) in vitro,17 both of which are fundamental events in angiogenesis and in remodeling. Because the balance between positive and negative regulators of EC survival determines vascular formation, we hypothesized that TP stimulation might be involved in the regulation of EC growth or survival. It has been established that activation of the serine/threonine protein kinase Akt, also known as protein kinase B or Rac kinase, is involved in embryonic vascular development and neoangiogenesis, and the phosphatidylinositol 3'-kinase (PI3-kinase)/Akt pathways are the targets of the antiapoptotic effects of many cytokines and angiogenic growth factors.18 19

In this study, we demonstrate that TP stimulation degrades capillary formation in ECs in vitro, and that TP stimulation induces EC apoptosis and inhibits phosphorylation of the survival protein kinase Akt. Furthermore, TP isoforms differ in the signal transduction pathway used to cause apoptosis.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials, Cell Culture, and Stable Lines of Rat Capillary ECs (RECs)
The TxA2 mimetic IBOP and antagonist SQ29548 were purchased from Cayman Chemical. [3H]SQ29548 was from NEN Life Science. Forskolin, protein kinase A (PKA) inhibitor 14-22 amide, and H-89 were obtained from Calbiochem. HECs were isolated and cultured until the third passage in M199 containing 20% newborn calf serum and 5% human serum.17 RECs were cultured in M199 with 15% FBS.20 Differential expression plasmids (the GFP/pRc plasmid21 ) containing TP{alpha} or TPß cDNA were constructed. RECs were transfected with vector, TP{alpha}, or TPß construct using lipofectin (Gibco BRL). Stable clones were selected by neomycin and sorted by GFP fluorescence using a FACScan flow cytometer. Expression of TP was determined by reverse transcription–polymerase chain reaction (RT-PCR) using SuperScript One-Step RT-PCR kit (Gibco BRL). A sense primer, 3AF, AGACAGTGCTGCGAAACCCG (nucleotides 800 to 819), corresponding to the conserved region, and three antisense primers were used, 3BR, TCTTCCAATGTCTGCATGCCC (nucleotides 1315 to 1295) in the TP{alpha}-specific region, and 3CR, TGTAATCCCAGCTGCTCGGGA (nucleotides 1764 to 1745), and 4AS, GGAGTCTCACTCTGTGGCCCA (nucleotides 1006 to 987), representing the portion of the cytoplasmic tail common to both isoforms after TP{alpha}-specific region. TP binding sites were determined as described.15 [Ca2+]i responding to IBOP stimulation was measured using fura 2–based digital imaging microscopy as described.22

In Vitro Tube Formation Assay
Cells (1.5x105/well) were seeded on Matrigel in 12-well plates for 13 hours to allow tube formation, then stimulated with different concentrations of IBOP alone or plus SQ29548 for an additional 24 hours. The number of enclosed networks of tubes was determined as described.17 Incomplete networks were not counted.

Analysis of EC Apoptosis
Cells (1x106) were harvested and stained by either fluorescein isothiocyanate–conjugated annexin V (for HECs) or annexin V-biotin/streptavidin-allophycocyanin (for RECs) and propidium iodide dye following the manufacturer’s protocol (PharMingen). Apoptotic cells were determined by flow cytometry. For morphology, HECs on Matrigel were stained in situ with Hoechst 33342 for 10 minutes and fixed with 3.7% formaldehyde in PBS for 15 minutes. Images were captured using a Nikon Eclipse 600 microscope with a Nikon Coolpix 950 digital camera attached. For quantification of apoptotic cells, tubular networks formed on Matrigel were liberated by dispase (1 mL/well) digestion for 2 hours. The dispase was then inactivated by 10 mmol/L EDTA. The dispersed cells were collected by centrifuging at 200g for 5 minutes. To determine DNA content, liberated cells were incubated with 100 µL Hoechst 33342 (1 mmol/L in PBS) for 30 minutes on ice and analyzed by flow cytometry. The number of apoptotic cells was estimated as the percentage of total cells to the left of the G0/G1 peak.

Akt Phosphorylation Assay
Akt phosphorylation was analyzed with the phosphospecific Akt (Ser473) antibody (New England BioLabs) by Western blotting.21

cAMP Enzyme Immunoassay (EIA) Measurement
cAMP measurements of the cell lysates were performed by an enzyme immunoassay (EIA) according to the manufacturer’s instruction (Amersham).

Statistical Analysis
One- or two-way ANOVA was performed. Post hoc test was performed by Fisher’s least significant difference method. Differences were considered significant at values of P<0.01.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Expression of TP Isoforms in HEC and REC Clones
Using RT-PCR, we have determined that HECs express both TP isoforms (Figure 1ADown, left), consistent with a previous report.9 To determine whether TP isoforms mediate different aspects of TP function, each TP isoform was expressed in RECs (which are TP-null) to create separate clones of TP{alpha} and TPß (Figure 1ADown, right). Scatchard analysis (Figure 1BDown) of each TP isoform using [3H]SQ29548 binding revealed that both TP{alpha} and TPß expressed a similar number of receptors (Bmax=125.2±7.8 and 135.1±9.2 fmol/million cells, respectively). There was no significant difference in the Kd between TP{alpha} and TPß (11.2±1.3 and 10.2±1.7 nmol/L, respectively). Endogenous TP expression in HECs was also confirmed by [3H]SQ29548 binding (Bmax=14.6±2.5 fmol/million cells, Kd=9.8±1.2 nmol/L). As a functional index, [Ca2+]i levels after IBOP stimulation were measured in Figure 1CDown. HEC and REC TP{alpha} and TPß showed significant increase in [Ca2+]i on IBOP stimulation. Thus, we demonstrated that both TP isoforms were expressed in HECs, and we created ECs that separately express each TP isoform to study what differences, if any, existed in their ability to modulate EC function.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. Figure 1Up. Characterization of TP isoforms in HEC and REC clones. A, RT-PCR detection of the TP in HEC and REC clones. TP{alpha}: the products (516 bp) amplified with 3AF and 3BR in the TP{alpha}-specific region. TPß: the products amplified with 3AF and 3CR (305 bp) or 3AF and 4AS (206 bp) in the consensus tail region after the TP{alpha}-specific region. Experiments were repeated 4 times. B, Scatchard analysis of TP{alpha} and TPß ECs. Both TP{alpha} and TPß expressed a similar number of receptors and exhibited comparable affinity for [3H]SQ29548. Independent experiments were performed 4 times, and 2 different clones of each isoform were used. C, Effects of IBOP on [Ca2+]i in HEC and REC clones. [Ca2+]i was measured in fura 2–loaded cells stimulated with 100 nmol/L IBOP. *P<0.001 vs vector.

Reversal of Angiogenesis In Vitro and Apoptosis of HECs by TxA2
HECs were incubated with IBOP on the Matrigel as described in Materials and Methods. Loss of preformed EC tubes after IBOP treatment was observed in a concentration-dependent manner. This degradation of the tubes was specifically prevented by the TP antagonist SQ29548 (Figure 2ADown), indicating that this effect resulted from stimulation of the TP. A representative experiment of degradation of EC tubes on the Matrigel is shown in Figure 2BDown. To determine whether IBOP-induced apoptosis might be the cause, we examined whether IBOP-treated ECs demonstrated evidence of apoptosis. IBOP increased HEC apoptosis 2-fold after 24 hours (Figure 3ADown, left) and >3-fold after 48 hours (Figure 3ADown, right), as determined by flow cytometry. The TP antagonist SQ29548 (Figure 3Down) also blocked these effects. Apoptosis of HECs from Matrigel was determined morphologically by Hoechst 33342 stain and also by flow cytometry. IBOP-treated HECs from Matrigel did not form tubes and exhibited a random arrangement of cells with either condensed or fragmented nuclei (Figure 3BDown), which were considered apoptotic, and the number of apoptotic cells was increased 55% compared with untreated cells (Figure 3CDown). Thus, IBOP mediated the degradation of preformed capillary tubes in vitro and induced apoptosis in HECs.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 2. Figure 2Up. IBOP-induced degradation of HEC tubes formed in vitro. A, HECs were seeded for 13 hours to allow tube formation, then treated with IBOP alone or IBOP with SQ29548 (10 µmol/L) for 24 hours. The number of networks was counted 24 hours after stimulation. Results shown are mean±SE. Five independent experiments were performed. {dagger}P<0.01 vs 0 nmol/L; *P<0.01 vs +SQ29548. B, Top, Decrease in networks corresponding to the increase in concentration of IBOP. Bottom, Suppression of the IBOP effect by SQ29548. Representative of 5 different experiments.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. Figure 3Up. Induction of HEC apoptosis by IBOP. A, HECs were cultured in the presence or absence of serum to provide the negative or positive control for apoptosis. HECs were cultured in 2% BSA with or without IBOP (100 nmol/L) for 24 hours (left) or 48 hours (right). After stimulation, cells both in the media and on the bottom of the dishes were collected. Apoptotic cells were determined by flow cytometry for annexin V and propidium iodide staining. Results shown are mean±SE of 3 independent experiments with 3 different HEC preparations. #P<0.01 vs with serum; *P<0.01 vs control. B, HECs were incubated on Matrigel for 13 hours to form tubes, then stimulated with IBOP for 24 hours and stained with Hoechst 33342 in situ. Control cultures (left) formed tubes between islands of monolayered HECs. Arrows denote proliferating cells at ends of the tube. IBOP-treated HECs (right) exhibited the absence of tube formation and random arrangement of cells. Arrows denote cells with either condensed (C) or fragmented nuclei (F). Results are representative of 3 individual experiments. C, Cells in the Matrigel were stained with Hoechst 33342 and collected after dispase digestion and analyzed by flow cytometry. The sub–G1 peak on the generated histograms (left) was used to quantify the percentage of apoptotic cells present on Matrigel (right). The data are shown as the mean±SE from 5 experiments. *P<0.001 vs control.

Reversal of Angiogenesis In Vitro and Apoptosis in REC TP{alpha} and TPß by TxA2
To determine whether the TP isoforms had different effects in IBOP-induced tube degradation and apoptosis, we tested whether IBOP causes tube degradation and apoptosis in only TP{alpha} ECs or TPß ECs or both. IBOP degraded formed tubes and induced apoptosis in both TP{alpha} and TPß ECs, which was specifically blocked by SQ29548 (Figures 4Down and 5Down). Vector-transfected cells did not show tube degradation or increased apoptosis with IBOP. Thus, these results suggest that either TP isoform can mediate IBOP-induced reversal of angiogenesis in vitro and EC apoptosis.



View larger version (73K):
[in this window]
[in a new window]
 
Figure 4. Figure 4Up. IBOP-induced degradation of tubes formed in vitro via TP{alpha} or TPß. A, RECs were seeded for 13 hours to form tubes, then treated with IBOP (100 nmol/L) alone or IBOP with SQ29548 (10 µmol/L) for 24 hours. The number of networks was counted 24 hours after stimulation. Results shown are mean±SE. *P<0.01 vs IBOP or IBOP+SQ29548. Three independent experiments were performed. B, Representative pictures show the decreases in networks in TP{alpha} and TPß ECs treated with IBOP, and the effects of IBOP were suppressed by SQ29548.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. Figure 5Up. Induction of apoptosis by IBOP in TP{alpha} or TPß ECs. RECs were serum-deprived for 2 days, then stimulated with or without IBOP (100 nmol/L) or IBOP with SQ29548 (5 µmol/L) for 24 hours in serum-free medium. Tumor necrosis factor-{alpha} (TNF-{alpha}) (100 U/mL) and cycloheximide (CHX) (2.5 µg/mL) were added as a positive control for apoptosis. After stimulation, cells both in the media and on the bottom of the dishes were collected. Apoptotic cells were determined as described in Materials and Methods. Results shown are mean±SE of 3 independent experiments. #P<0.001 vs control or IBOP in vector; *P<0.01 vs control or IBOP with SQ29548 in TP{alpha} and TPß.

TxA2 Inhibits Phosphorylation of Akt Kinase
Given that the Akt signal pathway is an important determinant of EC survival, we determined whether IBOP induces apoptosis by counteracting serum-induced Akt activation. Akt phosphorylation was analyzed by Western blotting with a specific phospho-Akt antibody, which has been shown to correlate with its enzyme activity.19 In the presence of serum, apoptosis is inhibited and Akt is phosphorylated and activated. Stimulation with IBOP in HECs (Figure 6ADown) and in RECs expressing either TP isoform (Figure 6BDown) markedly decreased the amount of phosphorylated Akt. TP antagonist SQ29548 specifically blocked the dephosphorylation of Akt by IBOP. These results suggest that IBOP induces apoptosis in ECs, probably via inhibiting the Akt signal transduction pathway.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 6. Figure 6Up. Inhibition of Akt phosphorylation by IBOP in HECs and in TP{alpha} or TPß RECs. HECs (A) and RECs (B) were cultured in the presence of serum to activate Akt maximally, then treated with or without IBOP (100 nmol/L) in serum-free medium for 20 minutes. SQ29548 (5 µmol/L) was added 20 minutes before IBOP. Western blotting was performed with the anti–phospho-Akt antibody (top). The blots were then reprobed with anti–Akt antibody as a loading control (bottom). Representative of 3 different experiments.

Effect of Adenylyl Cyclase Stimulation or Inhibition on Apoptosis Induced by TxA2
Previous reports suggested that the TP isoforms have distinct effects on cAMP metabolism,14 and changes in cAMP levels are associated with apoptosis in different kinds of cells.23 24 25 26 Thus, we determined whether the cAMP-dependent pathway contributes to IBOP-induced apoptosis by each TP isoform. Figure 7Down demonstrates a differential response in cAMP levels after IBOP in each of the ECs. TP{alpha} ECs showed a concentration-dependent increase in cAMP levels, whereas neither TPß ECs nor vector ECs showed a significant change in cAMP levels. To test whether modification of the cAMP pathway affects apoptosis in either TP{alpha} or TPß ECs, cells were treated with either the adenylyl cyclase activator forskolin or the cell-permeable myristoylated PKA inhibitor 14-22 amide and H-89. Neither forskolin nor the two PKA inhibitors affected IBOP-induced apoptosis in TP{alpha} cells (Figure 8ADown). On the other hand, forskolin suppressed IBOP-induced apoptosis, and both of the PKA inhibitors enhanced IBOP-induced apoptosis in TPß cells (Figure 8BDown). These results suggest that the inhibition of adenylyl cyclase by TPß stimulation may have an important role in inducing EC apoptosis, but that TP{alpha} stimulation, although it affects cAMP metabolism, may induce apoptosis by a separate mechanism.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 7. Figure 7Up. Differential response in cAMP levels to IBOP in TP{alpha} and TPß ECs. Cells were incubated with IBMX (0.1 mmol/L) for 10 minutes and with various concentrations of IBOP for an additional 10 minutes, and the cAMP levels were measured by EIA as described in Materials and Methods. Data points are mean±SE from 4 replicate wells of a single experiment. The results were confirmed in 2 additional experiments. *P<0.01, TP{alpha} vs 0 nmol/L, TPß, and Vector.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 8. Figure 8Up. Effect of forskolin, PKA inhibitor (PKAI), and H-89 on IBOP-induced apoptosis in TP{alpha} or TPß ECs. Cells were serum-deprived for 2 days, then stimulated with different reagents as indicated for 24 hours in serum-free medium. TNF-{alpha} (100 U/mL) and CHX (2.5 µg/mL) were added as a positive control for apoptosis. After stimulation, cells both in the media and on the bottom of the dishes were collected. Apoptotic cells were determined by flow cytometry for annexin V and propidium iodide staining. A, Forskolin (FSK) (10 µmol/L), PKAI (1 µmol/L), and H-89 (1 µmol/L) had no effect on IBOP (100 µmol/L)-induced apoptosis in TP{alpha} ECs. B, FSK decreased and PKAI and H-89 increased IBOP-induced apoptosis in TPß ECs. Three experiments were performed using 2 different clones from each isoform. #P<0.001 vs vector control; *P<0.01 vs TP{alpha} control; {Delta}P<0.01 vs TPß control and IBOP+FSK.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
TxA2 contributes to thrombosis and ischemia by causing aggregation of platelets and vasoconstriction,1 and TxA2 levels are elevated during those states.3 6 Thus, any effects that TxA2 has on endothelial function or angiogenesis would be relevant in patients with ischemia. In this study, we demonstrated that in vitro tube formation in HECs was reversed with the TxA2 mimetic, an effect that resulted from its interaction with TP and may reflect EC apoptosis. These results suggest that TxA2 may prevent and reverse angiogenesis via EC apoptosis during conditions such as myocardial infarction or myocarditis in which TxA2 is formed and released from platelets or macrophages.27 By suppressing angiogenesis, TxA2 might also affect the vascular remodeling process.

What is the mechanism(s) by which TP stimulation induces apoptosis and reverses vascular tube formation? One possibility is that EC tubes on Matrigel require growth factors, such as basic fibroblast growth factor (FGF), for their maintenance and survival. Reversal of angiogenesis was recently noted in HECs after deprivation of basic FGF, which was followed by apoptosis.28 Increasing evidence of crosstalk between G protein and tyrosine kinase receptors29 suggests that one of the possible mechanisms for our observations is that TxA2-derived signals may interact with and inhibit such a growth factor survival signaling pathway.

A second possibility, not necessarily mutually exclusive, is based on the effect of TxA2 on Akt. Akt is a growth factor–regulated serine/threonine kinase that contains a pleckstrin homology (PH) domain and is activated by a mechanism involving PI3-kinase. Binding of PI3-kinase products to the PH domain results in translocation of Akt to the plasma membrane where it is activated by phosphorylation by upstream kinases including PI3-kinase. Activated Akt provides a universal survival signal to protect cells from apoptosis induced by various stresses.19 30 In this study, we have demonstrated that IBOP markedly reduces the phosphorylation of Akt in ECs. Phosphorylation of Akt correlates with its kinase activity, which, in turn, is proportional to its ability to inhibit apoptosis and promote survival.19 31 Thus, these results suggest that TxA2 may induce apoptosis by inhibiting the Akt signal pathway.

As noted above, human TP exists as at least two isoforms (TP{alpha} and TPß). Both isoforms are expressed in a number of tissues and cells including platelets, placenta, and ECs. To test the differential role of TP isoforms in mediating EC apoptosis, we expressed each isoform in RECs, which have no native functional TP. Both TP{alpha} and TPß ECs showed enhanced apoptosis and decreased phospho-Akt level after IBOP stimulation, suggesting that both TP isoforms mediate EC apoptosis, although it is not clear how these isoforms are regulated in vivo.

The next hypothesis that we tested is that the TP isoforms induced apoptosis using different intracellular mediators. Each TP isoform uses a signaling pathway with some features that are shared, and at least some that differ. Hirata et al14 reported that in human platelets TP{alpha} was functionally coupled to Gs whereas TPß was coupled to Gi. Thus, in addition to differences in desensitization15 and internalization,16 the TP isoforms have contrasting effects on cAMP mobilization.

There are data to suggest that these changes in cAMP may be related to the ability of TxA2 to induce apoptosis; in tissues other than ECs, such changes in cAMP levels have been linked to this process. No consistent direction for the association of cAMP changes with apoptosis has been established. In some cases, increased cAMP promotes,23 24 and in others prevents,25 26 apoptosis. In vascular ECs, TxA2 causes vascular EC damage (as estimated by adenine release), and a phosphodiesterase inhibitor, which increases cAMP levels, prevents this TxA2-induced damage, although whether the effects of TxA2 resulted from apoptosis in that study is unknown.32 In the present study, we sought to determine whether PKA inhibition could be responsible for the apoptosis in TPß ECs, or whether PKA activation could mediate IBOP-induced apoptosis in TP{alpha} ECs. The adenylyl cyclase activator forskolin suppressed and the PKA inhibitors increased TxA2-induced apoptosis in TPß, suggesting that the inhibition of PKA (a decrease of the cAMP level) may promote apoptosis in these cells. On the other hand, the PKA inhibitors did not block TxA2-induced apoptosis in TP{alpha}, nor was such apoptosis enhanced by forskolin. These results indicate that PKA inhibition induced by the TPß isoform might mediate the proapoptotic effect of TP, but that PKA activation induced by the TP{alpha} might not be related to apoptosis in ECs. These data suggest that stimulation of each TP isoform may induce apoptosis via a different downstream pathway, only one of which (TPß) appears to be associated with cAMP.

In disease states such as myocardial infarction and pregnancy-induced hypertension, an elevated number of TPs has been found in platelets,4 7 and there are also increased levels of circulating TxA2.3 6 Our finding that TxA2 damages ECs suggests that the eicosanoid might further aggravate these diseases by lessening the thromboresistant and vasodilatory properties of ECs. In addition, TxA2 might prevent and reverse angiogenesis or collateral development in ischemic hearts, a process that protects hearts from further ischemia and promotes recovery.33 Thus, we speculate that a TxA2 receptor blocker and/or TxA2 synthase inhibitor might promote angiogenesis and improve the process of remodeling of the tissue over several weeks.

In conclusion, we demonstrate TP-mediated reversal of tube formation in vitro and also a possible mechanism for this phenomenon: TP-mediated apoptosis of HECs at least partially through dephosphorylation of Akt kinase. TP isoforms mediate apoptosis through at least two separate signal transduction pathways. These observations suggest that TP stimulation of ECs may have an important effect on pathophysiological conditions marked by TxA2 release that requires vascular growth or repair.


*    Acknowledgments
 

This work was supported by HL47032 and HL51043 from the National Institutes of Health. Dr Yokota was partly supported by the program JSPS Fellowship for Research at Centers of Excellence Abroad under the sponsorship of the Japan Society for the Promotion of Science. We thank Drs Weixin Zhao and George J. Christ for measuring the intracellular calcium concentrations.


*    Footnotes
 
1 Both authors contributed equally to this study. Back

Received May 23, 2000; revision received August 14, 2000; accepted August 29, 2000.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Ogletree ML. Overview of physiological and pathophysiological effects of thromboxane A2. Fed Proc. 1987;46:133–138.[Medline] [Order article via Infotrieve]

2. Ali S, Davis MG, Becker MW, Dorn GW. Thromboxane A2 stimulates vascular smooth muscle hypertrophy by up-regulating the synthesis and release of endogenous basic fibroblast growth factor. J Biol Chem. 1993;268:17397–17403.[Abstract/Free Full Text]

3. Fitzgerald DJ, Roy L, Catella F, FitzGerald GA. Platelet activation in unstable coronary disease. N Engl J Med. 1986;315:983–989.[Abstract]

4. Dorn GW, Liel N, Trask JL, Mais DE, Assey ME, Halushka PV. Increased platelet thromboxane A2/prostaglandin H2 receptors in patients with acute myocardial infarction. Circulation. 1990;81:212–218.[Abstract/Free Full Text]

5. Fitzgerald DJ, FitzGerald GA. Role of thrombin and thromboxane A2 in reocclusion following coronary thrombolysis with tissue-type plasminogen activator. Proc Natl Acad Sci U S A. 1989;86:7585–7589.[Abstract/Free Full Text]

6. Meagher EA, FitzGerald GA. Disordered eicosanoid formation in pregnancy-induced hypertension. Circulation. 1993;88:1324–1333.[Free Full Text]

7. Liel N, Nathan I, Yermiyahu T, Zolotov Z, Lieberman JR, Dvilansky A, Halushka PV. Increased platelet thromboxane A2/prostaglandin H2 receptors in patients with pregnancy induced hypertension. Thromb Res. 1993;70:205–210.[Medline] [Order article via Infotrieve]

8. Kent KC, Collins LJ, Schwerin FT, Raychowdhury MK, Ware JA. Identification of functional PGH2/TxA2 receptors on human endothelial cells. Circ Res. 1993;72:958–965.[Abstract/Free Full Text]

9. Miggin SM, Kinsella BT. Expression and tissue distribution of the mRNAs encoding the human thromboxane A2 receptor (TP) {alpha} and ß isoforms. Biochim Biophys Acta. 1998;1425:543–559.

10. Hirata M, Hayashi Y, Ushikubi F, Yokota Y, Kageyama R, Nakanishi S, Narumiya S. Cloning and expression of cDNA for a human thromboxane A2 receptor. Nature. 1991;349:617–620.[Medline] [Order article via Infotrieve]

11. Raychowdhury MK, Yukawa M, Collins LJ, McGrail SH, Kent KC, Ware JA. Alternative splicing produces a divergent cytoplasmic tail in the human endothelial thromboxane A2 receptor [published erratum appears in J Biol Chem. 1995;:270:7011]. J Biol Chem. 1994;269:19256–19261.[Abstract/Free Full Text]

12. Wang GR, Zhu Y, Halushka PV, Lincoln TM, Mendelsohn ME. Mechanism of platelet inhibition by nitric oxide: in vivo phosphorylation of thromboxane receptor by cyclic GMP-dependent protein kinase. Proc Natl Acad Sci U S A. 1998;95:4888–4893.[Abstract/Free Full Text]

13. Shenker A, Goldsmith P, Unson CG, Spiegel AM. The G protein coupled to the thromboxane A2 receptor in human platelets is a member of the novel Gq family. J Biol Chem. 1991;266:9309–9313.[Abstract/Free Full Text]

14. Hirata T, Ushikubi F, Kakizuka A, Okuma M, Narumiya S. Two thromboxane A2 receptor isoforms in human platelets: opposite coupling to adenylyl cyclase with different sensitivity to Arg60 to Leu mutation. J Clin Invest. 1996;97:949–956.[Medline] [Order article via Infotrieve]

15. Yukawa M, Yokota R, Eberhardt RT, von Andrian L, Ware JA. Differential desensitization of thromboxane A2 receptor subtypes. Circ Res. 1997;80:551–556.[Abstract/Free Full Text]

16. Parent JL, Labrecque P, Orsini MJ, Benovic JL. Internalization of the TXA2 receptor {alpha} {alpha}nd ß ßsoforms: role of the differentially spliced COOH terminus in agonist-promoted receptor internalization. J Biol Chem. 1999;274:8941–8948.[Abstract/Free Full Text]

17. Ashton AW, Yokota R, John G, Zhao S, Suadicani SO, Spray DC, Ware JA. Inhibition of endothelial cell migration, intercellular communication, and vascular tube formation by thromboxane A2. J Biol Chem. 1999;274:35562–35570.[Abstract/Free Full Text]

18. Gerber HP, McMurtrey A, Kowalski J, Yan M, Keyt BA, Dixit V, Ferrara N. Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway: requirement for Flk-1/KDR activation. J Biol Chem. 1998;273:30336–30343.[Abstract/Free Full Text]

19. Kandel ES, Hay N. The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB. Exp Cell Res. 1999;253:210–229.[Medline] [Order article via Infotrieve]

20. Tang S, Morgan KG, Parker C, Ware JA. Requirement for protein kinase C {theta} {theta}or cell cycle progression and formation of actin stress fibers and filopodia in vascular endothelial cells. J Biol Chem. 1997;272:28704–28711.[Abstract/Free Full Text]

21. Tang S, Gao Y, Ware JA. Enhancement of endothelial cell migration and in vitro tube formation by TAP20, a novel ß5 integrin-modulating, PKC {theta}-dependent protein. J Cell Biol. 1999;147:1073–1084.[Abstract/Free Full Text]

22. Zhao W, Christ GJ. Endothelin-1 as a putative modulator of erectile dysfunction, II: calcium mobilization in cultured human corporal smooth muscle cells. J Urol. 1995;154:1571–1579.[Medline] [Order article via Infotrieve]

23. Taga S, Carlier K, Mishal Z, Capoulade C, Mangeney M, Lecluse Y, Coulaud D, Tetaud C, Pritchard LL, Tursz T, Wiels J. Intracellular signaling events in CD77-mediated apoptosis of Burkitt’s lymphoma cells. Blood. 1997;90:2757–2767.[Abstract/Free Full Text]

24. Srivastava RK, Srivastava AR, Korsmeyer SJ, Nesterova M, Cho-Chung YS, Longo DL. Involvement of microtubules in the regulation of Bcl2 phosphorylation and apoptosis through cyclic AMP-dependent protein kinase. Mol Cell Biol. 1998;18:3509–3517.[Abstract/Free Full Text]

25. Michel PP, Agid Y. Chronic activation of the cyclic AMP signaling pathway promotes development and long-term survival of mesencephalic dopaminergic neurons. J Neurochem. 1996;67:1633–1642.[Medline] [Order article via Infotrieve]

26. Parvathenani LK, Buescher ES, Chacon-Cruz E, Beebe SJ. Type I cAMP-dependent protein kinase delays apoptosis in human neutrophils at a site upstream of caspase-3. J Biol Chem. 1998;273:6736–6743.[Abstract/Free Full Text]

27. Reale M, Barbacane RC, Frydas S, Anogianakis G, Trakatellis A, Dimitriadou D, Vacalis D, Placido FC, De Fazio P, Porreca E, Di Febbo C, Conti P. Human recombinant interleukin-1ß induces thromboxane A2 release in polymorphonuclear leukocytes, macrophages and platelets: effect of IL-1 receptor antagonist. Mol Cell Biochem. 1996;159:163–168.[Medline] [Order article via Infotrieve]

28. Satake S, Kuzuya M, Ramos MA, Kanda S, Iguchi A. Angiogenic stimuli are essential for survival of vascular endothelial cells in three-dimensional collagen lattice. Biochem Biophys Res Commun. 1998;244:642–646.[Medline] [Order article via Infotrieve]

29. Ptasznik A, Gewirtz AM. Crosstalk between G protein-coupled receptors and tyrosine kinase signaling: Src take centre stage. Arch Immunol Ther Exp. 2000;48:27–30.

30. Kennedy SG, Wagner AJ, Conzen SD, Jordan J, Bellacosa A, Tsichlis PN, Hay N. The PI 3-kinase/Akt signaling pathway delivers an anti-apoptotic signal. Genes Dev. 1997;11:701–713.[Abstract/Free Full Text]

31. Bellacosa A, Chan TO, Ahmed NN, Datta K, Malstrom S, Stokoe D, McCormick F, Feng J, Tsichlis P. Akt activation by growth factors is a multiple-step process: the role of the PH domain. Oncogene. 1998;17:313–325.[Medline] [Order article via Infotrieve]

32. Kishi Y, Numano F. In vitro study of vascular endothelial injury by activated platelets and its prevention. Atherosclerosis. 1989;76:95–101.[Medline] [Order article via Infotrieve]

33. Ware JA, Simons M. Angiogenesis in ischemic heart disease. Nat Med. 1997;3:158–164.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Physiol. Rev.Home page
S. E. Iismaa, B. M. Mearns, L. Lorand, and R. M. Graham
Transglutaminases and Disease: Lessons From Genetically Engineered Mouse Models and Inherited Disorders
Physiol Rev, July 1, 2009; 89(3): 991 - 1023.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Song, M. Zhang, S. Wang, J. Xu, H. C. Choi, and M.-H. Zou
Thromboxane A2 Receptor Activates a Rho-associated Kinase/LKB1/PTEN Pathway to Attenuate Endothelium Insulin Signaling
J. Biol. Chem., June 19, 2009; 284(25): 17120 - 17128.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. A. Benndorf, E. Schwedhelm, A. Gnann, R. Taheri, G. Kom, M. Didie, A. Steenpass, S. Ergun, and R. H. Boger
Isoprostanes Inhibit Vascular Endothelial Growth Factor-Induced Endothelial Cell Migration, Tube Formation, and Cardiac Vessel Sprouting In Vitro, As Well As Angiogenesis In Vivo via Activation of the Thromboxane A2 Receptor: A Potential Link Between Oxidative Stress and Impaired Angiogenesis
Circ. Res., October 24, 2008; 103(9): 1037 - 1046.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Mir and G. C. Le Breton
A Novel Nuclear Signaling Pathway for Thromboxane A2 Receptors in Oligodendrocytes: Evidence for Signaling Compartmentalization during Differentiation
Mol. Cell. Biol., October 15, 2008; 28(20): 6329 - 6341.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. M. Sellers and J. N. Stallone
Sympathy for the devil: the role of thromboxane in the regulation of vascular tone and blood pressure
Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H1978 - H1986.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Alfranca, M. A. Iniguez, M. Fresno, and J. M. Redondo
Prostanoid signal transduction and gene expression in the endothelium: Role in cardiovascular diseases
Cardiovasc Res, June 1, 2006; 70(3): 446 - 456.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
F. Michel, J.-S. Silvestre, L. Waeckel, S. Corda, T. Verbeuren, J. P. Vilaine, M. Clergue, M. Duriez, and B. I. Levy
Thromboxane A2/Prostaglandin H2 Receptor Activation Mediates Angiotensin II-Induced Postischemic Neovascularization
Arterioscler Thromb Vasc Biol, March 1, 2006; 26(3): 488 - 493.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. Quiniou, F. Sennlaub, M. H. Beauchamp, D. Checchin, I. Lahaie, S. Brault, F. Gobeil Jr., M. Sirinyan, A. Kooli, P. Hardy, et al.
Dominant Role for Calpain in Thromboxane-Induced Neuromicrovascular Endothelial Cytotoxicity
J. Pharmacol. Exp. Ther., February 1, 2006; 316(2): 618 - 627.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. C. Wassmer, J. B. de Souza, C. Frere, F. J. Candal, I. Juhan-Vague, and G. E. Grau
TGF-{beta}1 Released from Activated Platelets Can Induce TNF-Stimulated Human Brain Endothelium Apoptosis: A New Mechanism for Microvascular Lesion during Cerebral Malaria
J. Immunol., January 15, 2006; 176(2): 1180 - 1184.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Li, K.-R. Chiou, A. Bugayenko, K. Irani, and D. A. Kass
Reduced Wall Compliance Suppresses Akt-Dependent Apoptosis Protection Stimulated by Pulse Perfusion
Circ. Res., September 16, 2005; 97(6): 587 - 595.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
G. P. Pidgeon, R. Tamosiuniene, G. Chen, I. Leonard, O. Belton, A. Bradford, and D. J. Fitzgerald
Intravascular Thrombosis After Hypoxia-Induced Pulmonary Hypertension: Regulation by Cyclooxygenase-2
Circulation, October 26, 2004; 110(17): 2701 - 2707.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. E. Iismaa and R. M. Graham
Dissecting Cardiac Hypertrophy and Signaling Pathways: Evidence for an Interaction Between Multifunctional G Proteins and Prostanoids
Circ. Res., May 30, 2003; 92(10): 1059 - 1061.
[Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Zhang, R. Vezza, T. Plappert, P. McNamara, J. A. Lawson, S. Austin, D. Pratico, M. S.-J. Sutton, and G. A. FitzGerald
COX-2-Dependent Cardiac Failure in Gh/tTG Transgenic Mice
Circ. Res., May 30, 2003; 92(10): 1153 - 1161.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
O. Belton and D. Fitzgerald
Cyclooxygenase-2 inhibitors and atherosclerosis
J. Am. Coll. Cardiol., May 21, 2003; 41(10): 1820 - 1822.
[Full Text] [PDF]


Home page
HypertensionHome page
X. Peng, S. Haldar, S. Deshpande, K. Irani, and D. A. Kass
Wall Stiffness Suppresses Akt/eNOS and Cytoprotection in Pulse-Perfused Endothelium
Hypertension, February 1, 2003; 41(2): 378 - 381.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. M. Miggin and B. T. Kinsella
Regulation of Extracellular Signal-Regulated Kinase Cascades by alpha - and beta -Isoforms of the Human Thromboxane A2 Receptor
Mol. Pharmacol., April 1, 2002; 61(4): 817 - 831.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M.-H. Zou, C. Shi, and R. A. Cohen
High Glucose via Peroxynitrite Causes Tyrosine Nitration and Inactivation of Prostacyclin Synthase That Is Associated With Thromboxane/Prostaglandin H2 Receptor-Mediated Apoptosis and Adhesion Molecule Expression in Cultured Human Aortic Endothelial Cells
Diabetes, January 1, 2002; 51(1): 198 - 203.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y. Shizukuda and P. M. Buttrick
Protein kinase C-zeta modulates thromboxane A2-mediated apoptosis in adult ventricular myocytes via Akt
Am J Physiol Heart Circ Physiol, January 1, 2002; 282(1): H320 - H327.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, Y.
Right arrow Articles by Ware, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, Y.
Right arrow Articles by Ware, J. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow Angiogenesis
Right arrow Apoptosis
Right arrow Cell signalling/signal transduction
Right arrow Endothelium/vascular type/nitric oxide