This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Takano, H. Articles by Masuda, Y. Search for Related Content PubMed PubMed Citation Articles by Takano, H. Articles by Masuda, Y. Related Collections Cell signalling/signal transduction Heart failure - basic studies

(Circulation Research. 2000;87:596.)
© 2000 American Heart Association, Inc.

Molecular Medicine

Peroxisome Proliferator–Activated Receptor Activators Inhibit Lipopolysaccharide-Induced Tumor Necrosis Factor- Expression in Neonatal Rat Cardiac Myocytes

Hiroyuki Takano, Toshio Nagai, Masayuki Asakawa, Tetsuya Toyozaki, Toru Oka, Issei Komuro, Toshihiro Saito, Yoshiaki Masuda

From the Third Department of Internal Medicine (H.T., T.N., M.A., T.T., T.S., Y.M.), Chiba University School of Medicine, and Department of Cardiovascular Medicine (T.O., I.K.), University of Tokyo Graduate School of Medicine, Japan.

Correspondence to Hiroyuki Takano, MD, PhD, Third Department of Internal Medicine, Chiba University School of Medicine, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan. E-mail htakano-cib{at}umin.ac.jp

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract—Peroxisome proliferator–activated receptors (PPARs) are transcription factors belonging to the nuclear receptor superfamily. Recently, PPAR activators have been shown to inhibit the production of proinflammatory cytokines in macrophages or vascular smooth muscle cells. It has been reported that tumor necrosis factor- (TNF-) expression is elevated in the failing heart and that TNF- has a negative inotropic effect on cardiac myocytes. Therefore, we examined the effects of PPAR and PPAR activators on expression of TNF- in neonatal rat cardiac myocytes. Northern blot analysis revealed expression of PPAR and PPAR mRNA in cardiac myocytes. Immunofluorescent staining demonstrated that both PPAR and PPAR were expressed in the nuclei of cells. When cardiac myocytes were transfected with PPAR responsive element (PPRE)-luciferase reporter plasmid, both PPAR and PPAR activators increased the promoter activity. Cardiomyocytes were stimulated with lipopolysaccharide (LPS), and the levels of TNF- in the medium were measured by ELISA. After exposure to LPS, the levels of TNF- significantly increased. However, pretreatment of myocytes with PPAR or PPAR activators decreased LPS-induced expression of TNF- in the medium. Both PPAR and PPAR activators also inhibited LPS-induced increase in TNF- mRNA in myocytes. In addition, electrophoretic mobility shift assays demonstrated that PPAR activators reduced LPS-induced nuclear factor-B activation. These results suggest that both PPAR and PPAR activators inhibit cardiac expression of TNF- in part by antagonizing nuclear factor-B activity and that treatment with PPAR activators may lead to improvement in congestive heart failure.

Key Words: peroxisome proliferator–activated receptor • tumor necrosis factor- • nuclear factor-B • cardiac myocyte

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Tumor necrosis factor- (TNF-) is a proinflammatory cytokine that has been implicated in the pathogenesis of cardiovascular diseases, including congestive heart failure, acute myocardial infarction, myocarditis, and dilated cardiomyopathy.^{1 2} Several lines of evidence indicate that the levels of circulating TNF- are elevated in patients with congestive heart failure and that TNF- expresses in the failing myocardium.^{3 4} Previous studies have demonstrated that TNF- has direct negative inotropic effects on cardiac muscle cells.^{5 6} It has been suggested that TNF- may contribute to the progression of congestive heart failure. Indeed, recent studies have shown that transgenic mice with myocardial expression of TNF- develop a dilated cardiomyopathy and have documented a severe impairment of cardiac function.^{7 8} Although modulation of TNF- in cardiovascular diseases is a critical therapeutic strategy, the molecular mechanisms that regulate cardiac TNF- expression are unknown.

Peroxisome proliferator–activated receptors (PPARs) are transcription factors belonging to the nuclear receptor superfamily that heterodimerize with the retinoid X receptor and bind to specific response elements termed PPAR responsive elements (PPREs) in target gene promoters.⁹ PPARs have 3 isoforms, , ß (or ), and . PPAR regulates genes involved in the ß-oxidative degradation of fatty acids, whereas PPAR promotes adipocyte differentiation and glucose homeostasis. Hypolipidemic drugs (clofibrate, gemfibrozil, and Wy14643) are known to be ligands for PPAR.¹⁰ Natural prostaglandin D₂ metabolite, 15-deoxy-^12,14-prostaglandin J₂ (15d-PGJ₂), and synthetic antidiabetic thiazolidinedione (troglitazone and BRL49653) are identified as ligands for PPAR.¹¹ PPAR is present in liver, kidney, and muscle, whereas PPAR is expressed predominantly in adipose tissue.^{12 13 14} It was recently reported that PPAR activators inhibit inflammatory responses in aortic smooth muscle cells,¹⁵ whereas PPAR activators suppress production of inflammatory cytokines in activated macrophages.^{16 17} Therefore, we hypothesized that PPAR activators might regulate cardiac expression of TNF-. In the present study, we first examined the expressions of PPAR and PPAR in neonatal rat cardiac myocytes. We demonstrate that both PPAR and PPAR are expressed in the nuclei of cardiomyocytes. Furthermore, we investigated whether PPAR activators regulate lipopolysaccharide (LPS)–induced TNF- expression. Our results show that PPAR activators inhibit TNF- expression at the transcriptional level in part by preventing nuclear factor-B (NF-B) activity in cardiomyocytes.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Materials
Troglitazone, BRL49653, and gemfibrozil were generous gifts from Sankyo, SmithKline Beecham, and Parke-Davis, respectively. Wy14643 was purchased from Cayman Chemical. LPS was purchased from Sigma.

Cell Culture
Primary cultures of cardiac myocytes were prepared from ventricles of 1-day-old Wistar rats as described previously,¹⁸ basically according to the method of Simpson and Savion.¹⁹ Cardiomyocytes were plated at a field density of 1x10³ cells/mm² on 35- or 100-mm culture dishes (Falcon Primaria) and cultured in MEM containing 5% bovine calf serum.

RNA Extraction and Northern Blot Analysis
Total RNA was isolated by the guanidinium thiocyanate–phenol chloroform method, and 20 µg of total RNA was used in Northern blot analysis. The following cDNA fragments were used as probes: rat PPAR cDNA, murine PPAR1 cDNA, and murine TNF- cDNA.

Immunocytochemistry
To prove that cardiomyocytes express PPAR and PPAR, double staining was performed with goat polyclonal anti-PPAR or -PPAR antibody (Santa Cruz Biotechnology) and mouse monoclonal anti-cardiac troponin I antibody (generous gift from Dr N. Toyota, Chiba University). Proteins were visualized using secondary Cy3-conjugated anti-goat IgG and FITC-conjugated anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories). Substitution of the primary antibody with a normal goat IgG was used as control. Specificity of PPAR antibodies was checked by Western blot analysis.

Transient Transfection Assay
The reporter construct (PPRE)₃-TK-LUC was constructed by inserting 3 copies of the PPRE site from rat acyl-CoA oxidase promoter into the SalI site of the basal reporter construct TK-LUC, which contains a thymidine kinase promoter fused to a firefly luciferase gene.⁹ Cardiac myocytes were cotransfected with the reporter plasmid and pRL-SV40 control plasmid, which contains a Renilla luciferase gene, by the calcium phosphate method. At 6 hours after transfection, cells were washed with PBS, PPAR or PPAR activator was added in the medium, and cells were incubated further for 24 hours.

Measurement of TNF-
Cardiac myocytes were pretreated for 18 hours with various PPAR activators and stimulated with LPS from Escherichia coli 0127 (10 ng/mL) for 6 hours. At the end of the treatment period, the supernatants were collected, and the levels of TNF- were measured with a rat TNF- UltraSensitive ELISA kit (Biosource).

Electrophoretic Mobility Shift Assay (EMSA)
For EMSA, cardiac myocytes were pretreated with various PPAR activators for 23 hours before stimulation with LPS (10 ng/mL) for 1 hour. Nuclear extracts from cells were prepared as described previously.²⁰ Nuclear extracts (5 µg) were incubated with the ³²P-labeled NF-B consensus oligonucleotide (AGTTGAGGGGACTTTCCCAGGC) (Promega). Specificity was determined by addition of an excess of unlabeled NF-B oligonucleotide. Supershift analysis was performed by incubating nuclear extracts with anti-p50 or anti-p65 antibodies (catalogue Nos. sc-114X and sc-109X, respectively, Santa Cruz Biotechnology). EMSA was performed as described previously.²⁰

Statistical Analysis
Data are presented as mean±SEM. Statistical analysis was performed using 1-way ANOVA, and a Student t test was used to examine significance of difference in 2 groups.

A value of P<0.05 was considered to be statistically significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
PPAR and PPAR Are Expressed in Neonatal Rat Cardiac Myocytes
First, to investigate the expression of PPARs in rat cardiac myocytes, Northern blot analysis of total RNA isolated from neonatal rat cardiac myocytes was performed. Northern blot analysis demonstrated the presence of both PPAR and PPAR mRNAs in cardiac myocytes (Figure 1A). To identify the subcellular localization of PPAR and PPAR protein in cardiomyocytes, double staining with an antibody to cardiac troponin I, which specifically stains the cytoplasm of cardiac myocytes, and an antibody to PPAR or PPAR was performed. Immunostaining with troponin I antibody demonstrated that a routine preparation contains 90% to 95% cardiomyocytes, as described previously.¹⁸ Staining with PPAR antibody revealed immunoreactivity in the nuclei of myocytes (Figure 1B, a). Similar results were seen when staining with PPAR antibody was performed (Figure 1B, e). No immunoreactive PPAR or PPAR was detectable when normal goat IgG was used (Figure 1B, b and f). Western blot analysis was performed using PPAR and PPAR antibodies to determine the specificity of both antibodies (Figure 1C). Taken together, these data indicate that both PPAR and PPAR are expressed in rat cardiac myocytes.

View larger version (16K): [in this window] [in a new window]   Figure 1. PPAR and PPAR expression in neonatal rat cardiac myocytes. A, Northern blot showing PPAR and PPAR mRNA expression in cardiac myocytes. Rat cardiac myocytes were harvested 2 days after plating. Total RNA (20 µg) was loaded in each lane for Northern blot analysis. Blots were hybridized with a 32P-labeled PPAR or PPAR cDNA. Equal loading was confirmed by 28S and 18S ribosomal RNA density using ethidium bromide staining. B, Immunocytochemical staining with an antibody to PPAR (a) or PPAR (e) and an antibody to cardiac troponin I (c, d, g, and h). After fixation, cells were blocked with 1% BSA for 10 minutes and double stained with goat polyclonal anti-PPAR or PPAR antibody and mouse monoclonal anti-cardiac troponin I antibody overnight at 4°C. After washing with PBS, cells were incubated with secondary antibody for 2 hours at room temperature. Substitution of the primary antibody with a normal goat IgG was used as control (b and f). C, Western blot analysis using PPAR and PPAR antibodies to determine the specificity of the both antibodies.

PPAR Activators Induce Transcriptional Activity of Endogenous PPARs
Because PPARs are ligand-dependent transcription factors, we sought to determine whether endogenous PPARs are transcriptionally active in cardiac myocytes. Myocytes were transiently cotransfected with the (PPRE)₃-TK-LUC reporter plasmid and pRL-SV40 control plasmid and subsequently treated with PPAR (Wy14643 and gemfibrozil) or PPAR (BRL49653 and troglitazone) activator. After 24 hours, cells were harvested for assessment of luciferase activity. Both PPAR and PPAR activators increased luciferase activity (Figure 2). These results suggest that endogenous PPARs function as ligand-dependent transcription factors, which bind to PPRE.

View larger version (43K): [in this window] [in a new window]   Figure 2. Transcriptional activity of PPRE by PPAR and PPAR activator. Cardiac myocytes were transiently cotransfected by calcium phosphate method with the (PPRE)3-TK-LUC reporter plasmid and pRL-SV40 control (cont) plasmid in the presence or absence of PPAR activator (Wy14643 [Wy], 100 µmol/L; gemfibrozil [gem], 100 µmol/L) or PPAR activator (BRL49653 [BRL], 10 µmol/L; troglitazone [tro], 10 µmol/L) for 24 hours. Firefly luciferase activity was measured and normalized to Renilla luciferase activity. Results are expressed as multiples of induction compared with control cells and shown as mean±SEM. *P<0.05, **P<0.01 vs control (ANOVA, n=3).

PPAR Activators Inhibit LPS-Induced TNF- Production
Recently, it was reported that LPS (10 ng/mL, 6 hours) induces an increase in TNF- secretion by cardiomyocytes.²¹ Therefore, we examined the effects of PPAR activators on LPS-induced TNF- expression by ELISA. Cells were pretreated for 18 hours with various PPAR (Wy14643 and gemfibrozil) or PPAR (BRL49653 and troglitazone) activators and subsequently stimulated with LPS for 6 hours. As previously described,²¹ LPS (10 ng/mL, 6 hours) significantly induced TNF- production (116.6±10.7 pg/mL) (Figure 3A). All PPAR activators significantly inhibited LPS-induced TNF- expression (Figure 3A). However, when myocytes were exposed to PPAR activators at the time of or after LPS stimulation, TNF- expression was not inhibited (data not shown). These changes were not due to cell death because cellular protein content was equal in each sample and myocyte beating appeared the same. Similarly, 15d-PGJ₂, which is known as a ligand for PPAR, inhibited LPS-induced TNF- expression (data not shown). Although 15d-PGJ₂ has been suggested to inhibit the production of inflammatory cytokines through the activation of PPAR, recent study has shown that 15d-PGJ₂ exerts a direct inhibitory effect on the activity of the inhibitor of nuclear factor-B (IB) kinase.²² As IB kinase is responsible for NF-B activation and TNF- production, there is a possibility that 15d-PGJ₂ may regulate TNF- production, independent of PPAR activation. Therefore, we used both BRL49653 and troglitazone as PPAR activators to examine whether PPAR activators inhibit TNF- expression. These data indicate that both PPAR and PPAR activators decrease LPS-induced TNF- production in cardiomyocytes.

View larger version (28K): [in this window] [in a new window]   Figure 3. Effects of PPAR activators on LPS-induced TNF- expression. A, Cardiac myocytes were pretreated for 18 hours with PPAR activator (Wy14643, 10, 100, and 200 µmol/L; gemfibrozil, 10, 100, and 200 µmol/L) or PPAR activator (BRL49653, 0.1, 1, and 10 µmol/L; troglitazone, 1, 10, and 20 µmol/L). Cells were subsequently stimulated with LPS (10 ng/mL) for 6 hours. Levels of TNF- in supernatants were measured by ELISA. Results are shown as mean±SEM. *P<0.05, **P<0.01 vs LPS-stimulated cells (ANOVA, n=3). B, Northern blot showing TNF- mRNA expression in cardiac myocytes. a, Cells were stimulated with LPS (10 ng/mL) for the indicated times (0, 0.5, 1, 3, 6, and 12 hours). b and c, Cells were pretreated with Wy14643 (50 and 250 µmol/L) (b) or BRL49653 (1 and 10 µmol/L) (c) for 23 hours and subsequently stimulated with LPS (10 ng/mL) for 1 hour. Total RNA (20 µg) was assayed. Equal loading was confirmed by 18S ribosomal RNA density using ethidium bromide staining. Results are representative of 3 independent experiments.

PPAR Activators Repress LPS-Induced TNF- mRNA Expression
Northern blot analysis demonstrated increased TNF- mRNA after stimulation of cardiac myocytes with LPS (10 ng/mL) for the indicated times (Figure 3B, a). TNF- mRNA level started to increase 30 minutes after stimulation with LPS, peaked at 1 hour, and decreased gradually thereafter (Figure 3B, a). We next examined whether PPAR activators regulate LPS-induced TNF- mRNA expression in myocytes. Cells were pretreated with PPAR (Wy14643) or PPAR (BRL49653) (Figure 3B, b and c) activator for 23 hours and were subsequently stimulated with LPS (10 ng/mL) for 1 hour. Both PPAR activators inhibit LPS-induced TNF- mRNA expression in cardiac myocytes. These results indicate that both PPAR and PPAR activators inhibit LPS-induced TNF- production at the mRNA level.

PPAR Activators Reduce LPS-Induced NF-B Activation
TNF- transcription is regulated by transcription factor binding sites present within the TNF- promoter. It has been reported that LPS induction of TNF- promoter activity is dependent on NF-B binding sites and that LPS treatment of macrophages stimulates the nuclear translocation of NF-B.^{23 24} Therefore, we performed EMSAs to investigate whether PPAR activators inhibit NF-B activation in cardiac myocytes. Specificity of DNA-binding complexes was assessed in competition experiments by adding an excess of unlabeled NF-B oligonucleotide to incubation mixtures. Characterization of NF-B was performed by incubating nuclear extracts with antibodies directed against p50 and p65 subunits. Stimulation of cells with LPS (10 ng/mL) led to an increase in NF-B binding activity reaching a plateau between 60 and 120 minutes (Figure 4A). Cells were pretreated with various PPAR activators for 23 hours before LPS (10 ng/mL) stimulation for 1 hour. Both PPAR and PPAR activators reduced LPS-induced increase in NF-B binding activity (Figures 4B and 4C). In the presence of excess consensus, the shifted band was abrogated. On the addition of anti-p50 or p65 antibody, the band was supershifted, thus showing that these incubation mixtures contained NF-B. These results suggest that PPARs inhibit TNF- gene expression in part by antagonizing the binding activity of NF-B in cardiomyocytes.

View larger version (73K): [in this window] [in a new window]   Figure 4. Effects of PPAR activators on LPS-induced NF-B activation. A, EMSA of cardiac myocytes stimulated with LPS (10 ng/mL) for the indicated times (0, 15, 30, 45, 60, and 120 minutes). Nuclear extracts (5 µg) from cardiac myocytes were incubated with the 32P-labeled NF-B consensus oligonucleotide. B, EMSA of cardiac myocytes stimulated with LPS (10 ng/mL) for 1 hour in the presence of Wy14643 (50 and 250 µmol/L). C, EMSA of cardiac myocytes stimulated with LPS (10 ng/mL) for 1 hour in the presence of BRL49653 (1 and 10 µmol/L). Nuclear extracts (5 µg) from cardiac myocytes were incubated with the 32P-labeled NF-B consensus oligonucleotide. Specificity was assessed by addition of unlabeled NF-B oligonucleotide (cold probe). Supershift analysis was performed by incubating nuclear extracts with antibodies directed against p50 or p65 subunit of NF-B. Similar results were obtained from 3 independent experiments.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
The present study demonstrates the expression of both PPAR and PPAR in neonatal rat cardiac myocytes. Furthermore, we show that LPS induces TNF- secretion by cardiac myocytes. This result is consistent with previous reports showing TNF- secretion by neonatal mouse or neonatal rat cardiomyocytes after exposure to LPS.^{21 25} Both PPAR and PPAR activators inhibit LPS-induced expression of TNF- in myocytes at the mRNA level. Finally, we demonstrate that PPAR activators inhibit TNF- gene expression, at least in part, by antagonizing the binding activity of NF-B in cardiac myocytes.

It has been reported that PPAR is present in liver, kidney, and muscle, whereas PPAR is expressed predominantly in adipose tissue.¹³ Previous studies have examined the expression of PPARs in heart by RNase protection assay, reverse transcription-polymerase chain reaction, or in situ hybridization.^{12 13 14} These results have shown that PPAR is expressed in variable amounts between individuals, whereas PPAR is expressed at a low level, in adult rat or adult human heart. Our results demonstrate the expression of both PPAR and PPAR by Northern blot analysis of total RNA from neonatal rat cardiac myocytes. Recently, it was reported that PPAR activators inhibit the inflammatory responses in aortic smooth muscle cells by negatively regulating NF-B transcriptional activity¹⁵ and that PPAR activators suppress production of inflammatory cytokines in macrophages by antagonizing the activities of activator protein-1 (AP-1), signal transducers and activators of transcription (STAT), and NF-B.¹⁶ Our results suggest that both PPAR and PPAR are involved in the regulation of proinflammatory cytokine TNF- in cardiac myocytes.

Because LPS has been shown to induce TNF- production in macrophages or cardiomyocytes,^{21 23 24 25} we stimulated neonatal rat myocytes in the same way. Regulation of TNF- transcription is conferred by transcription factor binding sites present within TNF- promoter. It has been reported that LPS-induced increase in TNF- promoter activity occurs by activation of the NF-B signaling pathway and is dependent on NF-B binding sites.^{23 24} Therefore, we examined whether PPAR activators exert their effects on TNF- gene transcription by preventing the binding activity of NF-B. Our results from EMSAs showing that PPAR activators reduce LPS-induced increase in NF-B binding activity suggest that both PPAR and PPAR activators inhibit expression of TNF-, at least in part, by antagonizing NF-B binding activity. However, the molecular mechanism by which PPARs interfere with NF-B binding to the TNF- promoter is unknown. Recently, several lines of evidence have implicated the functional significance of interaction between nuclear receptors and coactivators in transcriptional activation. cAMP response element binding protein (CREB)-binding protein (CBP)/p300 is a transcriptional coactivator of PPAR, PPAR, and NF-B.^{26 27 28} Steroid receptor coactivator-1 (SRC-1) also functions as a coactivator for PPAR and NF-B.^{29 30} These observations raise the possibility that nuclear competition for limiting amounts of CBP/p300 or SRC-1 may occur between PPARs and NF-B. Our data do not exclude the participation of coactivators in the inhibition of NF-B activity by PPAR activators.

Previous studies have reported that the levels of circulating TNF- are elevated in patients with congestive heart failure and that TNF- expresses in the failing heart.^{2 3 4} In addition, overexpression of TNF- in heart led to a phenotype characterized by dilated cardiomyopathy.^{7 8} It has been suggested that TNF- may contribute to the progression of heart failure. Therefore, the results of the present study suggest that PPAR activators may prevent the development of congestive heart failure by inhibiting TNF- expression. Although it is known that other cytokines such as interleukin-1ß, interleukin-2, and interleukin-6 are also involved in the pathogenesis of congestive heart failure, the effects on expression of other cytokines by PPAR activators remain to be determined. Because our study uses only LPS to induce TNF- production in cardiac myocytes, whether PPAR activators attenuate TNF- expression in congestive heart failure in vivo is not yet understood. More studies are necessary to characterize the effects of PPAR activators on the development of heart failure in vivo.

PPAR activator gemfibrozil has been shown to reduce coronary events and improve plasma lipid levels. Gemfibrozil may prevent the critical inflammatory processes not only in atherosclerosis but also in heart failure. PPAR activator troglitazone has been shown to reduce insulin resistance associated with obesity, hypertension, and impaired glucose tolerance in humans. Because it is known that diabetic cardiomyopathy, which is a major complication of diabetes, is characterized by systolic and diastolic dysfunctions, troglitazone appears to be beneficial to cardiac function impairment in patients with diabetes mellitus. It has been reported that high rates of fatty acid oxidation after ischemia decrease cardiac function during reperfusion.³¹ Excessive rates of fatty acid oxidation inhibit glucose oxidation and cause an uncoupling between glycolysis and glucose oxidation, resulting in an increase in the production of protons from glycolytically derived ATP.³¹ Therefore, the production of protons appears to be an important contributor to the impaired recovery of reperfused ischemic heart. Although PPAR activators stimulate the oxidation of fatty acid, it remains to be determined whether PPAR activators induce the same mechanism. Williams et al³² reported that T-174 (LY282449), a PPAR activator, induces cardiac hypertrophy in rats. However, we recently found that pioglitazone, also a PPAR activator, inhibits the pressure overload–induced cardiac hypertrophy and that pressure overload induces more prominent cardiac hypertrophy in heterozygous PPAR-deficient (PPAR +/-) mice than in wild-type mice (M. Asakawa et al, unpublished data, 2000). Therefore, PPAR activators may also be useful in the treatment of cardiac hypertrophy. Recent studies have demonstrated that both PPAR and PPAR are implicated in the pathogenesis of atherosclerosis.^{33 34 35}

In conclusion, we demonstrate that PPAR activators inhibit LPS-induced TNF- expression in cardiac myocytes. Given the involvement of TNF- in the pathogenesis of heart failure, our findings suggest that PPARs may play a critical role in inflammatory response in heart failure. Further studies should continue to elucidate the role of PPARs in other TNF-–related cardiovascular diseases, such as ischemia-reperfusion, myocardial infarction, myocarditis, and dilated cardiomyopathy.

	Acknowledgments

 
We thank Dr N. Toyota (Chiba University) for providing anti-cardiac troponin I antibody, Dr K. Umesono (Kyoto University, Japan) for (PPRE)₃-TK-LUC reporter plasmid, Dr M. Sakai (Hokkaido University, Japan) for PPAR cDNA probe, Dr T. Osumi (Himeji Institute of Technology, Japan) for PPAR1 cDNA probe, and Dr K. Yamada (Kurume University, Japan) for TNF- cDNA probe.

Received August 11, 2000; accepted August 22, 2000.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Neumann FJ, Ott I, Gawaz M, Richardt G, Holzapfel H, Jochum M, Schomig A. Cardiac release of cytokines and inflammatory responses in acute myocardial infarction. Circulation. 1995;92:748–755.[Abstract/Free Full Text]

2. Matsumori A, Yamada T, Suzuki H, Matoba Y, Sasayama S. Increased circulating cytokines in patients with myocarditis and cardiomyopathy. Br Heart J. 1994;72:561–566.[Abstract/Free Full Text]

3. Levine B, Kalman J, Mayer L, Fillit HM, Packer M. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med. 1990;323:236–241.[Abstract]

4. Torre-Amione G, Kapadia S, Lee J, Durand JB, Bies RD, Young JB, Mann DL. Tumor necrosis factor- and tumor necrosis factor receptors in the failing human heart. Circulation. 1996;93:704–711.[Abstract/Free Full Text]

5. Finkel MS, Oddis CV, Jacob TD, Watkins SC, Hattler BG, Simmons RL. Negative inotropic effects of cytokines on the heart mediated by nitric oxide. Science. 1992;257:387–389.[Abstract/Free Full Text]

6. Yokoyama T, Vaca L, Rossen RD, Durante W, Hazarika P, Mann DL. Cellular basis for the negative inotropic effects of tumor necrosis factor- in the adult mammalian heart. J Clin Invest. 1993;92:2303–2312.

7. Kubota T, McTiernan CF, Frye CS, Slawson SE, Lemster BH, Koretsky AP, Demetris AJ, Feldman AM. Dilated cardiomyopathy in transgenic mice with cardiac-specific overexpression of tumor necrosis factor-. Circ Res. 1997;81:627–635.[Abstract/Free Full Text]

8. Bryant D, Becker L, Richardson J, Shelton J, Franco F, Peshock R, Thompson M, Giroir B. Cardiac failure in transgenic mice with myocardial expression of tumor necrosis factor-. Circulation. 1998;97:1375–1381.[Abstract/Free Full Text]

9. Kliewer SA, Umesono K, Noonan DJ, Heyman RA, Evans RM. Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature. 1992;358:771–774.[Medline] [Order article via Infotrieve]

10. Forman BM, Chen J, Evans RM. Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors and . Proc Natl Acad Sci U S A. 1997;94:4312–4317.[Abstract/Free Full Text]

11. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM. 15-Deoxy-^12,14-prostaglandin J₂ is a ligand for the adipocyte determination factor PPAR. Cell. 1995;83:803–812.[Medline] [Order article via Infotrieve]

12. Mukherjee R, Jow L, Noonan D, McDonnell DP. Human and rat peroxisome proliferator activated receptors (PPARs) demonstrate similar tissue distribution but different responsiveness to PPAR activators. J Steroid Biochem Mol Biol. 1994;51:157–166.[Medline] [Order article via Infotrieve]

13. Braissant O, Foufelle F, Scotto C, Dauca M, Wahli W. Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-, -ß, and - in the adult rat. Endocrinology. 1996;137:354–366.[Abstract]

14. Cullingford TE, Bhakoo K, Peuchen S, Dolphin CT, Patel R, Clark JB. Distribution of mRNAs encoding the peroxisome proliferator-activated receptor , ß, and and the retinoid X receptor , ß, and in rat central nervous system. J Neurochem. 1998;70:1366–1375.[Medline] [Order article via Infotrieve]

15. Staels B, Koenig W, Habib A, Merval R, Lebret M, Torra IP, Delerive P, Fadel A, Chinetti G, Fruchart JC, Najib J, Maclouf J, Tedgui A. Activation of human aortic smooth-muscle cells is inhibited by PPAR but not by PPAR activators. Nature. 1998;393:790–793.[Medline] [Order article via Infotrieve]

16. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK. The peroxisome proliferator-activated receptor- is a negative regulator of macrophage activation. Nature. 1998;391:79–82.[Medline] [Order article via Infotrieve]

17. Jiang C, Ting AT, Seed B. PPAR- agonists inhibit production of monocyte inflammatory cytokines. Nature. 1998;391:82–86.[Medline] [Order article via Infotrieve]

18. Komuro I, Kaida T, Shibazaki Y, Kurabayashi M, Takaku F, Yazaki Y. Stretching cardiac myocytes stimulates proto-oncogene expression. J Biol Chem. 1990;265:3595–3598.[Abstract/Free Full Text]

19. Simpson P, Savion S. Differentiation of rat myocytes in single cell cultures with and without proliferating nonmyocardial cells. Circ Res. 1982;50:101–116.[Free Full Text]

20. Norman DA, Yacoub MH, Barton PJ. Nuclear factor NF-B in myocardium: developmental expression of subunits and activation by interleukin-1ß in cardiac myocytes in vitro. Cardiovasc Res. 1998;39:434–441.[Abstract/Free Full Text]

21. Wagner DR, Combes A, McTiernan C, Sanders VJ, Lemster B, Feldman AM. Adenosine inhibits lipopolysaccharide-induced cardiac expression of tumor necrosis factor-. Circ Res. 1998;82:47–56.[Abstract/Free Full Text]

22. Rossi A, Kapahi P, Natoli G, Takahashi T, Chen Y, Karin M, Santoro MG. Anti-inflammatory cyclopentenone prostaglandins are direct inhibitors of IB kinase. Nature. 2000;403:103–108.[Medline] [Order article via Infotrieve]

23. Shakhov AN, Collart MA, Vassalli P, Nedospasov SA, Jongeneel CV. B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor gene in primary macrophages. J Exp Med. 1990;171:35–47.[Abstract/Free Full Text]

24. Swantek JL, Christerson L, Cobb MH. Lipopolysaccharide-induced tumor necrosis factor- promoter activity is inhibitor of nuclear factor-B kinase-dependent. J Biol Chem. 1999;274:11667–11671.[Abstract/Free Full Text]

25. Giroir BP, Johnson JH, Brown T, Allen GL, Beutler B. The tissue distribution of tumor necrosis factor biosynthesis during endotoxemia. J Clin Invest. 1992;90:693–698.

26. Dowell P, Ishmael JE, Avram D, Peterson VJ, Nevrivy DJ, Leid M. p300 functions as a coactivator for the peroxisome proliferator-activated receptor . J Biol Chem. 1997;272:33435–33443.[Abstract/Free Full Text]

27. Mizukami J, Taniguchi T. The antidiabetic agent thiazolidinedione stimulates the interaction between PPAR and CBP. Biochem Biophys Res Commun. 1997;240:61–64.[Medline] [Order article via Infotrieve]

28. Gerritsen ME, Williams AJ, Neish AS, Moore S, Shi Y, Collins T. CREB-binding protein/p300 are transcriptional coactivators of p65. Proc Natl Acad Sci U S A. 1997;94:2927–2932.[Abstract/Free Full Text]

29. Sheppard KA, Phelps KM, Williams AJ, Thanos D, Glass CK, Rosenfeld MG, Gerritsen ME, Collins T. Nuclear integration of glucocorticoid receptor and nuclear factor-B signaling by CREB-binding protein and steroid receptor coactivator-1. J Biol Chem. 1998;273:29291–29294.[Abstract/Free Full Text]

30. Zhu Y, Qi C, Calandra C, Rao MS, Reddy JK. Cloning and identification of mouse steroid receptor coactivator-1 (mSRC-1), as a coactivator of peroxisome proliferator activated receptor . Gene Expr. 1996;6:185–195.[Medline] [Order article via Infotrieve]

31. Lopaschuk GD, Belke DD, Gamble J, Itoi T, Schonekess BO. Regulation of fatty acid oxidation in the mammalian heart in health and disease. Biochim Biophys Acta. 1994;1213:263–276.[Medline] [Order article via Infotrieve]

32. Williams GD, Deldar A, Jordan WH, Gries C, Long GG, Dimarchi RD. Subchronic toxicity of the thiazolidinedione, Tanabe-174 (LY282449), in the rat and dog. Diabetes. 1993;42(suppl):59A.

33. Marx N, Schonbeck U, Lazar MA, Libby P, Plutzky J. Peroxisome proliferator-activated receptor activators inhibit gene expression and migration in human vascular smooth muscle cells. Circ Res. 1998;83:1097–1103.[Abstract/Free Full Text]

34. Marx N, Sukhova GK, Collins T, Libby P, Plutzky J. PPAR activators inhibit cytokine-induced vascular cell adhesion molecule-1 expression in human endothelial cells. Circulation. 1999;99:3125–3131.[Abstract/Free Full Text]

35. Delerive P, Martin-Nizard F, Chinetti G, Trottein F, Fruchart JC, Najib J, Duriez P, Staels B. Peroxisome proliferator-activated receptor activators inhibit thrombin-induced endothelin-1 production in human vascular endothelial cells by inhibiting the activator protein-1 signaling pathway. Circ Res. 1999;85:394–402.[Abstract/Free Full Text]

This article has been cited by other articles:

				M. K. Duda, K. M. O'Shea, and W. C. Stanley {omega}-3 polyunsaturated fatty acid supplementation for the treatment of heart failure: mechanisms and clinical potential Cardiovasc Res, October 1, 2009; 84(1): 33 - 41. [Abstract] [Full Text] [PDF]

				C. Pellieux, C. Montessuit, I. Papageorgiou, and R. Lerch Angiotensin II downregulates the fatty acid oxidation pathway in adult rat cardiomyocytes via release of tumour necrosis factor-{alpha} Cardiovasc Res, May 1, 2009; 82(2): 341 - 350. [Abstract] [Full Text] [PDF]

				M. B. Schaefer, A. Pose, J. Ott, M. Hecker, A. Behnk, R. Schulz, N. Weissmann, A. Gunther, W. Seeger, and K. Mayer Peroxisome proliferator-activated receptor-{alpha} reduces inflammation and vascular leakage in a murine model of acute lung injury Eur. Respir. J., November 1, 2008; 32(5): 1344 - 1353. [Abstract] [Full Text] [PDF]

				P. J. H. Smeets, B. E. J. Teunissen, A. Planavila, H. de Vogel-van den Bosch, P. H. M. Willemsen, G. J. van der Vusse, and M. van Bilsen Inflammatory Pathways Are Activated during Cardiomyocyte Hypertrophy and Attenuated by Peroxisome Proliferator-activated Receptors PPAR{alpha} and PPAR{delta} J. Biol. Chem., October 24, 2008; 283(43): 29109 - 29118. [Abstract] [Full Text] [PDF]

				T. Doi, T. Sakoda, T. Akagami, T. Naka, Y. Mori, T. Tsujino, T. Masuyama, and M. Ohyanagi Aldosterone induces interleukin-18 through endothelin-1, angiotensin II, Rho/Rho-kinase, and PPARs in cardiomyocytes Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H1279 - H1287. [Abstract] [Full Text] [PDF]

				C. P. Alibin, M. A. Kopilas, and H. D. I. Anderson Suppression of Cardiac Myocyte Hypertrophy by Conjugated Linoleic Acid: ROLE OF PEROXISOME PROLIFERATOR-ACTIVATED RECEPTORS {alpha} AND {gamma} J. Biol. Chem., April 18, 2008; 283(16): 10707 - 10715. [Abstract] [Full Text] [PDF]

				P. J.H. Smeets, B. E.J. Teunissen, P. H.M. Willemsen, F. A. van Nieuwenhoven, A. E. Brouns, B. J.A. Janssen, J. P.M. Cleutjens, B. Staels, G. J. van der Vusse, and M. van Bilsen Cardiac hypertrophy is enhanced in PPAR{alpha}-/- mice in response to chronic pressure overload Cardiovasc Res, April 1, 2008; 78(1): 79 - 89. [Abstract] [Full Text] [PDF]

				D. Aguilar, B. Bozkurt, A. Pritchett, N. J. Petersen, and A. Deswal The Impact of Thiazolidinedione Use on Outcomes in Ambulatory Patients With Diabetes Mellitus and Heart Failure J. Am. Coll. Cardiol., July 3, 2007; 50(1): 32 - 36. [Abstract] [Full Text] [PDF]

				A. Guellich, T. Damy, Y. Lecarpentier, M. Conti, V. Claes, J.-L. Samuel, J. Quillard, J.-L. Hebert, T. Pineau, and C. Coirault Role of oxidative stress in cardiac dysfunction of PPAR{alpha}-/- mice Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H93 - H102. [Abstract] [Full Text] [PDF]

				M. Yano, T. Matsumura, T. Senokuchi, N. Ishii, Y. Murata, K. Taketa, H. Motoshima, T. Taguchi, K. Sonoda, D. Kukidome, et al. Statins Activate Peroxisome Proliferator-Activated Receptor {gamma} Through Extracellular Signal-Regulated Kinase 1/2 and p38 Mitogen-Activated Protein Kinase-Dependent Cyclooxygenase-2 Expression in Macrophages Circ. Res., May 25, 2007; 100(10): 1442 - 1451. [Abstract] [Full Text] [PDF]

				B. N. Finck The PPAR regulatory system in cardiac physiology and disease Cardiovasc Res, January 15, 2007; 73(2): 269 - 277. [Abstract] [Full Text] [PDF]

				Z. T. Bloomgarden Third Annual World Congress on the Insulin Resistance Syndrome: Atherothrombotic disease Diabetes Care, August 1, 2006; 29(8): 1973 - 1980. [Full Text] [PDF]

				S. Cuzzocrea, E. Mazzon, R. Di Paola, A. Peli, A. Bonato, D. Britti, T. Genovese, C. Muia, C. Crisafulli, and A. P. Caputi The role of the peroxisome proliferator-activated receptor-{alpha} (PPAR-{alpha}) in the regulation of acute inflammation J. Leukoc. Biol., May 1, 2006; 79(5): 999 - 1010. [Abstract] [Full Text] [PDF]

				D. Gomez-Garre, M. Herraiz, M. L. Gonzalez-Rubio, R. Bernal, P. Aragoncillo, A. Carbonell, J. J. Rufilanchas, and A. Fernandez-Cruz Activation of peroxisome proliferator-activated receptor-{alpha} and -{gamma} in auricular tissue from heart failure patients Eur J Heart Fail, March 1, 2006; 8(2): 154 - 161. [Abstract] [Full Text] [PDF]

				R. Lautamaki, K.E. J. Airaksinen, M. Seppanen, J. Toikka, M. Luotolahti, E. Ball, R. Borra, R. Harkonen, P. Iozzo, M. Stewart, et al. Rosiglitazone Improves Myocardial Glucose Uptake in Patients With Type 2 Diabetes and Coronary Artery Disease: A 16-Week Randomized, Double-Blind, Placebo-Controlled Study Diabetes, September 1, 2005; 54(9): 2787 - 2794. [Abstract] [Full Text] [PDF]

				Z Yuan, Y Liu, Y Liu, J Zhang, C Kishimoto, Y Wang, A Ma, and Z Liu Cardioprotective effects of peroxisome proliferator activated receptor {gamma} activators on acute myocarditis: anti-inflammatory actions associated with nuclear factor {kappa}B blockade Heart, September 1, 2005; 91(9): 1203 - 1208. [Abstract] [Full Text] [PDF]

				A. Planavila, J. C. Laguna, and M. Vazquez-Carrera Nuclear Factor-{kappa}B Activation Leads to Down-regulation of Fatty Acid Oxidation during Cardiac Hypertrophy J. Biol. Chem., April 29, 2005; 280(17): 17464 - 17471. [Abstract] [Full Text] [PDF]

				A. Planavila, R. Rodriguez-Calvo, M. Jove, L. Michalik, W. Wahli, J. C. Laguna, and M. Vazquez-Carrera Peroxisome proliferator-activated receptor {beta}/{delta} activation inhibits hypertrophy in neonatal rat cardiomyocytes Cardiovasc Res, March 1, 2005; 65(4): 832 - 841. [Abstract] [Full Text] [PDF]

				E. L. Schiffrin Peroxisome proliferator-activated receptors and cardiovascular remodeling Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1037 - H1043. [Abstract] [Full Text] [PDF]

				Y. Xu, M. Gen, L. Lu, J. Fox, S. O. Weiss, R. D. Brown, D. Perlov, H. Ahmad, P. Zhu, C. Greyson, et al. PPAR-{gamma} activation fails to provide myocardial protection in ischemia and reperfusion in pigs Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1314 - H1323. [Abstract] [Full Text] [PDF]

				H. Akazawa, S. Komazaki, H. Shimomura, F. Terasaki, Y. Zou, H. Takano, T. Nagai, and I. Komuro Diphtheria Toxin-induced Autophagic Cardiomyocyte Death Plays a Pathogenic Role in Mouse Model of Heart Failure J. Biol. Chem., September 24, 2004; 279(39): 41095 - 41103. [Abstract] [Full Text] [PDF]

				S. Srinivasan, M. E. Hatley, K. B. Reilly, E. C. Danziger, and C. C. Hedrick Modulation of PPAR{alpha} Expression and Inflammatory Interleukin-6 Production by Chronic Glucose Increases Monocyte/Endothelial Adhesion Arterioscler Thromb Vasc Biol, May 1, 2004; 24(5): 851 - 857. [Abstract] [Full Text]

				H. D. I. Anderson, F. Wang, and D. G. Gardner Role of the Epidermal Growth Factor Receptor in Signaling Strain-dependent Activation of the Brain Natriuretic Peptide Gene J. Biol. Chem., March 5, 2004; 279(10): 9287 - 9297. [Abstract] [Full Text] [PDF]

				I. E. Konstantinov, J. G. Coles, C. Boscarino, M. Takahashi, J. Goncalves, J. Ritter, and G. S. Van Arsdell Gene expression profiles in children undergoing cardiac surgery for right heart obstructive lesions J. Thorac. Cardiovasc. Surg., March 1, 2004; 127(3): 746 - 754. [Abstract] [Full Text] [PDF]

				K. Asada, S. Sasaki, T. Suda, K. Chida, and H. Nakamura Antiinflammatory Roles of Peroxisome Proliferator-activated Receptor {gamma} in Human Alveolar Macrophages Am. J. Respir. Crit. Care Med., January 15, 2004; 169(2): 195 - 200. [Abstract] [Full Text] [PDF]

				M. R. Mehrabi, P. Haslmayer, S. Humpeler, G. Strauss-Blasche, W. Marktl, F. Tamaddon, N. Serbecic, G. Wieselthaler, T. Thalhammer, H. D. Glogar, et al. Quantitative analysis of peroxisome proliferator-activated receptor gamma (PPAR{gamma}) expression in arteries and hearts of patients with ischaemic or dilated cardiomyopathy Eur J Heart Fail, December 1, 2003; 5(6): 733 - 739. [Abstract] [Full Text] [PDF]

				E. L. Schiffrin, F. Amiri, K. Benkirane, M. Iglarz, and Q. N. Diep Peroxisome Proliferator-Activated Receptors: Vascular and Cardiac Effects in Hypertension Hypertension, October 1, 2003; 42(4): 664 - 668. [Abstract] [Full Text] [PDF]

				A. Cabrero, M. Jove, A. Planavila, M. Merlos, J. C. Laguna, and M. Vazquez-Carrera Down-Regulation of Acyl-CoA Oxidase Gene Expression in Heart of Troglitazone-Treated Mice through a Mechanism Involving Chicken Ovalbumin Upstream Promoter Transcription Factor II Mol. Pharmacol., September 1, 2003; 64(3): 764 - 772. [Abstract] [Full Text] [PDF]

				F. Liang, F. Wang, S. Zhang, and D. G. Gardner Peroxisome Proliferator Activated Receptor (PPAR){alpha} Agonists Inhibit Hypertrophy of Neonatal Rat Cardiac Myocytes Endocrinology, September 1, 2003; 144(9): 4187 - 4194. [Abstract] [Full Text] [PDF]

				Z. Yuan, Y. Liu, Y. Liu, J. Zhang, C. Kishimoto, Y. Wang, A. Ma, and Z. Liu Peroxisome proliferation-activated receptor-{gamma} ligands ameliorate experimental autoimmune myocarditis Cardiovasc Res, September 1, 2003; 59(3): 685 - 694. [Abstract] [Full Text] [PDF]

				C. A Lygate, K. Hulbert, M. Monfared, M. A Cole, K. Clarke, and S. Neubauer The PPAR{gamma}-activator rosiglitazone does not alter remodeling but increases mortality in rats post-myocardial infarction Cardiovasc Res, June 1, 2003; 58(3): 632 - 637. [Abstract] [Full Text] [PDF]

				Y. Xu, L. Lu, C. Greyson, J. Lee, M. Gen, K. Kinugawa, C. S. Long, and G. G. Schwartz Deleterious Effects of Acute Treatment With a Peroxisome Proliferator-Activated Receptor-{gamma} Activator in Myocardial Ischemia and Reperfusion in Pigs Diabetes, May 1, 2003; 52(5): 1187 - 1194. [Abstract] [Full Text] [PDF]

				A. J. Gilde, K. A.J.M. van der Lee, P. H.M. Willemsen, G. Chinetti, F. R. van der Leij, G. J. van der Vusse, B. Staels, and M. van Bilsen Peroxisome Proliferator-Activated Receptor (PPAR) {alpha} and PPAR{beta}/{delta}, but not PPAR{gamma}, Modulate the Expression of Genes Involved in Cardiac Lipid Metabolism Circ. Res., March 21, 2003; 92(5): 518 - 524. [Abstract] [Full Text] [PDF]

				C.-H. Wang, R. D. Weisel, P. P. Liu, P. W.M. Fedak, and S. Verma Glitazones and Heart Failure: Critical Appraisal for the Clinician Circulation, March 18, 2003; 107(10): 1350 - 1354. [Full Text] [PDF]

				T. Shiomi, H. Tsutsui, S. Hayashidani, N. Suematsu, M. Ikeuchi, J. Wen, M. Ishibashi, T. Kubota, K. Egashira, and A. Takeshita Pioglitazone, a Peroxisome Proliferator-Activated Receptor-{gamma} Agonist, Attenuates Left Ventricular Remodeling and Failure After Experimental Myocardial Infarction Circulation, December 10, 2002; 106(24): 3126 - 3132. [Abstract] [Full Text] [PDF]

				M. Lappas, M. Permezel, H. M. Georgiou, and G. E. Rice Regulation of Proinflammatory Cytokines in Human Gestational Tissues by Peroxisome Proliferator-Activated Receptor-{gamma}: Effect of 15-Deoxy-{Delta}12,14-PGJ2 and Troglitazone J. Clin. Endocrinol. Metab., October 1, 2002; 87(10): 4667 - 4672. [Abstract] [Full Text] [PDF]

				J. C. Osorio, W. C. Stanley, A. Linke, M. Castellari, Q. N. Diep, A. R. Panchal, T. H. Hintze, G. D. Lopaschuk, and F. A. Recchia Impaired Myocardial Fatty Acid Oxidation and Reduced Protein Expression of Retinoid X Receptor-{alpha} in Pacing-Induced Heart Failure Circulation, July 30, 2002; 106(5): 606 - 612. [Abstract] [Full Text] [PDF]

				M. Fu, J. Zhang, Y. Lin, X. Zhu, M. U. Ehrengruber, and Y. E. Chen Early Growth Response Factor-1 Is a Critical Transcriptional Mediator of Peroxisome Proliferator-activated Receptor-gamma 1 Gene Expression in Human Aortic Smooth Muscle Cells J. Biol. Chem., July 19, 2002; 277(30): 26808 - 26814. [Abstract] [Full Text] [PDF]

				N. Khandoudi, P. Delerive, I. Berrebi-Bertrand, R. E. Buckingham, B. Staels, and A. Bril Rosiglitazone, a Peroxisome Proliferator-Activated Receptor-{gamma}, Inhibits the Jun NH2-Terminal Kinase/Activating Protein 1 Pathway and Protects the Heart From Ischemia/Reperfusion Injury Diabetes, May 1, 2002; 51(5): 1507 - 1514. [Abstract] [Full Text] [PDF]

				M.-A. Simonin, K. Bordji, S. Boyault, A. Bianchi, E. Gouze, P. Becuwe, M. Dauca, P. Netter, and B. Terlain PPAR-gamma ligands modulate effects of LPS in stimulated rat synovial fibroblasts Am J Physiol Cell Physiol, January 1, 2002; 282(1): C125 - C133. [Abstract] [Full Text] [PDF]

				T.-l. Yue, J. Chen, W. Bao, P. K. Narayanan, A. Bril, W. Jiang, P. G. Lysko, J.-L. Gu, R. Boyce, D. M. Zimmerman, et al. In Vivo Myocardial Protection From Ischemia/Reperfusion Injury by the Peroxisome Proliferator-Activated Receptor-{gamma} Agonist Rosiglitazone Circulation, November 20, 2001; 104(21): 2588 - 2594. [Abstract] [Full Text] [PDF]

				K. Yamamoto, R. Ohki, R. T. Lee, U. Ikeda, and K. Shimada Peroxisome Proliferator-Activated Receptor {gamma} Activators Inhibit Cardiac Hypertrophy in Cardiac Myocytes Circulation, October 2, 2001; 104(14): 1670 - 1675. [Abstract] [Full Text] [PDF]

				M. Asakawa, H. Takano, T. Nagai, H. Uozumi, H. Hasegawa, N. Kubota, T. Saito, Y. Masuda, T. Kadowaki, and I. Komuro Peroxisome Proliferator-Activated Receptor {gamma} Plays a Critical Role in Inhibition of Cardiac Hypertrophy In Vitro and In Vivo Circulation, March 12, 2002; 105(10): 1240 - 1246. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Takano, H. Articles by Masuda, Y. Search for Related Content PubMed PubMed Citation Articles by Takano, H. Articles by Masuda, Y. Related Collections Cell signalling/signal transduction Heart failure - basic studies