© 2000 American Heart Association, Inc.
Integrative Physiology |
Expression of Coxsackievirus and Adenovirus Receptor in Hearts of Rats With Experimental Autoimmune Myocarditis
From the First Department of Internal Medicine, Niigata University School of Medicine (M.I., M.K., M.M., M.Y., K.F., Y.U., S.H., Y.O., K.K., Y.A.), and Research Laboratory for Molecular Genetics, Niigata University (Y.H., T.H., R.K.), Niigata, Japan.
Correspondence to Masahiro Ito, MD, First Department of Internal Medicine, Niigata University School of Medicine, 1-757 Asahimachi, Niigata 951-8510, Japan.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract—The expression of coxsackievirus and adenovirus receptor (CAR) was dominant in the brains and hearts of mice until the newborn phase. There is no detailed information concerning the relation between the expression of CAR and development of hearts. It is also uncertain whether CAR is able to be induced in adult hearts after cardiac injury. We demonstrated that CAR was abundant in the hearts of newborn rats but was barely detectable in the hearts of adult rats. The expression of CAR in rat hearts with experimental autoimmune myocarditis, which was induced by immunization of purified cardiac myosin, was serially investigated. Active myocarditis was observed from day 15 after immunization. By immunohistochemistry, cardiomyocytes were strongly stained for CAR antibody from days 24 to 42. CAR mRNA was also detected from days 18 to 30 by using reverse transcription–polymerase chain reaction. In the next experiment, the induction of CAR on isolated cardiomyocytes was investigated. CAR was barely detectable in cultured cardiomyocytes by Western blot analysis after isolation. This molecule gradually appeared along with the creation of clusters and beating of cardiomyocytes. Furthermore, the induction of CAR in cultured cardiomyocytes increased after supplement with conditioned medium of rat splenocytes activated by concanavalin A. In conclusion, rat CAR is expressed strongly in the hearts of newborn rats and is suppressed in those of adult rats. The expression of CAR is enhanced during the active phase of experimental autoimmune myocarditis and is induced by inflammatory mediators. CAR may play a role in cell-to-cell contact and adhesion of cardiomyocytes.
Key Words: coxsackievirus and adenovirus receptors • myocarditis • cardiomyocytes
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Coxsackievirus and adenovirus receptor (CAR) was recently identified, and cDNA of this molecule was isolated in humans and mice.1 2 3 CAR exhibits both tissue- and species-specific expression. In mice, CAR was present in the brain, liver, heart, lungs, and kidneys.1 2 In our previous study, CAR was strongly expressed in the brains and hearts of mice until the newborn phase; its expression then decreased and subsequently became undetectable in adult mice.4 These observations imply that the expression of CAR exhibits developmental changes and that this molecule may play roles in differentiation and development of the brain and heart.
CAR structurally belongs to the immunoglobulin superfamily, similar to intercellular adhesion molecule-1 (ICAM-1) and neural cell adhesion molecule (N-CAM). Both ICAM-1 and N-CAM have been demonstrated to be related to either the normal development of the heart or the pathogenesis of cardiovascular diseases.5 6 7 The physiological functions of CAR have not yet been elucidated.3 Whether CAR plays a role in left ventricular remodeling after myocardial injury has not yet been determined. In the present study, we demonstrated that CAR was reexpressed in the hearts of adult rats with rat experimental autoimmune myocarditis, which is an animal model of human giant cell myocarditis leading to dilated cardiomyopathy. Furthermore, we examined the expression of CAR in cultured rat cardiomyocytes supplemented with conditioned medium of rat splenocytes activated by concanavalin A (Con A) to elucidate the mechanisms of the induction of CAR, accompanied by inflammation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Immunization
Experimental autoimmune myocarditis was elicited in Lewis rats by immunization of purified pig cardiac myosin as previously described.8 On day 0, 15 rats were immunized with antigen-adjuvant emulsion. Another group of 15 rats was immunized with saline as the control.
Sampling
Newborn rats were killed on day 1 after birth, and their hearts
were removed. Myosin-immunized rats were killed on days 9, 12, 15, 18,
21, 24, 27, 30, 33, 36, 39, 42, 49, and 56 after immunization.
Macroscopic findings were scored in 3 grades as previously
described.8 Hearts were then removed and weighed to
calculate the heart weight/body weight ratio. The
ventricular muscle was used for the following
analysis.
Preparation of Antibody
Seventeen amino acid residues (KTQYNQVPSEDFERAPQ) in an
intracellular domain of CAR were selected. Antibodies against CAR were
prepared as previously described.9
Histopathology and Immunohistochemistry
CAR was immunohistochemically detected by use of purified rabbit
anti-murine CAR antibodies. Positive findings for CAR produced a brown
color. The severity of inflammation was graded from 0 (no inflammation)
to 3 (severe inflammation) as previously described.10 The
expression of CAR was graded as follows: -, negative; ±, weakly
positive; +, moderately positive; and ++, strongly positive.
RT-PCR Analysis
Total RNA was extracted from rat hearts, and reverse
transcription (RT)–polymerase chain reaction (PCR) was performed with
primers (ATGGATCCTACACCCGAACAGAGGATCG [sense] and
GCGAATTCGCGTCGCCAGACTTGACAT [antisense]). ß-Actin cDNA was
amplified as the control. Thirty-three cycles of amplification
reactions (94°C denaturation, 53°C annealing, and 72°C extension)
were performed.
Preparation of Conditioned Medium of Rat Splenocytes
Activated by Con A
Single-splenocyte suspensions of adult rat11 were
cultured for 2 days in the presence of 10 µg/mL of Con A, and the
supernatant was obtained (Con A medium).
Preparation of Cultured Cardiomyocytes
Cardiomyocytes were prepared from neonatal rat ventricles by the
modified method of Libby.12 The cardiomyocytes
were divided into 4 groups. Group 1 was not cultured. Group 2 was
cultured for 24 hours. Groups 3 and 4 were cultured for 96 hours. Group
4 was cultured in standard medium for an initial 24 hours and then
cultured in Con A medium (10% of culture medium) for 72 hours.
Western Blot Analysis
Total protein was prepared from the left ventricle of 1-day-old
and adult rats and from cultured cardiomyocytes with cell
lysis buffer. Protein (15 µg) from total cell lysates13
was separated by SDS-PAGE and analyzed by
immunoblotting with the polyclonal anti-CAR antibodies.
The bands of CAR were analyzed with NIH Image and expressed in
relation to the control values.
Statistical Analysis
Data are presented as mean±SD. Statistical assessment
of the significance among groups was made by 1-way ANOVA followed by
the Bonferroni-Dunn method. A value of P<0.05 was
considered significant.
An expanded Materials and Methods section is available online at http://www.circresaha.org.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Expression of CAR in Hearts of Newborn and Adult Rats
To confirm that the PCR product was an amplified fragment of rat CAR cDNA, the PCR product on day 21 was directly sequenced. Because the sequence of the PCR product had a homology of 93% with murine CAR, we interpreted this product as rat CAR (sequence not shown). RT-PCR revealed that CAR mRNA was expressed abundantly in the hearts of newborn rats, whereas only a slight expression of CAR was detected in the hearts of normal adult rats (Figure 1
). Immunohistochemical staining showed
that the expression of CAR was strong in the hearts of newborn rats but
was undetectable in those of adult rats (Figure 2).
|
|
Expression of CAR in Rat Hearts With Myocarditis
Clinical Course of Myosin-Immunized Rats
One of the myosin-immunized rats died on day 18, during the active
phase of myocarditis. This rat showed macroscopic evidence of severe
myocarditis and was thought to have died of heart failure. No control
rats died spontaneously throughout the period of this experiment
(Table).
|
Macroscopic Findings
The extent of discolored areas of the hearts and the appearance of
pericardial effusion are summarized in the Table
. From the 15th
day after immunization, discolored areas were observed on the cardiac
surface of the myosin-immunized rats. Hearts of the myosin-immunized
rats were markedly enlarged, as shown by heart weight/body weight
ratios >4.0; control rat heart weight/body weight ratios ranged from
2.89 to 3.83, with a mean of 3.16. Pericardial effusion was observed in
myosin-immunized rats on days 18, 21, and 24 (Table).
Histological Study
Microscopic findings are summarized in the Table. There
were no microscopic abnormalities in the hearts of either the control
rats or the myosin-immunized rats on day 9. Small lesions of
mononuclear cell infiltration were observed in the hearts of the
myosin-immunized rats on day 12. Thereafter, inflammatory lesions
spread extensively, and interstitial edema became evident.
From day 21, in addition to mononuclear cell infiltration, myocardial
necrosis was observed. Fibrosis became prominent on day 36. Most of the
infiltrated cells disappeared on day 49, and the inflammatory lesions
were replaced by fibrosis.
RT-PCR Analysis
CAR mRNA was identified in the hearts of the myosin-immunized rats
on days 18 to 30 and peaked on days 21 and 24. CAR mRNA was not
detectable after day 33 by RT-PCR (Figure 3). CAR mRNA was not detected in the
control group throughout the experiment by our RT-PCR (data are not
shown).
|
Immunohistochemical Analysis
Immunohistochemical staining for CAR was negative in the hearts of
control rats. Hearts of the rats with experimental autoimmune
myocarditis were stained with anti-CAR antibodies from day 24.
Immunoreactivity of CAR was found in the cardiomyocytes of
rats with experimental autoimmune myocarditis, not only in the
inflammatory lesions but also in the intact area, where infiltration
cells and myocardial degeneration were not found. Scar tissue and the
vascular wall were not stained. The staining was most intense in the
hearts obtained on day 33, after which immunoreaction for CAR gradually
decreased (Figure 4).
|
Induction of CAR in Cultured Cardiomyocytes
Although CAR was expressed abundantly in the hearts of the newborn
rats, only a slight expression of CAR was detected in cultured rat
cardiomyocytes after isolation from the newborn rats by
Western blot analysis (Figure 5A). The expression of CAR was suppressed
after isolation, but then it gradually increased according to the
creation of clusters and beating of cardiomyocytes.
Furthermore, the induction of CAR was more significantly enhanced in
cultured cardiomyocytes treated with Con A medium than
those treated with culture medium (Figure 5B).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CAR structurally belongs to the immunoglobulin superfamily, and its physiological function has not yet been clarified. The immunoglobulin superfamily includes many cell-surface proteins that mediate cell-to-cell recognition or antigen recognition in the immune system. N-CAM, which also belongs to the immunoglobulin superfamily, was expressed prominently in the embryonic phase, and its expression was suppressed in the hearts of adult rats.14 N-CAM immunoreactivity was reexpressed in transplanted extrinsically denervated human hearts and also in the hypertrophic myocardium of rats.15 16 From these observations, N-CAM was considered to play roles in both development of the heart and innervation to the heart. The expression of CAR was high in the myocardium of newborn rats and low in the myocardium of adult rats in the present study. This implied that CAR might act on myocardial morphogenesis similar to N-CAM. Although CAR was abundantly expressed in the hearts of newborn rats, the expression of CAR decreased in cultured cardiomyocytes after isolation from these hearts. CAR gradually appeared again as cardiomyocytes began to make clusters and start a beat. On the basis of these results, we suggest that CAR may play roles in cell-to-cell contact and adhesion.
Rat experimental autoimmune myocarditis is inducible by purified cardiac myosin and is an animal model of human giant cell myocarditis, which leads to dilated cardiomyopathy. 17 T cells play an important role in inducing myocarditis in this model.11 We examined the expression of CAR in experimental autoimmune myocarditis of rats to clarify whether CAR was reenhanced in diseased hearts. In the course of experimental autoimmune myocarditis, the expression of CAR in the hearts was low or undetectable before the onset of the disease, and then its expression became apparent during the active phase of myocarditis. Next, the expression of CAR decreased in the chronic phase. ICAM-1, which also belongs to the immunoglobulin superfamily, was also induced in myocardial cells of mice with acute viral myocarditis.7 Its expression coincided with cell infiltration. ICAM-1 on cardiac myocytes, together with myosin heavy chain antigens, was demonstrated to be associated with cell-mediated myocardial injuries by activated lymphocytes.7 On the other hand, the expression of rat CAR was preceded by several days of massive cell infiltration. Accordingly, the expression of CAR in myocardial cells might not be related to myocardial injuries in acute myocarditis. CAR may be associated with the healing phase of myocarditis or regeneration of damaged myocardium.
The mechanism responsible for the induction of CAR had not been
elucidated. In the present study, CAR was induced when myocytes
were treated with conditioned medium of rat splenocytes
activated by Con A. This result implied that the expression of
CAR was induced by inflammatory mediators. We previously revealed the
time course of the expression of various cytokine mRNA in
experimental autoimmune myocarditis.18 19 mRNA of
proinflammatory cytokines, such as interferon-
, tumor
necrosis factor-
, and interleukin-1ß, and inducible nitric oxide
synthase were expressed in the myocardium of experimental
autoimmune myocarditis from the beginning of the acute inflammatory
phase. CAR mRNA was reexpressed after the expression of these
cytokines. The present study suggests that inflammatory
mediators play a role in the induction of CAR in experimental
autoimmune myocarditis. Further study is necessary to identify the
specific mediators inducing CAR.
In conclusion, the expression of CAR was enhanced in experimental autoimmune myocarditis. Our results suggest that CAR is induced by inflammatory mediators. This molecule may contribute to cell-to-cell contact and to the adhesion of cardiomyocytes and act on myocardial regeneration.
Received August 19, 1999; accepted November 5, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Bergelson JM, Krithivas A, Celi L, Droguett G, Horwitz MS, Wickham T, Crowell RL, Finberg RW. The murine CAR homolog is a receptor for coxsackie B viruses and adenoviruses. J Virol. 1998;72:415–419.
2.
Bergelson JM, Cunningham JA, Droguett G, Kurt-Jones
EA, Krithivas A, Hong JS, Horwitz MS, Crowell RL, Finberg RW. Isolation
of a common receptor for coxsackie B viruses and adenoviruses 2 and 5.
Science. 1997;275:1320–1323.
3.
Tomko RP, Xu R, Philipson L. HCAR and MCAR: the human
and mouse cellular receptors for subgroup C adenoviruses and group B
coxsackieviruses. Proc Natl Acad Sci U S A. 1997;94:3352–3356.
4. Hotta Y, Masuko M, Hanyu T, Abe TK, Honda T, Tominaga K, Odani S, Kuwano R. Immunohistochemical analysis of new adhesion molecule gmp46. Neurosci Res. 1998;22(suppl):S313. Abstract.
5.
Hillis GS, Flapan AD. Cell adhesion molecules in
cardiovascular disease: a clinical perspective.
Heart. 1998;79:429–431.
6. Hoffman S, Crossin KL, Prediger EA, Cunningham BA, Edelman GM. Expression and function of cell adhesion molecules during the early development of the heart. Ann N Y Acad Sci. 1990;588:73–86.[Medline] [Order article via Infotrieve]
7. Seko Y, Matsuda H, Kato K, Hashimoto Y, Yagita H, Okumura K, Yazaki Y. Expression of intracellular adhesion molecule-1 in murine hearts with acute myocarditis caused by coxsackievirus B3. J Clin Invest. 1993;91:1327–1336.
8. Kodama M, Matsumoto Y, Fujiwara M, Masani F, Izumi T, Shibata A. A novel experimental model of giant cell myocarditis induced in rats by immunization with cardiac myosin fraction. Clin Immunol Immunopathol. 1990;57:250–262.[Medline] [Order article via Infotrieve]
9. Abe TK, Tanaka H, Iwanaga T, Odai S, Kuwano R. The presence of the 50-kDa subunit of dynactin complex in the nerve growth cone. Biochem Biophys Res Commun. 1997;233:295–299.[Medline] [Order article via Infotrieve]
10.
Kodama M, Zhang S, Hanawa H, Saeki M, Inomata T, Suzuki
K, Koyama S, Shibata A. Effects of 15-deoxyspergualin on experimental
autoimmune giant cell myocarditis of the rat. Circulation. 1995;91:1116–1122.
11.
Kodama M, Matsumoto Y, Fujiwara M. In vivo
lymphocyte-mediated myocardial injuries demonstrated by adoptive
transfer of experimental autoimmune myocarditis.
Circulation. 1992;85:1918–1926.
12. Libby P. Long-term culture of contractile mammalian heart cells in a defined serum-free medium that limits non-muscle cell proliferation. J Mol Cell Cardiol. 1984;16:803–811.[Medline] [Order article via Infotrieve]
13. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685.[Medline] [Order article via Infotrieve]
14. Wharton J, Gordon L, Walsh FS, Flanigan TP, Moore SE, Polak JM. Neural cell adhesion molecule (N-CAM) expression during cardiac development in the rat. Brain Res. 1989;483:170–176.[Medline] [Order article via Infotrieve]
15. Gordon L, Wharton J, Moore SE, Walsh FS, Moscoso JG, Penketh R, Wallwork J, Taylor KM, Yacoub MH, Polak JM. Myocardial localization and isoforms of neural cell adhesion molecule (N-CAM) in the developing and transplanted human heart. J Clin Invest. 1990;86:1293–1300.
16. Gordon L, Wharton J, Moore SE, Flanigan TP, Gulbenkian S, Walsh FS, David-Ferreira JF, Winter RJD, Polak JM. Expression of neural cell adhesion molecule immunoreactivity in hypertrophic myocardium. Life Sci. 1990;47:601–609.[Medline] [Order article via Infotrieve]
17.
Kodama M, Hanawa H, Saeki M, Hosono H, Inomata T,
Suzuki K, Sibata A. Rat dilated cardiomyopathy
after autoimmune giant cell myocarditis. Circ Res. 1994;75:278–284.
18.
Hirono S, Islam MO, Nakazawa M, Yoshida Y, Kodama M,
Shibata A, Izumi T, Imai S. Expression of inducible nitric oxide
synthase in rat experimental autoimmune myocarditis with special
reference to changes in cardiac hemodynamics.
Circ Res. 1997;80:11–20.
19. Okura Y, Yamamoto T, Goto S, Inomata T, Hirono S, Hanawa H, Feng L, Wilson CB, Kihara I, Izumi T, Shibata A, Aizawa Y, Seki S, Abo T. Characterization of cytokine and iNOS mRNA expression in situ during the course of experimental autoimmune myocarditis in rats. J Mol Cell Cardiol. 1997;29:491–502.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  M. Mirza, C. Petersen, K. Nordqvist, and K. Sollerbrant Coxsackievirus and Adenovirus Receptor Is Up-Regulated in Migratory Germ Cells during Passage of the Blood-Testis Barrier Endocrinology, November 1, 2007; 148(11): 5459 - 5469. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Zanone, E. Favaro, E. Ferioli, G. C. Huang, N. J. Klein, P. C. Perin, M. Peakman, P. G. Conaldi, and G. Camussi Human pancreatic islet endothelial cells express coxsackievirus and adenovirus receptor and are activated by coxsackie B virus infection FASEB J, October 1, 2007; 21(12): 3308 - 3317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Asher, R. Finberg, F. Wegmann, S. Butz, F. G. Rathjen, K. Wolburg-Buchholz, H. Wolburg, and D. Vestweber CAR might provide a survival signal for myocardial cells J. Cell Sci., December 15, 2005; 118(24): 5679 - 5680. [Full Text] [PDF]
|
|
|
|
 |
|
 K. Fuse, G. Chan, Y. Liu, P. Gudgeon, M. Husain, M. Chen, W.-C. Yeh, S. Akira, and P. P. Liu Myeloid Differentiation Factor-88 Plays a Crucial Role in the Pathogenesis of Coxsackievirus B3-Induced Myocarditis and Influences Type I Interferon Production Circulation, October 11, 2005; 112(15): 2276 - 2285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Dorner, F. Wegmann, S. Butz, K. Wolburg-Buchholz, H. Wolburg, A. Mack, I. Nasdala, B. August, J. Westermann, F. G. Rathjen, et al. Coxsackievirus-adenovirus receptor (CAR) is essential for early embryonic cardiac development J. Cell Sci., August 1, 2005; 118(15): 3509 - 3521. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Schrenzel, J. L. Oaks, D. Rotstein, G. Maalouf, E. Snook, C. Sandfort, and B. Rideout Characterization of a New Species of Adenovirus in Falcons J. Clin. Microbiol., July 1, 2005; 43(7): 3402 - 3413. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Shen, W. Xu, Y.-W. Chu, Y. Wang, Q.-S. Liu, and S.-D. Xiong Coxsackievirus Group B Type 3 Infection Upregulates Expression of Monocyte Chemoattractant Protein 1 in Cardiac Myocytes, Which Leads to Enhanced Migration of Mononuclear Cells in Viral Myocarditis J. Virol., November 15, 2004; 78(22): 12548 - 12556. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Sasse, Z. Ding, M. Wallich, A. Godecke, and J. Schrader Vascular transfer of adenovirus is augmented by nitric oxide in the rat heart Am J Physiol Heart Circ Physiol, September 1, 2004; 287(3): H1362 - H1368. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Raschperger, U. Engstrom, R. F. Pettersson, and J. Fuxe CLMP, a Novel Member of the CTX Family and a New Component of Epithelial Tight Junctions J. Biol. Chem., January 2, 2004; 279(1): 796 - 804. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Kishimoto, Y. Hiraoka, N. Takamatsu, H. Takada, H. Kamiya, and H. Ochiai An in vivo model of autoimmune post-coxsackievirus B3 myocarditis in severe combined immunodeficiency mouse Cardiovasc Res, November 1, 2003; 60(2): 397 - 403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Zautner, U. Korner, A. Henke, C. Badorff, and M. Schmidtke Heparan Sulfates and Coxsackievirus-Adenovirus Receptor: Each One Mediates Coxsackievirus B3 PD Infection J. Virol., September 15, 2003; 77(18): 10071 - 10077. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Communal, F. Huq, D. Lebeche, C. Mestel, J. K. Gwathmey, and R. J. Hajjar Decreased Efficiency of Adenovirus-Mediated Gene Transfer in Aging Cardiomyocytes Circulation, March 4, 2003; 107(8): 1170 - 1175. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Sollerbrant, E. Raschperger, M. Mirza, U. Engstrom, L. Philipson, P. O. Ljungdahl, and R. F. Pettersson The Coxsackievirus and Adenovirus Receptor (CAR) Forms a Complex with the PDZ Domain-containing Protein Ligand-of-Numb Protein-X (LNX) J. Biol. Chem., February 21, 2003; 278(9): 7439 - 7444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Fechner, M. Noutsias, C. Tschoepe, K. Hinze, X. Wang, F. Escher, M. Pauschinger, D. Dekkers, R. Vetter, M. Paul, et al. Induction of Coxsackievirus-Adenovirus-Receptor Expression During Myocardial Tissue Formation and Remodeling: Identification of a Cell-to-Cell Contact-Dependent Regulatory Mechanism Circulation, February 18, 2003; 107(6): 876 - 882. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Poller, H. Fechner, M. Noutsias, C. Tschoepe, M. Pauschinger, and H.-P. Schultheiss The molecular basis of cardiotropic viral infections Eur. Heart J. Suppl., December 1, 2002; 4(suppl_I): I18 - I30. [Abstract] [PDF]
|
|
|
|
|
|
P. Liu, P. Lee, K. Fuse, and M. Nian Molecular pathophysiological mechanisms in virus infected host myocardium Eur. Heart J. Suppl., December 1, 2002; 4(suppl_I): I37 - I41. [Abstract] [PDF]
|
|
|
|
|
|
H. Luo, B. Yanagawa, J. Zhang, Z. Luo, M. Zhang, M. Esfandiarei, C. Carthy, J. E. Wilson, D. Yang, and B. M. McManus Coxsackievirus B3 Replication Is Reduced by Inhibition of the Extracellular Signal-Regulated Kinase (ERK) Signaling Pathway J. Virol., March 7, 2002; 76(7): 3365 - 3373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Noutsias, H. Fechner, H. de Jonge, X. Wang, D. Dekkers, A.B. Houtsmuller, M. Pauschinger, J. Bergelson, R. Warraich, M. Yacoub, et al. Human Coxsackie-Adenovirus Receptor Is Colocalized With Integrins {alpha}v{beta}3 and {alpha}v{beta}5 on the Cardiomyocyte Sarcolemma and Upregulated in Dilated Cardiomyopathy: Implications for Cardiotropic Viral Infections Circulation, July 17, 2001; 104(3): 275 - 280. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. P. Liu and M. A. Opavsky Viral Myocarditis : Receptors That Bridge the Cardiovascular With the Immune System? Circ. Res., February 18, 2000; 86(3): 253 - 254. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||