© 2000 American Heart Association, Inc.
Molecular Medicine |
Smooth Muscle 
-Actin CArG Elements Coordinate Formation of a Smooth Muscle Cell–Selective, Serum Response Factor–Containing Activation Complex
From the Department of Molecular Physiology and Biological Physics, University of Virginia Medical School, Charlottesville.
Correspondence to Gary K. Owens, PhD, Box 449, Health Sciences Center, University of Virginia, Charlottesville, VA 22908.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract—Previous studies have shown that multiple serum response factor (SRF)-binding CArG elements were required for smooth muscle cell (SMC)-specific regulation of smooth muscle (SM)
-actin expression. However, a critical question
remains as to the mechanisms whereby a ubiquitously expressed
transcription factor such as SRF might contribute to SMC-specific
expression. The goal of the present study was to investigate the
hypothesis that SMC-selective expression of SM -actin is due at
least in part to (1) unique CArG flanking sequences that distinguish
the SM -actin CArGs from other ubiquitously expressed CArG-dependent
genes such as c-fos, (2) cooperative interactions
between CArG elements, and (3) SRF-dependent binding of SMC-selective
proteins to the CArG-containing regions of the promoter. Results
demonstrated that specific sequences flanking CArG B were important for
promoter activity in SMCs but not in bovine aortic
endothelial cells. We also provided evidence indicating
that the structural orientation between CArGs A and B was an important
determinant of promoter function. Electrophoretic mobility shift assays
and methylation interference footprinting demonstrated that a unique
SRF-containing complex formed that was selective for SMCs and,
furthermore, that this complex was probably stabilized by
protein-protein interactions and not by specific interactions with CArG
flanking sequences. Taken together, the results of these studies
provide evidence that SM -actin expression in SMCs is complex and
may involve the formation of a unique multiprotein initiation complex
that is coordinated by SRF complexes bound to multiple CArG
elements.
Key Words: serum response factor • smooth muscle -actin • CArG element
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Intimal migration and subsequent proliferation of vascular smooth muscle cells (SMCs) has been shown to be important in the development of atherosclerosis and in restenosis after balloon angioplasty.1 2 Medial SMCs are normally highly specialized for contraction and express cell type–specific contractile proteins, surface receptors, and second-messenger pathways that are critical for this function (reviewed in Reference 3 ). However, unlike myocardial and skeletal muscle cells that terminally differentiate, vascular SMCs are highly plastic and retain the ability to modulate their phenotype to a more proliferative synthetic state, even in adult animals.4 5 6 7 8 Retention of this plasticity is important in that it permits processes such as vessel repair after injury, but it may also be detrimental in that it increases susceptibility to atherogenic risk factors.
It is clear that understanding the molecular control of SMC
differentiation will be dependent on the identification of mechanisms
that control the transcription of genes encoding proteins necessary for
the differentiated function of SMCs. Several smooth muscle
(SM)-specific contractile or contractile-associated proteins, including
SM -actin, myosin heavy chain, h-caldesmon, and SM-22, are useful
markers for studying SMC differentiation.3 Of these, SM
-actin has been the most extensively studied. It is the most
abundant SMC protein and is the first known differentiation marker to
appear during vessel development.9 10 Although it is
transiently expressed in the myocardium and skeletal muscle
during early stages of development and in fibroblasts found in healing
wounds, its expression in adult animals is restricted to SMCs or
SM-like cells.11 12
Our laboratory and others have shown that regulation of SM -actin
expression involves a complex interaction of multiple positive and
negative cis elements that act in a cell-type–specific
fashion.13 14 15 16 17 18 The SM -actin promoter contains 3
CArG elements, designated CArG A at -62, CArG B at -112, and an
intronic CArG at +1001, that are completely conserved between all
species in which the promoter has been cloned and have been shown to be
required for full promoter activity in cultured SMCs.17 19
Moreover, we have recently shown by use of transgenic approaches that
all 3 CArGs were required for SM -actin expression in vivo. In those
experiments, we demonstrated that the SM -actin promoter regions
from -2600 through the first intron were sufficient to drive
expression of a LacZ transgene in a pattern virtually identical to that
of the endogenous SM -actin gene and that mutation of
CArG A, CArG B, or the intronic CArG inhibited expression in virtually
all SMCs.19
The CArG motif was first identified as the core sequence of the serum
response element (SRE) within early-response genes such as
c-fos, and much is known about SRE-mediated regulation on
serum stimulation (reviewed in Reference 20 ). The SRE
binds the MADS box transcription factor, serum response factor (SRF),
but also contains an Ets motif that stabilizes a ternary complex that
forms when one of several SRF accessory proteins (Elk-1, Sap-1, or
ERP/NET) is recruited to the SRE through SRF-mediated
protein-protein interactions.21 22 23 However, CArG
elements have also been shown to direct developmental and
tissue-specific expression of many muscle-specific
genes.24 25 26 27 28 Interestingly, virtually all of the SM
differentiation marker genes characterized to date contain 
2 CArG or
CArG-like elements that are required for their expression in
SMCs.17 29 30 31 32 33
Recent studies from this laboratory indicate that CArG elements play a
critical role in SMC-specific regulation of SM -actin. For example,
when transfected into SMC cultures, a minimal promoter construct
containing the first 125 bp of the 5' promoter (p125CAT) had very high
activity that was absolutely dependent on CArG A and CArG
B.17 This same construct had little or no activity in L6
myoblasts or L6 myotubes, and the modest activity of p125CAT observed
in endothelial cells was not affected by CArG
mutations.17 Moreover, our transgenic model demonstrated
that mutation of the intronic CArG abolished expression in SMCs but had
no affect on the transient expression of SM -actin that is normally
seen in the heart and skeletal muscle during embryonic
development.19 In addition, separate laboratories have
shown that the arterial expression of an SM22 promoter/LacZ
transgene was absolutely dependent on a conserved CArG
element.32 33 Taken together, these data provide strong
evidence that CArG elements are of key importance for SMC-specific gene
regulation during differentiation/maturation.
Although the SM -actin CArGs are required for expression in SMCs, a
critical unresolved issue is how SRF contributes to SMC-specific
transcriptional regulation. SRF binding to CArG and CArG-like elements
is required for cell-type–specific promoter activation, but evidence
suggests that SRF binding by itself is not sufficient.33
Moreover, although recent evidence suggests that muscle tissues contain
more SRF than do nonmuscle tissues,34 35 SRF is thought to
be ubiquitously expressed, indicating that mechanisms in addition to
SRF binding are likely to be involved in determining
cell-type–specific expression. Several groups have shown that CArG
flanking sequences are important in skeletal and cardiac -actin
expression,36 37 but the specific DNA sequences and
trans-activating factors involved have not been clearly
identified. SMC-specific regulation may also involve
trans-acting factors other than SRF that are known to bind
CArG elements. The multifunctional transcription factor, YY1, binds the
skeletal actin and SM-22 promoters and can modulate transcription of
these genes.38 39 However, like SRF, YY1 is expressed
in a wide range of tissues, and its role in cell-type–specific
regulation is unclear at this time.40 Cell-specific
CArG-dependent regulation may also involve unique combinatorial
interactions between multiple cis- and
trans-acting factors that, by themselves, are not cell-type
specific. Tissue-specific expression of cardiac actin, for example, is
mediated by several cis- and trans-acting
factors, including SRF, Sp-1, Nkx-2.5, and Myo
D.41 42 In short, the mechanisms involved in
CArG-dependent regulation of SMC-specific genes are undoubtedly
complex, and at present, the specific DNA sequences,
trans-acting factors, and mechanisms that mediate such
regulation are poorly understood.
The goal of the present study was to identify key mechanisms that
contribute to CArG-dependent SMC-specific expression of SM -actin.
We hypothesized that several parameters unique to the SM
-actin gene or to SMCs in general were involved. First, we proposed
that the DNA context in which the CArGs are situated may affect the
activity and specificity of the SM -actin promoter. Although the SM
-actin gene lacks a consensus Ets domain, the sequences directly
flanking CArGs A and B are nearly completely conserved,17
which suggests that they play an important regulatory role. Thus, we
tested a variety of mutations to the SM -actin CArG flanking
sequences to further define regulatory sequences required for
SMC-specific expression of this gene. Second, previous evidence
indicated that SRF-induced changes in DNA conformation and the
structural positioning of multiple CArG elements may be important for
SRF-dependent activation.25 43 44 Moreover, the 40-bp
spacing between CArGs A and B is completely conserved across species,
with both elements placed on the same side of the DNA. Therefore, we
also tested whether the spacing and phasing of these 2 required
elements might be important for activity in SMCs. Third, our initial
electrophoretic mobility shift assay (EMSA) data demonstrated that an
SMC protein, in addition to SRF, was present in a higher order
complex with the CArG B–containing region of the
promoter.17 For example, when a 95-bp probe that contained
CArGs A and B was combined with SMC nuclear extracts, an SRF-containing
DNA binding complex formed that had a lower mobility than did a similar
complex formed with recombinant SRF (rSRF). In the present
study, we further characterized the molecular interactions that are
important for the formation of the SRF- containing higher order complex
and extended these studies to the intronic CArG-containing region of
the promoter. The present study provides novel evidence indicating
that CArG- and SRF-dependent regulation of SM -actin expression is
cell-type specific and is modulated by several parameters
including (1) the structural positioning of the CArG elements within
the first 125 bp of the promoter, (2) the formation of a unique
SRF-containing CArG-binding complex in SMCs, and (3) the involvement of
specific SM -actin CArG flanking sequences in promoter
activation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell Culture, Transient Transfections, and Gel-Shift Analyses
Rat aortic SMCs,16 rat L6 myoblasts,17 rat L6 myotubes,45 and bovine aortic endothelial cells (BAECs)16 were isolated and cultured as previously described. Transfections were performed with 4 µg of plasmid DNA per well as previously described.17 Chloramphenicol acetyltransferase (CAT) activity was measured, normalized to the protein concentration of each cell lysate, and expressed relative to the activity of a promoterless CAT construct. Nuclear extracts were prepared from confluent rat aortic SMCs, BAECs, and rat L6 myoblasts and myotubes by using the methods of Dignam et al.46 Human rSRF was synthesized with the TnT-Quick in vitro transcription/translation kit (Promega) from an expression plasmid generously provided by Richard Treisman (Imperial Cancer Research Fund, London, UK). Oligonucleotides used in EMSAs were purchased commercially (Operon Technologies) and include the following: CArG B, 5'-gaggtccctatatggttgtg-3'; SRE, 5'-ttacacaggatgccatattaggacat-3'; and intronic CArG, 5'-ttttacctaattaggaaatg-3'. Probes were 32P end-labeled and annealed or generated by polymerase chain reaction (PCR). A Mut95 plasmid that contained transversion mutations (ie, G
T
and AC) to all non-CArG sequences was constructed by subcloning the
following fragment (Operon) into an EcoRI/XbaI
site of the Bluescript KS vector (Promega):
5'aattctggggtgtatcttgccctatatgggatatcgctctgaccgtt-aactaggactagctgagggtagccttgtttggct
gcatctgtttcttttcggctagc-3'. Probes used for circular permutation
studies were generated with the use of PCR by selecting primers such
that the position of the CArG B element varied within the PCR fragment
(see Figure 8A
for more detail). EMSAs were incubated for 30
minutes at room temperature in 1x binding buffer (10 mmol/L
Tris-HCl [pH 7.5], 100 mmol/L KCl, 50 mmol/L NaCl, 1
mmol/L dithiothreitol, 1 mmol/L EDTA, and 5% glycerol) that
included the following: 
30 pg of labeled probe; either 5 µg of SMC
nuclear extract, 15 to 20 µg of BAECs, and myotube and myoblast
extracts or 1 µL of rSRF; and 0.2 to 0.6 µg of poly(dI-dC).
Antibodies used for supershifts were purchased commercially (Santa
Cruz).
|
Construction of SM -Actin Promoter Mutations
CArG flanking mutations in the p125CAT context were constructed
by PCR amplification using the wild-type SM -actin promoter and the
Mut95 plasmid described above as templates. CArG flanking mutations
were made in the p2600Int/LacZ context by using the QuickChange system
(Stratagene). CArG spacing and phasing constructs were made in the
p125CAT context by ligating different-length linker sequences (5, 10,
15, 20, 45, and 60 bp) into an HpaI site created in the
wild-type promoter at -102 by an AG to CA mutation. This mutation had
no effect on promoter activity.
Methylation Interference Footprinting
A 32P end-labeled 95-bp probe spanning
CArGs A and B was methylated for 3 minutes with 0.05% dimethyl
sulfate. The methylated probe was then used in EMSAs under conditions
identical to those described above. The low-mobility SRF-containing
bands as well as the bands corresponding to free probe were excised
from the gel and electrophoresed through 1.0% agarose onto a DEAE
membrane. DNA was eluted from the membrane, extracted with an equal
volume of phenol/chloroform, and precipitated with EtOH. DNA was
cleaved in 100 µL of 1 mol/L piperidine for 30 minutes at 90°C, and
equal counts of each band were loaded onto an 8%
acrylamide sequencing gel.
An expanded Materials and Methods section is available online at http://www.circresaha.org.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Specific CArG Flanking Sequences Were Important for Promoter Activity in SMCs but Not BAECs
The sequences surrounding the SM
-actin CArGs A and B are
highly conserved, and several reports have shown that the activity and
specificity of CArG-dependent genes are regulated by CArG flanking
sequences.22 47 Therefore, a series of mutations was made
in the CArG flanking regions of the p125CAT reporter construct in order
to test the functional significance of these regions on SM -actin
expression in both SMCs and BAECs. The p125CAT construct was chosen for
these experiments because this relatively simple promoter fragment has
very high activity in SMCs, is differentially regulated in SMCs versus
non-SMCs in a CArG-dependent fashion, and has consistently
yielded valuable insight into the regulation of SM -actin
expression.17 19 48 Mutations were designed to leave the
CArG elements as well as the recently described transforming growth
factor-ß1 control element at -48 intact
because these elements are known to be required for promoter activity
(Figure 1A).
|
Transfection results shown in Figure 1B
indicate that the
activity of the wild-type p125CAT construct was 50-fold and 15-fold
that of the promoterless construct when transfected into SMCs and
BAECs, respectively. Consistent with previous studies from this
laboratory, mutation of CArG B completely abolished activity in SMCs
but had little effect on activity in BAECs. Mutations to the 3'
flanking region of CArG B (pM92–111) significantly reduced promoter
activity in SMCs to 10% of control, whereas none of the CArG
flanking mutants significantly affected promoter activity in BAECs.
More defined site-directed mutations to this region demonstrated that
the positive activity in the CArG B flanking region was contained
within the 6 nucleotides immediately 3' to CArG B (Figure 1C). These data suggest that, in addition to the CArGs
themselves, specific CArG flanking sequences are also important for
cell-type–specific expression of p125CAT.
To determine whether the CArG B flanking region interacts with other
regulatory components within the SM -actin promoter, we mutated the
6-bp region in a larger promoter context that we previously
demonstrated was sufficient to drive expression of SM -actin in vivo
(-2600 through the first intron).19 The CArG B flanking
mutations had nearly identical effects on the activity of the larger
promoter construct (Figure 2).
|
Spacing and Phasing of CArGs A and B Were Important for Promoter
Function in SMCs
We have previously shown that all 3 of the CArG elements were
required for SM -actin expression in vivo, which indicated that
these elements somehow function interdependently.19
SRF-induced changes in DNA conformation have been reported in several
CArG-containing genes, including c-fos and skeletal
-actin, and such changes to DNA structure are likely to be important
for their regulation.25 43 Of interest, CArGs A and B
are located in proximity, and the 40-bp interval that separates them
positions them on the same side of the DNA double helix.17
Moreover, this structural orientation has been completely conserved
across all species in which the promoter has been
cloned.17 To determine whether CArG positioning was
important for transcriptional activity, we altered the position of CArG
B by inserting several different-length linkers between CArGs A and B
that not only changed their spacing but also altered their phasing by
rotating the elements to different planes along the DNA double helix
(Figure 3A).
|
Results demonstrated (Figure 3B) that as CArG B was moved 5, 10,
and 15 bp upstream from CArG A, p125CAT activity dropped significantly.
The 15-bp insertion positioned CArGs A and B on opposite sides of the
DNA and resulted in an 85% drop in promoter activity. With the
insertion of an additional 5 bp (from 15 to 20) and the accompanying
half turn of DNA, promoter activity increased significantly to 50% of
control. The addition of larger stretches of DNA led to large
reductions in promoter activity that could not be relieved by changes
in phasing. These results indicate that a higher order interaction that
includes SRF bound to both CArGs A and B is critical for
transcriptional activity of the SM -actin promoter. Although we have
not directly tested the importance of CArG phasing and spacing in the
context of p2600Int/CAT, the fact that the spacing and phasing of CArGs
A and B within the endogenous gene are highly conserved
provides strong evidence that our results in the p125 context are
relevant to regulation of the endogenous
gene.
SMC Extracts Contained Unique CArG-Binding Activities
Previous studies have demonstrated that CArG elements are critical
for SMC-specific regulation of SM -actin expression, and the results
from the present study indicated that specific CArG flanking
sequences and CArG spacing and phasing were important for SMC-selective
expression of SM -actin. To further explore the mechanisms that
control SMC-specific regulation, we performed extensive gel-shift
analyses to determine whether the CArG-containing regions of
the SM -actin promoter exhibited DNA binding activities that were
specific to SMCs. Nuclear extracts from SMCs, BAECs, L6 myoblasts, and
L6 myotubes were combined with the 20-bp CArG B
oligonucleotide or with a 95-bp probe that contained
CArGs A and B, because both are required for promoter activity. As
previously observed, Figure 4
demonstrates that SMC extracts formed 2 SRF-containing shift bands when
reacted with CArG B (lanes 3 and 4, bands A and B) and 2 lower mobility
SRF-containing complexes when reacted with the 95-bp probe (lanes 1 and
2, bands 1 and 2). Of particular interest, these results also showed
that bands 1 and 2 were present only when SMC extracts were used,
whereas shift bands formed with non-SMC types had electrophoretic
mobilities identical to SMC complexes A and B formed with the 20-bp
CArG B oligo.
|
Results from Figure 4 indicate that the SRF-containing shift
complexes that were formed when the 95-bp probed was reacted with SMC
nuclear extracts were distinct from those that were formed when a 20-bp
CArG probe was used. We previously reported results based on supershift
and cross-linking analyses demonstrating that band 1 contained
SRF or an SRF-like protein.17 As a first step in
determining the DNA regions required for the formation of the higher
order SRF-containing complex in SMCs, we compared the shift complexes
that form with the 95-bp probe, a 20-bp CArG B probe, an SRE CArG
probe, and a 40-bp probe containing CArG A and B
oligonucleotides linked together (A+B). The results
(Figure 5A) demonstrated that the 2
SRF-containing complexes that formed when the 95-bp probe was reacted
with SMC nuclear extracts had lower mobilities that those formed when
rSRF was used (compare lane 2, bands A and B, with lane 7, bands 1 and
2). However, when 20-bp double-stranded
oligonucleotides containing SRE or CArG B were used as
probes, the SMC complexes had mobilities equal to those formed with
rSRF (compare lanes 3 and 4 with lane 1). Shift complexes formed with
the A+B probe had mobilities similar to those of bands A and B. These
results are consistent with our earlier observations and
suggest that a higher order SRF-containing complex forms with the 95-bp
probe when SMC nuclear extracts are used but that 20-bp
CArG–containing oligonucleotides alone are not
sufficient for its formation. Importantly, the reduced mobility of the
SRF-containing SMC complexes cannot be accounted for by differences
between SRF in SMC extracts and rSRF because SRF-dependent shift
mobilities were identical when SMC extracts or rSRF was reacted with
all other CArG-containing probes tested. Moreover, the reduced mobility
of the complex was not due to differences in probe size per se, in view
of the fact that shift complexes formed with rSRF were identical when
the 95- or 20-bp probes were used.
|
Because we have shown recently that the intronic CArG binds SRF and was
required for in vivo expression of SM -actin in SMCs,19
we also performed gel-shift analyses to determine whether SRF
can bind this element as part of a higher order complex. As shown in
Figure 5B, the SRF-containing binding complex that forms when
the intronic CArG is contained within a 95-bp intronic fragment had
lower mobility than the SRF-containing complex that binds to a 20-bp
intronic CArG oligonucleotide.
Methylation Interference Footprinting Provided Evidence That SMCs
May Contain an SRF-Associated DNA Binding Protein
The preceding gel-shift data provide strong evidence that the
higher order SRF-containing complex in SMCs contains a protein (or
proteins) in addition to SRF. To further test this possibility and to
define promoter regions involved in binding, we performed methylation
interference footprinting on the lowest mobility SRF complex that bound
to the 95-bp probe that contained CArGs A and B. Consistent
with previously published reports involving DNA binding by
rSRF,20 results shown in Figure 6 demonstrated that the interference
footprint of rSRF covered only the guanine residues of CArG B (compare
lane 5 with lane 3). In contrast, the footprint obtained with SMC
extracts covered CArG B but was also extended to several guanine
residues on the 5' flank of CArG B (compare lane 4 with lane 3). CArG A
did not exhibit footprinting with either rSRF or SMC extracts (compare
lanes 4 and 5 with lane 3). These data indicate that methlyation of
guanine residues in the region 5' to CArG B interferes with the
formation of the low-mobility SMC-specific/selective SRF-containing
complex.
|
Formation of the Higher Order Complex Required CArG B and Was Based
on SRF-Mediated Protein-Protein Interactions
It has been shown that the DNA sequences flanking c-fos
SRE CArG contain a critical cis binding site and play an
important role in ternary complex formation.22 23
Although the SM -actin gene does not contain an Ets or Ets-like
domain in proximity to CArG B, results of our gel-shift
analyses (Figures 3 and 4) and methylation
interference footprinting studies (Figure 6) provided evidence
for the presence of an additional protein in the shift complex.
Moreover, our functional data have demonstrated the importance of the
3' flank of CArG B for p125CAT activity in SMCs. To define more
precisely the DNA sequences involved in the formation of the higher
order complex at CArG B, we performed additional EMSA analyses.
Figures 7A and 7B show that the higher
order complex was not affected by competition with
oligonucleotides containing the 40-bp region between
the CArGs (Figure 6A, lanes 9 through 15), the region 5' to CArG
B (Figure 6B, lanes 1 through 7), or the region 3' to CArG A
(Figure 6B, lanes 9 through 16).
|
We also tested the effects of mutations to the 95-bp gel-shift probe
itself, including the CArGs as well as the CArG-flanking regions. One
such probe, M95, left CArGs A and B intact but
contained mutations to the remaining non-CArG regions, a mutational
strategy similar to that used for the pMut125CAT transfection
construct. When the M95 probe was reacted with
SMC nuclear extracts, an SRF-containing higher order complex formed
that was nearly identical to the complex formed with the wild-type
probe (Figure 7C, compare lanes 2 and 3). A mutation in CArG A
that had previously been shown to inhibit SRF binding and the
functional activity of the p125CAT construct had no effect on complex
formation (lane 4), whereas a similar mutation in CArG B caused nearly
complete disruption of all protein interactions with the 95-bp probe
(lanes 5 and 6). These data indicate that formation of the higher order
SRF-containing shift complex was primarily due to SRF mediated
protein-protein interactions but also required that the CArG B element
be contained within a minimal-length (ie, 95-bp) probe that may have
provided a structural backbone to stabilize the shift complex. In an
attempt to characterize the protein-protein and protein-DNA
interactions within the SRF-containing shift complex, we systematically
tested a large number of gel-shift variables, including ionic
strength, ionic composition, pH, DNA template concentrations, extract
concentrations, competitor rSRF protein, and detergent addition.
Interestingly, none of these treatments disrupted the formation of the
SRF-containing complex without disrupting SRF binding to CArG B.
Importantly, although we showed that mutations to the CArG B 3' flanking region significantly decreased the functional activity of both the p125 and 2600Int constructs in SMCs, these mutations failed to affect formation of the CArG B-SRF higher order complex in in vitro gel-shift assays. Thus, the formation of the higher order CArG B complex in vitro is clearly not dependent on these flanking regions. However, we cannot rule out the possibility that the CArG B flanking region interacts with trans-acting factors within (or separate from) the higher order complex but that such interactions are simply not detectable under in vitro gel-shift conditions.
Reduced Mobilities of the SMC Shift Complexes Were Not due to
SRF-Induced DNA Bending
SRF binding is known to cause changes in DNA conformation that can
be responsible for significant differences in complex mobility when
long shift probes are used.43 We directly tested this
possibility by performing circular permutation assays in which the
position of the CArG B element was moved incrementally from one end of
a 95-bp probe to the other. The shift probes generated for these
experiments are shown in Figure 8A, and the EMSA results obtained are
depicted in Figure 8B. Changing the position of CArG B within a
95-bp probe had little effect on the mobility of complexes formed with
SMC extracts or rSRF, suggesting that SRF-induced DNA bending did not
contribute significantly to the mobility differences observed in these
in vitro experiments.
The Higher Order SRF-Containing SMC Shift Complex Did Not Contain
YY1 or the Known SRF Accessory Proteins SAP-1 or Elk-1
YY1 is a multifunctional transcription factor that has been shown
to bind CArG elements through contacts with both the internal A/T-rich
region as well as the 2 guanine residues on the end of the
element.38 39 Kim et al32 have shown that a
YY1-containing shift complex forms when SMC extracts are reacted with a
probe containing an SM-22 CArG that is identical to the CArG B sequence
at 8 of 10 nucleotide positions. Therefore, to determine
whether YY1 was present in any of the SMC DNA binding complexes, we
performed supershift analysis using both the CArG B and 95-bp
probes. Figure 9 shows that an anti-YY1
antibody, which we have previously used to supershift YY1-containing
complexes in EMSA, failed to affect our gel-shift results. Thus,
although YY1 may well bind the CArG regions of the SM -actin
promoter, its presence cannot account for the SMC shift complexes
observed in the present study.
|
We also tested whether the presence of any of the known SRF accessory
factors was responsible for the decreased mobility of the
SRF-containing higher order complex. In these experiments, we used
antibodies specific for Sap-1 and Elk-1 and a third antibody specific
for the highly conserved DNA binding domain of the Ets family of
transcription factors. Results (Figure 9) showed that none of
these antibodies had an effect on the binding complexes formed when SMC
extracts were combined with either the CArG B or 95-bp probes, although
they did react with ternary complexes formed with a c-fos
SRE probe (data not shown). Taken together, these results indicate that
none of the known Ets family members were contained within the unique
SMC SRF-containing shift complexes.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The central focus of the present study was to identify mechanisms whereby binding of the ubiquitously expressed transcription factor, SRF, to the SM
-actin CArGs contributes to SMC-specific
regulation of this gene. Studies
of CArG-mediated transcriptional control in promoters of other genes
suggest that cell-specific regulation via this element may be conferred
by a combination of differences in SRF expression, by the DNA sequences
within and flanking the CArG element, and by additional regulatory
motifs and trans factors that regulate the function of SRF
in a cell-type and promoter-specific
fashion.34 35 37 49 50 Results from the present
study provide evidence indicating that SMC-specific CArG-dependent
expression of SM -actin in vascular SMCs is likewise complex and
involves several unique interactive mechanisms including (1) the
structural positioning of the CArG A and B elements within the
promoter, (2) the formation of SRF-containing CArG binding complexes
that were unique to SMCs, and (3) the involvement of specific SM
-actin CArG flanking sequences.
The data from the present study demonstrate that spacing and
phasing of CArG B in relation to CArG A and possibly other core
promoter components are critical determinants of SM -actin promoter
activity. We have previously shown that specific CArG sequences are
required at each position, because switching CArGs A and B also
resulted in loss of promoter function in SMCs.48 Of
interest, virtually all SMC-specific promoters characterized to date,
including SM -actin, SM myosin heavy chain, and SM-22, contain
multiple conserved CArG elements that have been shown to be required
for maximal expression.17 29 30 Moreover, paired CArG
elements have also been shown to be required for expression of many
skeletal- and cardiac-specific genes.24 25 26 27 28 Thus, it is
possible that the specific structural requirements described herein may
apply to other SMC differentiation marker genes as well as to
CArG-dependent genes in other cell types. Indeed, Chow et
al44 have shown that the activity of the skeletal
-actin promoter was dependent on CArG spacing and phasing. It was
postulated by these authors that promoter activation occurred when
protein-induced changes in DNA conformation aligned the CArGs and other
required cis elements on the same face of the DNA, which
allowed recruitment of a transcription initiation complex.
Interestingly, the intronic CArG, which is located 1000 bp 3' to
CArGs A and B, is also required for in vivo expression of SM
-actin,19 but the importance of its positioning
within the promoter is unknown at this time. We do have preliminary
evidence from cell culture experiments demonstrating that the activity
of the intronic CArG region was not significantly affected by changes
in positioning (C.P. Mack and G.K. Owens, unpublished results, 1999).
However, this region functioned as an enhancer in only one orientation,
which argues that it does have at least some structural requirements.
The mechanisms by which SRF recruits components of the basal
transcriptional machinery are largely unknown. SRF has been shown to
directly bind the general transcription factor,
TFIIF,51 52 and SRF and Sap-1 have been shown to interact
with the transcription coactivators, p300 and CREB- binding
protein.53 54 55
We present several lines of evidence suggesting that SMC-specific
regulation of SM -actin expression may also involve binding of a
novel SRF accessory protein that is selectively expressed in SMCs.
First, extensive EMSA analysis showed that the mobility of the
complexes formed when SMC nuclear extracts were reacted with the 95-bp
probes that contained CArGs A and B or the intronic CArG could not be
attributed to the presence of SRF alone, because complexes formed with
rSRF alone ran significantly faster. Differences in probe length could
not account for these results, and Western analysis (data not
shown) confirmed that SRF in SMC extracts and rSRF were nearly
identical in size. However, we cannot rule out the possibility that
SMC-selective posttranscriptional modifications to SRF may have
affected SRF tertiary structure, dimerization, or DNA binding under the
nondenaturing conditions of gel-shift analyses and that these
differences were only detected when SRF was bound to the longer 95-bp
probe. Second, the results of methylation interference footprinting
studies on the SMC low-mobility shift complex showed extension of the
SRF footprint. When taken together with the results of our gel-shift
analyses, these data are consistent with the presence
of an additional protein in the SMC SRF-containing complex. Additional
EMSA analyses demonstrated that formation of this complex was
most likely the result of protein-protein interactions between the
unknown factor and SRF and not by specific interactions between the
unknown protein and specific CArG flanking sequences. However, a
significant stretch of nonspecific DNA flanking sequence was required
for complex formation, perhaps to stabilize the entire complex through
nonspecific protein-DNA interactions or through interactions based on
DNA structure. Third, the low-mobility SRF-containing complexes formed
with SMC extracts were distinct from those formed with the other cell
types tested, which ran with different mobilities than did the SMC
complexes. Fourth, based on supershift analyses, the higher
order complex did not appear to be due to binding of the known SRF
accessory proteins, since we could not supershift the low-mobility
complex with antibodies specific to Elk-1 or Sap-1 or with an antibody
that reacts with the conserved DNA binding domain of Ets protein family
members. However, results do not rule out the involvement of an
as-yet-unidentified member of the Ets protein family that does not
react with the antibodies tested.
Results from the present study provided clear evidence indicating
that the highly conserved CArG B 3' flanking region plays a key role in
SMC-specific expression of SM -actin, in that mutations to the CArG
B 3' flanking region abolished promoter activity in SMCs but had no
effect in BAECs. The requirement for specific flanking sequences for SM
-actin promoter activity is analogous to similar requirements in the
regulation of skeletal actin expression by the muscle response
element.36 However, these are the first studies to show
that such flanking sequences are involved in SMC-specific regulation of
an SMC differentiation marker such as SM -actin. Interestingly,
although mutations to the CArG B 3' flanking region abolished the
transcriptional activity of the P125 construct in SMCs, we were unable
to detect protein binding to this region. It is important to note that
formation of the unique SRF higher order complex in SMCs was not
dependent on specific DNA sequences in the 3' region because complete
mutation of this region had no effect on formation of that complex. As
such, we have no direct evidence that the functional activity of the
CArG B 3' flanking region and formation of the unique SRF complex are
related. If the 3' flanking region of CArG B does interact with the
higher order complex, it must be in a more subtle way that affects
complex conformation and/or activation instead of complex binding.
Consistent with this idea, studies by Acton et
al56 on the SRF-related yeast protein, MCM1, have shown
that mutations in CArG flanking sequences of the consensus MCM1 element
did not affect MCM1 binding but did affect MCM1-induced DNA bending and
promoter activation. It is also possible that formation of the higher
order complex might prevent binding to the CArG B 3' flanking region
because of its proximity and possible steric effects.
There is now extensive evidence demonstrating that muscle-specific gene
regulation is dependent on a complex interaction between multiple
independent cis elements or modules and their corresponding
trans factors (see References 37 and
57 for reviews). The nature of the protein interactions
within the higher order SRF-containing complex is of particular
interest because of recent evidence demonstrating that several
muscle-specific factors have been shown to interact with SRF to
regulate muscle-specific genes. For example, Chen and
Schwartz58 have shown that the heart-specific
homeobox factor, Nkx2.5, binds SRF and can
trans-activate the cardiac -actin promoter even
in the absence of Nkx2.5 DNA binding. Muscle-specific basic
helix-loop-helix proteins, such as Myo D and myogenin, have also been
shown to interact with not only SRF but also with other members of the
MADS box family (including MEF2) that contain conserved DNA binding
domains.59 Interestingly, the known SRF-associated
transcription factors have relatively low affinities for the Ets
binding site, but protein-protein interactions with SRF aid in their
binding to the c-fos SRE.22 60
Previous studies from this laboratory have demonstrated that regulation
of SRF binding to the SM -actin CArGs may be a critical pathway for
controlling SM -actin expression. Most CArG elements, although
highly conserved among species, show considerable differences in their
internal A/T-rich sequences when they are compared between promoters,
and such differences can have effects on SRF binding. The SM -actin
CArGs A and B, for example, bind SRF with low affinity because of G/C
substitutions in the A/T-rich core that are completely conserved across
all species in which that promoter has been cloned.61
Interestingly, in previous studies, we found that when the "weak"
SM -actin CArGs were replaced with the much stronger SRE CArG,
promoter activity increased dramatically and was no longer limited to
SMCs.48 In addition, we presented evidence
indicating that angiotensin II–induced upregulation of SM
-actin expression was mediated by increased expression of the
homeodomain protein, Mhox, which increased SRF binding to CArG
B.61 Importantly, Mhox itself was not found within the
SRF-containing gel-shift complexes and could not account for the SMC
SRF-containing higher order complex. Taken together, our results
suggest that cooperative interactions between multiple CArG elements,
G/C substitutions within the internal A/T-rich region, and the
accompanying regulation of SRF binding provide still other mechanisms
for CArG-dependent regulation of SMC gene expression. Such regulatory
mechanisms may also be shared by CArG-dependent genes in other muscle
cell types. For example, Lee et al28 have demonstrated
that 3 CArG elements are essential for skeletal -actin expression
and that SRF binding to 2 strong CArGs facilitates binding of SRF to
the third relatively weak CArG element. Cooperative SRF binding to the
95-bp probe was not detected in the present study, but perhaps
other factors within SMC may mediate the SMC-specific increase in SRF
binding and thus the activation of CArG-dependent SMC genes.
In conclusion, the data in the present study and in others suggest
that SMC-specific regulation of SM -actin expression is CArG
dependent and that several mechanisms are involved, including (1)
increased SRF expression in SMCs, (2) SRF binding to CArG elements that
have precise structural requirements relative to one another, (3)
unique combinatorial interactions with other regulatory elements
including the region flanking CArG B, (4) a unique SMC-selective
SRF-containing complex bound to the CArG B and intronic CArG regions of
the promoter, and (5) homeodomain protein-mediated regulation of SRF
binding to CArG elements that exhibit reduced SRF binding affinity.
Taken together, results suggest that SRF complexes that are bound to
the SM -actin CArGs, perhaps aided by SRF-induced changes in DNA
conformation, coordinate the assembly of a higher order transcription
complex that activates SM -actin gene expression (Figure 10). In any case, given the requirement of CArG elements for the
expression of multiple SMC differentiation marker
genes,19 29 30 31 it is clear that further studies to
identify ubiquitous and/or SMC-specific transcription factors that
interact with SRF to control SM -actin gene expression may provide
key insight regarding the molecular mechanisms that control SMC
differentiation.
|
|
Acknowledgments |
|---|
This study was supported by grants R01 HL-38854, P01 HL-19242, and F32 HL-10038 from the National Institutes of Health and Fellowship Grant VA-96-F-20 from the Virginia Affiliate of the American Heart Association. We gratefully acknowledge the excellent technical assistance of Diane Raines and Andrea Tanner. We would also like to thank Jennifer Clatterbuck for her help in preparing this manuscript.
Received October 19, 1999; accepted October 26, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Ross R. The pathogenesis of atherosclerosis. N Engl J Med. 1976;295(pt 1):369–377.
2. Schwartz SM, Ross R. Cellular proliferation in atherosclerosis and hypertension. Prog Cardiovasc Dis. 1984;26:355–372.[Medline] [Order article via Infotrieve]
3.
Owens GK. Regulation of differentiation of vascular
smooth muscle cells. Physiol Rev. 1995;75:487–517.
4. Chamley-Campbell JH, Campbell GR. What controls smooth muscle phenotype? Atherosclerosis. 1981;40:347–357.[Medline] [Order article via Infotrieve]
5.
Glukhova MA, Kabakov AE, Frid MG, Ornatski OI, Belkin
AM, Muhkin AM, Orekov AN, Koteliansky VE, Smirnov VN. Modulation of
human aorta smooth muscle cell phenotype: a study of
muscle-specific variants of vinculin, caldesmon, and actin expression.
Proc Nat Acad Sci U S A. 1988;85:9542–9546.
6. Liau G, Winkles JA, Cannnon MS, Kuo L, Chililan WM. Dietary-induced atherosclerotic lesions have increased levels of acidic FGF mRNA and altered cytoskeletal and extracellular matrix mRNA expression. J Vasc Res. 1993;30:327–332.[Medline] [Order article via Infotrieve]
7. Kocher O, Gabbiani F, Gabbiani G, Reidy MA, Cokay MS, Peters H, Huttner I. Phenotypic features of smooth muscle cells during the evolution of experimental carotid artery intimal thickening: biochemical and morphologic studies. Lab Invest. 1991;65:459–470.[Medline] [Order article via Infotrieve]
8. Kocher O, Gabbiani G. Cytoskeletal features of normal and atheromatous human arterial smooth muscle cells. Hum Pathol. 1986;17:875–880.[Medline] [Order article via Infotrieve]
9. Duband JL, Gimona M, Scatena S, Sartore S, Small JV. Calponin and SM22 as differentiation markers of smooth muscle: spatiotemporal distribution during avian embryonic development. Differentiation. 1993;55:1–11.[Medline] [Order article via Infotrieve]
10.
Fatigati V, Murphy RA. Actin and tropomyosin variants
in smooth muscle: dependence on tissue type. J Biol
Chem. 1984;259:14383–14388.
11. Darby I, Skalli O, Gabbiani G. Alpha-smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Lab Invest. 1990;63:21–29.[Medline] [Order article via Infotrieve]
12. Woodcock-Mitchell J, Mitchell JJ, Low RB, Kieny M, Sengel P, Rubbia L, Skalli O, Jackson B, Gabbiani G. Alpha-smooth muscle actin is transiently expressed in embryonic rat cardiac and skeletal muscles. Differentiation. 1988;39:161–166.[Medline] [Order article via Infotrieve]
13.
Min BH, Foster DN, Strauch AR. The 5'-flanking region
of the mouse vascular smooth muscle alpha-actin gene contains
evolutionarily conserved sequence motifs within a functional promoter.
J Biol Chem. 1990;265:16667–16675.
14.
Carroll SL, Bergsma DJ, Schwartz RJ. The
29-nucleotide DNA segment containing an evolutionarily
conserved motif is required in cis for cell-type-restricted repression
of the chicken alpha-smooth muscle actin gene core promoter. Mol
Cell Biol. 1988;8:241–250.
15. Nakano Y, Nishihara T, Sasayama S, Miwa T, Kamada S, Kakunaga T. Transcriptional regulatory elements in the 5' upstream and first intron regions of the human smooth muscle (aortic type) alpha-actin-encoding gene. Gene. 1991;99:285–289.[Medline] [Order article via Infotrieve]
16.
Blank RS, McQuinn TC, Yin DC, Thompson MM, Takeyasu K,
Schwartz RJ, Owens GK. Elements of the smooth muscle alpha-actin
promoter required in cis for transcriptional activation in smooth
muscle. J Biol Chem. 1992;267:984–989.
17.
Shimizu RT, Blank RS, Jarvis R, Lawrenz-Smith SC, Owens
GK. The smooth muscle alpha-actin gene promoter is differentially
regulated in smooth muscle versus non-smooth muscle cells. J
Biol Chem. 1995;270:7631–7643.
18.
Foster DN, Min B, Foster LK, Stoflet ES, Sun S, Getz
MJ, Strauch AR. Positive and negative cis acting regulatory elements
mediate expression of the mouse vascular smooth muscle alpha-actin
gene. J Biol Chem. 1992;267:11995–12003.
19.
Mack CP, Owens GK. Regulation of smooth muscle
-actin expression in vivo is dependent on CArG elements within the
5' and first intron promoter regions. Circ Res. 1999;84:852–861.
20. Treisman R. The serum response element. Trends Biochem Sci. 1992;17:423–426.[Medline] [Order article via Infotrieve]
21.
Giovane A, Pintzas A, Maira S, Sobieszczuk P, Wasylyk
B. Net, a new ets transcription factor that is activated by
Ras. Genes Dev. 1994;8:1502–1513.
22. Dalton S, Treisman R. Characterization of SAP-1, protein recruited by serum response factor to the c-fos serum response element. Cell. 1992;68:597–612.[Medline] [Order article via Infotrieve]
23. Price MA, Rogers AE, Treisman R. Comparative analysis of the ternary complex facts elk-1, SAT-1a and SAP-2 (ERP/NET). EMBO J. 1995;14:2589–2601.[Medline] [Order article via Infotrieve]
24.
Gustafson TA, Miwa T, Boxer LM, Kedes L. Interaction of
nuclear proteins with muscle-specific regulatory sequences of the human
cardiac alpha-actin promoter. Mol Cell Biol. 1988;8:4110–4119.
25.
Chow K. Schwartz RJ. A combination of closely
associated positive and negative cis-actin promoter elements regulates
transcription of the skeletal alpha-actin gene. Mol Cell
Biol. 1990;10:528–538.
26.
Papadopoulos N, Crow MT. Transcriptional control of the
chicken cardiac myosin light-chain gene is mediated by two AT-rich
cis-actin DNA elements and binding of serum response factor. Mol
Cell Biol. 1993;13:6907–6918.
27. Mohun TJ, Taylor MV, Garrett N, Gurdon JB. The CArG promoter sequence is necessary for muscle-specific transcription of the cardiac actin gene in Xenopus embryo. EMBO J. 1989;8:1153–1161.[Medline] [Order article via Infotrieve]
28.
Lee T, Chow K, Fang P, Schwartz RJ. Activation of
skeletal alpha-actin gene transcription: the cooperative formation of
serum response factor-binding complexes of positive cis-acting promoter
serum response elements displace a negative acting nuclear factor
enriched in replicating myoblasts and nonmyogenic cells. Mol Cell
Biol. 1991;11:5090–5100.
29.
Madsen CS, Hershey JC, Hautmann MB, White SL, Owens GK.
Expression of the smooth muscle myosin heavy chain gene is regulated by
a negative-actin GC-rich element located between two positive-acting
serum response factor-binding elements. J Biol Chem. 1997;272:6332–6340.
30.
Li L, Miano JM, Mercer B, Olson EN. Expression of the
SM22 alpha promoter in transgenic mice provides evidence for distinct
transcriptional regulatory programs in vascular and visceral smooth
muscle cells. J Cell Biol. 1996;132:849–859.
31.
Herring BP, Smith AF. Telokin expression in A10 smooth
muscle cells requires serum response factor. Am J
Physiol. 1997;272:C1394–C1404.
32.
Kim S, Ip HS, Lu MM, Clendenin C, Parmacek MS. A serum
response factor-dependent transcriptional regulatory program identifies
distinct smooth muscle cell sublineages. Mol Cell Biol. 1997;17:2266–2278.
33. Li L, Liu Z, Mercer B, Overbeek P, Olson EN. Evidence for serum response factor-mediated regulatory networks governing SM22 alpha transcription in smooth, skeletal, and cardiac muscle cells. Dev Biol. 1997;187:311–321.[Medline] [Order article via Infotrieve]
34. Croissant JD, Kim J, Eichele G, Goering L, Lough J, Prywes R, Schwartz RJ. Avian serum response factor expression restricted primarily to muscle cell lineages is required for alpha-actin gene transcription. Dev Biol. 1996;177:250–264.[Medline] [Order article via Infotrieve]
35.
Belaguli NS, Schildmeyer LA, Schwartz RJ. Organization
and myogenic restricted expression of the murine serum response factor
gene. J Biol Chem. 1997;272:18222–18231.
36.
Santoro IM, Walsh K. Natural and synthetic DNA elements
with the CArG motif differ in expression and protein-binding
properties. Mol Cell Biol. 1991;11:6296–6305.
37.
Sartorelli V, Kurabayashi M, Kedes L. Muscle-specific
gene expression: a comparison of cardiac and skeletal transcription
strategies. Circ Res. 1993;72:925–931.
38.
Natesan S, Gilman M. YY1 facilitates the association of
serum response factor with the c-fos serum response element. Mol
Cell Biol. 1995;15:5975–5982.
39. Martin KA, Gualberto A, Kolman MF, Lowry J, Walsh K. A competitive mechanism of CArG element regulation by YY1 and SRF: implications for assessment of Phox1/Mhox transcription factor interactions at CArG elements. DNA Cell Biol. 1997;16:653–661.[Medline] [Order article via Infotrieve]
40.
Becker KG, Swergold GD, Ozato K, Thayer RE.
Binding of the ubiquitous nuclear transcription factor YY1 to a cis
regulatory sequence in the human LINE-1 transposable element. Hum
Mol Genet. 1993;2:1697–1702.
41.
Chen C, Schwartz RJ. Competition between
negative acting YY1 versus positive acting serum response factor and
tinman homologue Nkx-2.5 regulates cardiac alpha-actin promoter
activity. Mol Endocrinol. 1997;11:812–822.
42.
Moss JB, McQuinn TC, Schwartz RJ. The avian cardiac
alpha-actin promoter is regulated through a pair of complex elements
composed of E boxes and serum response elements that bind both
positive- and negative-acting factors. J Biol Chem. 1994;269:12731–12740.
43.
Sharrocks AD, Shore P. DNA bending in the ternary
nucleoprotein complex at the c-fos promoter. Nucleic Acids
Res. 1995;23:2442–2449.
44.
Chow K, Hogan ME, Schwartz RJ. Phased cis-acting
promoter elements interact at short distances to direct avian skeletal
alpha-actin gene transcription. Proc Natl Acad Sci U S A. 1991;88:1301–1305.
45.
Yaffe D. Retention of differentiation potentialities
during prolonged cultivation of myogenic cells. Proc Natl Acad
Sci U S A. 1968;61:477–483.
46.
Dignam JD, Lebovitz RM, Roeder RG. Accurate
transcription initiation by RNA polymerase II in a soluble extract from
isolated mammalian nuclei. Nucleic Acids Res. 1983;11:1475–1489.
47. Hautmann MB, Madsen CS, Owens GK. A transforming growth factor beta control element drives TGF-induced stimulation of smooth muscle alpha-actin gene expression in concert with two CArG elements. J Biol Chem. 1997;272–10948-10956:.
48.
Hautmann MB, Madsen CS, Mack CP, Owens GK. Substitution
of the degenerate smooth muscle (SM) -actin
CC(A/T-rich)6 elements with c-fos
serum response elements results in increased basal expression but
relaxed SM cell specificity and reduced angiotensin II
inducibility. J Biol Chem. 1998;273:8398–8406.
49. Hill CS, Marais R, John S, Wynne J, Dalton S, Treisman R. Functional analysis of growth factor-responsive transcription factor complex. Cell. 1993;73–395-406.
50. Marais R, Wynne J, Treisman R. The SRF-accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell. 1993;73–383-393.
51.
Sartorelli V, Huang J, Hamamori Y, Kedes L. Molecular
mechanisms of myogenic coactivation by p300: direct interaction with
the activation domain of MyoD and with the MADS box of MEF2C. Mol
Cell Biol. 1997;17:1010–1026.
52.
Zhu H, Joliot V, Prywes R. Role of transcription factor
TFIIF in serum response factor-activated transcription.
J Biol Chem. 1994;269:3489–3497.
53. Janknecht R, Nordheim A. Regulation of the c-fos promoter by the ternary complex factor Sap-1a and its coactivator CBP. Oncogene. 1996;12:1961–1969.[Medline] [Order article via Infotrieve]
54. Joliot V, Demma M, Prywes R. Interaction with RAP74 subunit of TFIIF is required for transcriptional activation by serum response factor. Nature. 1995;373:632–635.[Medline] [Order article via Infotrieve]
55.
Ramirez S, Ali SAS, Robin P, Roughce D, Harel-Bellan A.
The CREB-binding protein cooperates with the serum response factor for
transactivation of the c-fos serum response element. J Biol
Chem. 1997;272:31016–31021.
56.
Acton TB, Zhong H, Vershon AK. DNA-binding specificity
of MCM1: operator mutations that alter DNA-bending and transcriptional
activities by a MADS box protein. Mol Cell Biol. 1997;17:1881–1889.
57. Firulli AB, Olson EN. Modular regulation of muscle gene transcription: a mechanism for muscle cell diversity. Trends Genet. 1997;13:364–369.[Medline] [Order article via Infotrieve]
58.
Chen C, Schwartz RJ. Recruitment of the tinman
homologue Nkx2.5 by serum response factor activates cardiac
alpha-actin gene transcription. Mol Cell Biol. 1996;16:6372–6384.
59. Molkentin JD, Black BL, Martin JF, Olson EN. Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell. 1995;83:1125–1136.[Medline] [Order article via Infotrieve]
60. Shaw PE, Schoroter H, Nordheim A. The ability of the ternary complex to form over the serum response element correlates with the serum inducibility of the human c-fos promoter. Cell. 1989;56:563–572.[Medline] [Order article via Infotrieve]
61.
Hautmann MH, Thompson MM, Swartz EZ, Olson EN, Owens
GK. Angiotensin II–induced stimulation of smooth
muscle -actin expression by serum response factor and the
homeodomain transcription factor Mhox. Circ Res. 1997;81:600–610.
This article has been cited by other articles:
 |
|
 |
|
  A. L. Blaker, J. M. Taylor, and C. P. Mack PKA-Dependent Phosphorylation of Serum Response Factor Inhibits Smooth Muscle-Specific Gene Expression Arterioscler Thromb Vasc Biol, December 1, 2009; 29(12): 2153 - 2160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Li, Z. Niu, W. Yu, Y. Qian, Q. Wang, Q. Li, Z. Yi, J. Luo, X. Wu, Y. Wang, et al. SMYD1, the myogenic activator, is a direct target of serum response factor and myogenin Nucleic Acids Res., November 1, 2009; 37(21): 7059 - 7071. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yoshida, Q. Gan, and G. K. Owens Kruppel-like factor 4, Elk-1, and histone deacetylases cooperatively suppress smooth muscle cell differentiation markers in response to oxidized phospholipids Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1175 - C1182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Elberg, L. Chen, D. Elberg, M. D. Chan, C. J. Logan, and M. A. Turman MKL1 mediates TGF-{beta}1-induced {alpha}-smooth muscle actin expression in human renal epithelial cells Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1116 - F1128. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Lockman, J. M. Taylor, and C. P. Mack The Histone Demethylase, Jmjd1a, Interacts With the Myocardin Factors to Regulate SMC Differentiation Marker Gene Expression Circ. Res., December 7, 2007; 101(12): e115 - e123. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Zhu, K. G. Harutyunyan, J. L. Peng, J. Wang, R. J. Schwartz, and J. W. Belmont Identification of a novel role of ZIC3 in regulating cardiac development Hum. Mol. Genet., July 15, 2007; 16(14): 1649 - 1660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. G. McDonald and G. K. Owens Programming Smooth Muscle Plasticity With Chromatin Dynamics Circ. Res., May 25, 2007; 100(10): 1428 - 1441. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Chai, M. Norng, A. S Tarnawski, and J. Chow A critical role of serum response factor in myofibroblast differentiation during experimental oesophageal ulcer healing in rats Gut, May 1, 2007; 56(5): 621 - 630. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Staus, A. L. Blaker, J. M. Taylor, and C. P. Mack Diaphanous 1 and 2 Regulate Smooth Muscle Cell Differentiation by Activating the Myocardin-Related Transcription Factors Arterioscler Thromb Vasc Biol, March 1, 2007; 27(3): 478 - 486. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Fan, A. Sebe, Z. Peterfi, A. Masszi, A. C.P. Thirone, O. D. Rotstein, H. Nakano, C. A. McCulloch, K. Szaszi, I. Mucsi, et al. Cell Contact-dependent Regulation of Epithelial-Myofibroblast Transition via the Rho-Rho Kinase-Phospho-Myosin Pathway Mol. Biol. Cell, March 1, 2007; 18(3): 1083 - 1097. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. S.M. Rensen, P. M.G. Niessen, X. Long, P. A. Doevendans, J. M. Miano, and G. J.J.M. van Eys Contribution of serum response factor and myocardin to transcriptional regulation of smoothelins Cardiovasc Res, April 1, 2006; 70(1): 136 - 145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. Howson, A. C. Aplin, M. Gelati, G. Alessandri, E. A. Parati, and R. F. Nicosia The postnatal rat aorta contains pericyte progenitor cells that form spheroidal colonies in suspension culture Am J Physiol Cell Physiol, December 1, 2005; 289(6): C1396 - C1407. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kawai-Kowase, M. S. Kumar, M. H. Hoofnagle, T. Yoshida, and G. K. Owens PIAS1 Activates the Expression of Smooth Muscle Cell Differentiation Marker Genes by Interacting with Serum Response Factor and Class I Basic Helix-Loop-Helix Proteins Mol. Cell. Biol., September 15, 2005; 25(18): 8009 - 8023. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Tomasek, J. McRae, G. K. Owens, and C. J. Haaksma Regulation of {alpha}-Smooth Muscle Actin Expression in Granulation Tissue Myofibroblasts Is Dependent on the Intronic CArG Element and the Transforming Growth Factor-{beta}1 Control Element Am. J. Pathol., May 1, 2005; 166(5): 1343 - 1351. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Liu, S. Sinha, O. G. McDonald, Y. Shang, M. H. Hoofnagle, and G. K. Owens Kruppel-like Factor 4 Abrogates Myocardin-induced Activation of Smooth Muscle Gene Expression J. Biol. Chem., March 11, 2005; 280(10): 9719 - 9727. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Vlahopoulos, W. E. Zimmer, G. Jenster, N. S. Belaguli, S. P. Balk, A. O. Brinkmann, R. B. Lanz, V. C. Zoumpourlis, and R. J. Schwartz Recruitment of the Androgen Receptor via Serum Response Factor Facilitates Expression of a Myogenic Gene J. Biol. Chem., March 4, 2005; 280(9): 7786 - 7792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sato, K. Kawai-Kowase, H. Sato, Y. Oyama, H. Kanai, Y. Ohyama, T. Suga, T. Maeno, Y. Aoki, J. Tamura, et al. c-Src and Hydrogen Peroxide Mediate Transforming Growth Factor-{beta}1-Induced Smooth Muscle Cell-Gene Expression in 10T1/2 Cells Arterioscler Thromb Vasc Biol, February 1, 2005; 25(2): 341 - 347. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Stolle, B. Weitkamp, J. Rauterberg, S. Lorkowski, and P. Cullen Laser Microdissection-based Analysis of mRNA Expression in Human Coronary Arteries with Intimal Thickening J. Histochem. Cytochem., November 1, 2004; 52(11): 1511 - 1518. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Lockman, J. S. Hinson, M. D. Medlin, D. Morris, J. M. Taylor, and C. P. Mack Sphingosine 1-Phosphate Stimulates Smooth Muscle Cell Differentiation and Proliferation by Activating Separate Serum Response Factor Co-factors J. Biol. Chem., October 8, 2004; 279(41): 42422 - 42430. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Halayko, S. Kartha, G. L. Stelmack, J. McConville, J. Tam, B. Camoretti-Mercado, S. M. Forsythe, M. B. Hershenson, and J. Solway Phophatidylinositol-3 Kinase/Mammalian Target of Rapamycin/p70S6K Regulates Contractile Protein Accumulation in Airway Myocyte Differentiation Am. J. Respir. Cell Mol. Biol., September 1, 2004; 31(3): 266 - 275. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. K. Owens, M. S. Kumar, and B. R. Wamhoff Molecular Regulation of Vascular Smooth Muscle Cell Differentiation in Development and Disease Physiol Rev, July 1, 2004; 84(3): 767 - 801. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Dandre and G. K. Owens Platelet-derived growth factor-BB and Ets-1 transcription factor negatively regulate transcription of multiple smooth muscle cell differentiation marker genes Am J Physiol Heart Circ Physiol, June 1, 2004; 286(6): H2042 - H2051. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Anderson, E. Dodou, A. B. Heidt, S. J. De Val, E. J. Jaehnig, S. B. Greene, E. N. Olson, and B. L. Black HRC Is a Direct Transcriptional Target of MEF2 during Cardiac, Skeletal, and Arterial Smooth Muscle Development In Vivo Mol. Cell. Biol., May 1, 2004; 24(9): 3757 - 3768. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yoshida, M. H. Hoofnagle, and G. K. Owens Myocardin and Prx1 Contribute to Angiotensin II-Induced Expression of Smooth Muscle {alpha}-Actin Circ. Res., April 30, 2004; 94(8): 1075 - 1082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kaplan-Albuquerque, C. Garat, C. Desseva, P. L. Jones, and R. A. Nemenoff Platelet-derived Growth Factor-BB-mediated Activation of Akt Suppresses Smooth Muscle-specific Gene Expression through Inhibition of Mitogen-activated Protein Kinase and Redistribution of Serum Response Factor J. Biol. Chem., October 10, 2003; 278(41): 39830 - 39838. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Kelm Jr., S.-X. Wang, J. A. Polikandriotis, and A. R. Strauch Structure/Function Analysis of Mouse Pur{beta}, a Single-stranded DNA-binding Repressor of Vascular Smooth Muscle {alpha}-Actin Gene Transcription J. Biol. Chem., October 3, 2003; 278(40): 38749 - 38757. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Nelander, P. Mostad, and P. Lindahl Prediction of Cell Type-Specific Gene Modules: Identification and Initial Characterization of a Core Set of Smooth Muscle-Specific Genes Genome Res., August 1, 2003; 13(8): 1838 - 1854. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Zeidan, I. Nordstrom, S. Albinsson, U. Malmqvist, K. Sward, and P. Hellstrand Stretch-induced contractile differentiation of vascular smooth muscle: sensitivity to actin polymerization inhibitors Am J Physiol Cell Physiol, June 1, 2003; 284(6): C1387 - C1396. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yoshida, S. Sinha, F. Dandre, B. R. Wamhoff, M. H. Hoofnagle, B. E. Kremer, D.-Z. Wang, E. N. Olson, and G. K. Owens Myocardin Is a Key Regulator of CArG-Dependent Transcription of Multiple Smooth Muscle Marker Genes Circ. Res., May 2, 2003; 92(8): 856 - 864. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Kumar, J. A. Hendrix, A. D. Johnson, and G. K. Owens Smooth Muscle {alpha}-Actin Gene Requires Two E-Boxes for Proper Expression In Vivo and Is a Target of Class I Basic Helix-Loop-Helix Proteins Circ. Res., May 2, 2003; 92(8): 840 - 847. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Kumar and G. K. Owens Combinatorial Control of Smooth Muscle-Specific Gene Expression Arterioscler Thromb Vasc Biol, May 1, 2003; 23(5): 737 - 747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Masszi, C. Di Ciano, G. Sirokmany, W. T. Arthur, O. D. Rotstein, J. Wang, C. A. G. McCulloch, L. Rosivall, I. Mucsi, and A. Kapus Central role for Rho in TGF-beta 1-induced alpha -smooth muscle actin expression during epithelial-mesenchymal transition Am J Physiol Renal Physiol, May 1, 2003; 284(5): F911 - F924. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L'honore, N. J. Lamb, M. Vandromme, P. Turowski, G. Carnac, and A. Fernandez MyoD Distal Regulatory Region Contains an SRF Binding CArG Element Required for MyoD Expression in Skeletal Myoblasts and during Muscle Regeneration Mol. Biol. Cell, May 1, 2003; 14(5): 2151 - 2162. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Xu, Y.-S. Ho, R. P. Ritchie, and L. Li Human SM22alpha BAC encompasses regulatory sequences for expression in vascular and visceral smooth muscles at fetal and adult stages Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1398 - H1407. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Schauwienold, C. Plum, T. Helbing, P. Voigt, T. Bobbert, D. Hoffmann, M. Paul, and H. P. Reusch ERK1/2-Dependent Contractile Protein Expression in Vascular Smooth Muscle Cells Hypertension, March 1, 2003; 41(3): 546 - 552. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Meech, H. Makarenkova, D. B. Edelman, and F. S. Jones The Homeodomain Protein Barx2 Promotes Myogenic Differentiation and Is Regulated by Myogenic Regulatory Factors J. Biol. Chem., February 28, 2003; 278(10): 8269 - 8278. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Sepulveda, S. Vlahopoulos, D. Iyer, N. Belaguli, and R. J. Schwartz Combinatorial Expression of GATA4, Nkx2-5, and Serum Response Factor Directs Early Cardiac Gene Activity J. Biol. Chem., July 5, 2002; 277(28): 25775 - 25782. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang, M. Su, J. Fan, A. Seth, and C. A. McCulloch Transcriptional Regulation of a Contractile Gene by Mechanical Forces Applied through Integrins in Osteoblasts J. Biol. Chem., June 14, 2002; 277(25): 22889 - 22895. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Layne, S.-F. Yet, K. Maemura, C.-M. Hsieh, X. Liu, B. Ith, M.-E. Lee, and M. A. Perrella Characterization of the Mouse Aortic Carboxypeptidase-Like Protein Promoter Reveals Activity in Differentiated and Dedifferentiated Vascular Smooth Muscle Cells Circ. Res., April 5, 2002; 90(6): 728 - 736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. E. Carlini, M. J. Getz, A. R. Strauch, and R. J. Kelm Jr. Cryptic MCAT Enhancer Regulation in Fibroblasts and Smooth Muscle Cells. SUPPRESSION OF TEF-1 MEDIATED ACTIVATION BY THE SINGLE-STRANDED DNA-BINDING PROTEINS, Puralpha , Purbeta , and MSY1 J. Biol. Chem., March 1, 2002; 277(10): 8682 - 8692. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Nishida, M. Nakamura, S. Mori, M. Takahashi, Y. Ohkawa, S. Tadokoro, K. Yoshida, K. Hiwada, K.'i. Hayashi, and K. Sobue A Triad of Serum Response Factor and the GATA and NK Families Governs the Transcription of Smooth and Cardiac Muscle Genes J. Biol. Chem., February 22, 2002; 277(9): 7308 - 7317. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Geraci, M. Moore, T. Gesell, M. E. Yeager, L. Alger, H. Golpon, B. Gao, J. E. Loyd, R. M. Tuder, and N. F. Voelkel Gene Expression Patterns in the Lungs of Patients With Primary Pulmonary Hypertension : A Gene Microarray Analysis Circ. Res., March 30, 2001; 88(6): 555 - 562. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ribault, P. Neuville, A. Mechine-Neuville, F. Auge, A. Parlakian, G. Gabbiani, D. Paulin, and V. Calenda Chimeric Smooth Muscle-Specific Enhancer/Promoters : Valuable Tools for Adenovirus-Mediated Cardiovascular Gene Therapy Circ. Res., March 16, 2001; 88(5): 468 - 475. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ausoni and S. Sartore Cell Lineages and Tissue Boundaries in Cardiac Arterial and Venous Poles : Developmental Patterns, Animal Models, and Implications for Congenital Vascular Diseases Arterioscler Thromb Vasc Biol, March 1, 2001; 21(3): 312 - 320. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Halayko and J. Solway Plasticity in Skeletal, Cardiac, and Smooth Muscle: Invited Review: Molecular mechanisms of phenotypic plasticity in smooth muscle cells J Appl Physiol, January 1, 2001; 90(1): 358 - 368. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Garat, V. Van Putten, Z. A. Refaat, C. Dessev, S.-Y. Han, and R. A. Nemenoff Induction of Smooth Muscle alpha -Actin in Vascular Smooth Muscle Cells by Arginine Vasopressin Is Mediated by c-Jun Amino-terminal Kinases and p38 Mitogen-activated Protein Kinase J. Biol. Chem., July 14, 2000; 275(29): 22537 - 22543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. P. Mack, A. V. Somlyo, M. Hautmann, A. P. Somlyo, and G. K. Owens Smooth Muscle Differentiation Marker Gene Expression Is Regulated by RhoA-mediated Actin Polymerization J. Biol. Chem., January 5, 2001; 276(1): 341 - 347. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nakamura, W. Nishida, S. Mori, K. Hiwada, K.'i. Hayashi, and K. Sobue Transcriptional Activation of beta -Tropomyosin Mediated by Serum Response Factor and a Novel Barx Homologue, Barx1b, in Smooth Muscle Cells J. Biol. Chem., May 18, 2001; 276(21): 18313 - 18320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Phiel, V. Gabbeta, L. M. Parsons, D. Rothblat, R. P. Harvey, and K. M. McHugh Differential Binding of an SRF/NK-2/MEF2 Transcription Factor Complex in Normal Versus Neoplastic Smooth Muscle Tissues J. Biol. Chem., September 7, 2001; 276(37): 34637 - 34650. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Su, S. Mitra, H. Gregg, S. Flavahan, M. A. Chotani, K. R. Clark, P. J. Goldschmidt-Clermont, and N. A. Flavahan Redox Regulation of Vascular Smooth Muscle Cell Differentiation Circ. Res., July 6, 2001; 89(1): 39 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Layne, S.-F. Yet, K. Maemura, C.-M. Hsieh, X. Liu, B. Ith, M.-E. Lee, and M. A. Perrella Characterization of the Mouse Aortic Carboxypeptidase-Like Protein Promoter Reveals Activity in Differentiated and Dedifferentiated Vascular Smooth Muscle Cells Circ. Res., April 5, 2002; 90(6): 728 - 736. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||