Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation Research
Search: search_blue_button Advanced Search
Circulation Research. 2000;86:175-184

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, S.-k.
Right arrow Articles by Yue, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, S.-k.
Right arrow Articles by Yue, D. T.
Related Collections
Right arrow Congestive
Right arrow Gene therapy
Right arrow Arrythmias-basic studies
Right arrow Calcium cycling/excitation-contraction coupling
Right arrow Ion channels/membrane transport
(Circulation Research. 2000;86:175.)
© 2000 American Heart Association, Inc.


Cellular Biology

Ca2+ Channel Modulation by Recombinant Auxiliary ß Subunits Expressed in Young Adult Heart Cells

Shao-kui Wei, Henry M. Colecraft, Carla D. DeMaria, Blaise Z. Peterson, Rui Zhang, Trudy A. Kohout, Terry B. Rogers, David T. Yue

From the Program in Molecular and Cellular Systems Physiology (S.-k.W., H.M.C., C.D.D., B.Z.P., R.Z., D.T.Y.), Departments of Biomedical Engineering and Neuroscience, Johns Hopkins University School of Medicine, Baltimore, Md; Department of Medicine (T.A.K.), Howard Hughes Medical Institute, Duke University, Durham, NC; and Department of Biochemistry and Molecular Biology (T.B.R.), University of Maryland School of Medicine, Baltimore, Md.

Correspondence to David T. Yue, MD, PhD, Ross Building, Room 713, Johns Hopkins University School of Medicine, 720 Rutland Ave, Baltimore, MD 21205. E-mail dyue{at}bme.jhu.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—L-type Ca2+ channels contribute importantly to the normal excitation-contraction coupling of physiological hearts, and to the functional derangement seen in heart failure. Although Ca2+ channel auxiliary ß1–4 subunits are among the strongest modulators of channel properties, little is known about their role in regulating channel behavior in actual heart cells. Current understanding draws almost exclusively from heterologous expression of recombinant subunits in model systems, which may differ from cardiocytes. To study ß-subunit effects in the cardiac setting, we here used an adenoviral-component gene-delivery strategy to express recombinant ß subunits in young adult ventricular myocytes cultured from 4- to 6-week-old rats. The main results were the following. (1) A component system of replication-deficient adenovirus, poly-L-lysine, and expression plasmids encoding ß subunits could be optimized to transfect young adult myocytes with 1% to 10% efficiency. (2) A reporter gene strategy based on green fluorescent protein (GFP) could be used to identify successfully transfected cells. Because fusion of GFP to ß subunits altered intrinsic ß-subunit properties, we favored the use of a bicistronic expression plasmid encoding both GFP and a ß subunit. (3) Despite the heteromultimeric composition of L-type channels (composed of {alpha}1C, ß, and {alpha}2{delta}), expression of recombinant ß subunits alone enhanced Ca2+ channel current density up to 3- to 4-fold, which argues that ß subunits are "rate limiting" for expression of current in heart. (4) Overexpression of the putative "cardiac" ß2a subunit more than halved the rate of voltage-dependent inactivation at +10 mV. This result demonstrates that ß subunits can tune inactivation in the myocardium and suggests that other ß subunits may be functionally dominant in the heart. Overall, this study points to the possible therapeutic potential of ß subunits to ameliorate contractile dysfunction and excitability in heart failure.


Key Words: Ca2+ channel • ß subunit • adenovirus • gene delivery


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Voltage-gated L-type Ca2+ channels provide the essential trigger Ca2+ that initiates excitation-contraction coupling in heart.1 Not only do these channels figure prominently in the normal functioning of the heart, there are tantalizing hints that L-type channels contribute importantly to the functional derangement of heart failure2 3 that includes prolonged action-potential durations (APDs)4 5 6 and depressed contractility.4 7 These dysfunctional properties can contribute to arrhythmogenesis and pump failure.8 For example, in pacing-induced canine heart failure, a major causative factor in APD prolongation appears to be blunted L-type channel inactivation, perhaps secondary to altered intracellular Ca2+ dynamics playing through Ca2+-dependent inactivation.9 10 In human heart failure, single-channel work raises the possibility of spatial heterogeneity in channel open probability (Po), with readily opened channels located superficially, and low-Po channels situated deep in t-tubules.11 Such spatial heterogeneity could explain the decline of excitation-contraction coupling gain12 13 that may underlie the contractile depression in heart failure.

However, fundamental deficits in our basic understanding of L-type channels hinder definitive evaluation of how these channels contribute to the (patho-) physiology of the heart. Among the more salient deficiencies is the lack of information about the role of Ca2+ channel auxiliary ß subunits in actual heart cells. Although L-type channels are heteromultimers of at least 3 different subunits ({alpha}1C, ß, and {alpha}2{delta}), and the pore-forming {alpha}1C subunit specifies basic channel characteristics, the auxiliary ß subunits are arguably the most powerful modulators of expression, open probability, activation, and inactivation.14 15 16 So far, 4 genes encoding ß1–4 subunits have been identified, along with multiple splice variants.17 Different ß subunits impart distinctive patterns of channel expression and function,18 and therefore possess enormous potential for in vivo tuning of channel behavior. A major shortcoming in understanding the biological role of ß subunits is that current knowledge draws almost exclusively from heterologous expression of recombinant subunits in model systems. Such systems may differ from cardiocytes, given the possible existence of as-yet-unknown regulatory molecules,19 anchoring proteins,20 and post-translational modification in native heart.21 For example, in presynaptic termini, Ca2+ channel inactivation may be different from that in heterologous systems, as interactions with SNARE complex proteins22 (present at terminals) alters inactivation.23

Here, we therefore investigated the effects of expressing recombinant ß subunits in ventricular myocytes cultured from young adult rats. To our knowledge, these experiments are the first to transfect foreign genes in young adult myocytes using an adenoviral-component gene-delivery method24 and to characterize ß-subunit modulation in native heart cells. Although gene delivery proved more difficult in young adult rather than neonatal heart cells, we emphasized the older myocyte platform as a prelude to future experiments concerned with adult heart failure models.9 25 Neonatal heart cells have immature variants of L-type Ca2+ channels,26 27 28 excitation-contraction coupling,29 and sarcomeric structure.30 After optimization of the adenoviral-component method, we observed that expression of ß subunits alone induced a large increase in L-type current density, despite the heteromultimeric composition of Ca2+ channels. ß subunits could also strongly modulate inactivation rate in the native setting. These findings raise the possibility that gene delivery of ß subunits could counter contractile depression and excitability disorders in diseased hearts.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Adult Rat Heart Cell Isolation and Culture
The methods for cell isolation and culture have been described previously.31 Briefly, hearts was excised from young adult (4 to 6 weeks old) Sprague-Dawley rats, and ventricular heart cells were dispersed enzymatically. After centrifugation through a discontinuous Percoll gradient, {approx}80% rod-shaped cells were usually obtained. Myocytes were cultured relatively sparsely at a density of 50 000 to 80 000 cells per mL on laminin-coated coverslips, in medium 199 (containing, in mmol/L, sodium bicarbonate 26 and HEPES 25 as buffers, glucose 5.6, acetate 0.6, and amino acids as metabolic substrates), which was supplemented with (in mmol/L) carnitine 5, creatine 5, and taurine 5, and (in µg/mL) penicillin 100, streptomycin 100, and amphotericin 0.25. Cultures were equilibrated with 5% CO2/95% air at 37°C. As reported previously by others,32 using similar culture conditions, we observed little change in L-type channels over 4 to 5 days in culture.

Vectors for Transfection
Transfection of green fluorescent protein (GFP) alone was accomplished with an expression plasmid containing a cytomegalovirus (CMV) promoter driving "enhanced GFP," pEGFP (Clontech). The rat ß2a-N-GFP construct (Figure 3BDown) was created by polymerase chain reaction (PCR) amplification of approximately the first one third of the coding region of rat ß2a,33 so as to place a BglII site immediately before the second amino acid codon of rat ß2a. The upstream and downstream primers for PCR amplification were, respectively, AAGATCTCAGTGCTGCGGGCTGGTA and GACCTCATACCCCTTCAG. This PCR fragment was ligated into rat ß2a/pGW33 by BglII and ApaI sites. The entire resulting coding region was then transferred into pEGFP-C1 (Clontech) by BglII and EcoRI sites. The rat ß2a-C-GFP construct (Figure 3CDown) was created by ligating the PCR-amplified coding region of rat ß2a33 into BglII and PstI sites of pEGFP-N3 (Clonetech). The upstream and downstream primers for PCR amplification were, respectively, AAGATCTATGGACAGTGGCCGTGAC and TCTGCAGATTGGCGGATGTATACATCCCT. The rat ß3-N-GFP construct (Figure 3DDown) was created by PCR amplification of approximately the first one half of the coding region of rat ß3,35 so as to place a BglII site immediately before the second amino acid codon of rat ß3. The upstream and downstream primers for PCR amplification were, respectively, AAGATCTTATGACGACTCCTACGTG and GCCAGTGAGGTCTTGGCT. This PCR fragment was ligated into rat ß3/pGW35 by BglII and NheI sites. The entire resulting coding region was then transferred into pEGFP-C1 (Clontech) by BglII and EcoRI sites. Pfu polymerase (Stratagene) was used in PCR reactions to increase fidelity, and the region between cloning sites in final products was verified by thermocycle sequencing.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Gating properties of recombinant L-type channels expressed in HEK 293 cells from {alpha}1C, {alpha}2{delta}, and various ß subunit constructs. Top, Schematic diagrams of rat ß2a and ß3, along with different fusions of GFP to these ß subunits. A, Electrophysiological data from HEK 293 cells transfected with {alpha}1C, rat ß2a, and {alpha}2{delta} subunits. A1, Specimen Ba2+ current elicited by a 1-second depolarizing pulse to +10 mV, from a holding potential of -80 mV. Symbols indicate points at which peak (•) and residual ({circ}) currents are measured for plots of average behavior shown below. A2, Peak (•) and residual ({circ}) currents averaged from the indicated number of cells. A3, Plots of residual fraction of peak current after 1-second depolarization (r1000), averaged from the same cells as in panel A2. This plot provides a measure of inactivation properties, in which faster inactivation rate corresponds to a small r1000 value. B, Electrophysiological data for channels expressed from {alpha}1C, rat ß2a-N-GFP, and {alpha}2{delta} subunits. Format analogous to that in panel A. Dashed curve in panel B3 reproduces r1000 curve from panel A3. C, Electrophysiological data for channels expressed from {alpha}1C, rat ß2a-C-GFP, and {alpha}2{delta} subunits. Format analogous to that in panel A. Dashed curve in panel C3 reproduces r1000 curve from panel A3. D, Electrophysiological data for channels expressed from {alpha}1C, rat ß3-N-GFP, and {alpha}2{delta} subunits. Format analogous to that in panel A. Dashed curve in panel D3 shows average r1000 curve averaged from n=5 cells expressing {alpha}1C, rat ß3, and {alpha}2{delta} subunits.

The mammalian expression vector pCGI(GFP-IR) (provided by Drs David Johns and Eduardo Marbán, Johns Hopkins University, Baltimore, Md) was used as the base for the biscistronic vector, rat ß2a-IR-GFP (Figure 4ADown). The vector contains a CMV promotor, followed by a gene encoding enhanced GFP (EGFP), then an internal ribosomal entry site (IRES) from encephalomyocarditis virus, a multiple cloning site, and poly A region. The rat ß2a-IR-GFP construct was created by nondirectional ligation of cDNA encoding the rat ß2a subunit33 into the EcoR1 site of pCGI(GFP-IR), which was just downstream from the IRES. The final product was verified by diagnostic restriction enzyme digests.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Functional characterization of bicistronic expression plasmid encoding GFP and rat ß2a subunits in HEK 293 cells. A, Schematic diagram showing mechanism whereby rat ß2a-IR-GFP plasmid gives rise to separate GFP and rat ß2a proteins from a single mRNA species. CMV indicates CMV promoter; Neo/Kan, drug-resistance genes for neomycin and kanamycin. Poly A region is derived from SV40 virus. B, Exemplar Ba2+ current (B1) and average gating behavior (B2 and B3) for recombinant L-type channels expressed from {alpha}1C, rat ß2a-IR-GFP, and {alpha}2{delta} subunits. Format analogous to that in Figure 3BUp. Dashed curve in panel C3 reproduces r1000 curve from panel A3, corresponding to channels with unfused rat ß2a subunits. C, Data for channels expressed from {alpha}1C, rat ß2a-IR-GFP, and {alpha}2{delta} subunits, with the amount of transfected rat ß2a-IR-GFP cDNA reduced 5-fold from the usual amount (as in panel B). Format identical to that in panel B.

For transfection with the adenoviral-component system, all cDNA constructs were purified by CsCl centrifugation. Transfection rates were considerably lower for cDNAs purified by anion-exchange resins (Qiagen), possibly because supercoiled plasmid DNA is required for proper complexation of component elements.

Adenovirus Preparation and Storage
High-quality, replication-deficient human adenovirus (type 5 mutant Ad5dl312) was critical to transfection efficiency by the adenoviral-component system. We propagated adenovirus in complementing cells (HEK 293) cells and then purified virus as previously described.24 Briefly, we infected confluent HEK 293 cells grown in 15-cm plates with {approx}5 µL adenoviral stock solution (1012 to 1013 viral particles per mL in 10 mmol/L Tris-HCl buffer as described below). About 20 plates were processed per preparation. After {approx}48 hours, cells from all plates were harvested as a pellet and resuspended in 20 mL of buffer containing (in mmol/L) Tris-HCl 10, MgCl2 1, and CaCl2 1 (pH 8.0). Cells were lysed by 5 freeze-thaw cycles, and then cellular debris was pelleted by centrifugation. The virus-laden supernatant was then subjected to 1-hour density-gradient ultracentrifugation with CsCl step gradients of 1.25, 1.33, and 1.45 g/mL. The viral band was collected and subjected to overnight ultracentrifugation in 1.33 g/mL CsCl. The viral band was again collected and subjected to a further 4-hour ultracentrifugation in 1.33 g/mL CsCl. The now-pure viral band was collected and dialyzed against the Tris-HCl buffer described above. After dialysis, glycerol was added to a final concentration of 10% (vol/vol), and the viral stock solution was stored at -80°C. Resulting adenoviral stock solutions contained 1012 to 1013 particles per mL with a {approx}30:1 particle/plaque-forming unit ratio. Stocks were stored for 4 to 6 months at -80°C without degradation of transfection efficiency. With increasing storage time, the transfection efficiency declined appreciably.

Transfection of Heart Cells Using Adenoviral-Component System
Transfections were performed on cells that had been cultured for 1 day. An adenoviral-component mixture was used, which was composed of replication-deficient adenovirus (prepared as above), poly-L-lysine (molecular weight 34 000 to 48 000, Sigma), and expression plasmids. The transfection procedure was similar to that described previously,24 with modifications as noted below. Briefly, {approx}2 to 20 µL of Ad5dl312 virus stock (1012 to 1013 viral particles per mL in 10 mmol/L Tris-HCl stock solution described above) was combined with 14 µL poly-L-lysine stock (33 µg/mL) and diluted in medium 199 to a final volume of {approx}267 µL, resulting in final concentrations of {approx}8x1010 viral particles per mL and {approx}1.7 µg/mL poly-L-lysine. After a 30-minute incubation at room temperature, 0.7 µL of plasmid DNA stock (1 µg/µL in water) was added to the mixture, yielding a final DNA concentration of {approx}2.5 µg/mL. This mixture was then incubated for another 30 minutes. Another aliquot of poly-L-lysine stock solution ({approx}10 µL) was added, resulting in a final poly-L-lysine concentration of {approx}2.5 µg/mL. This mixture was subsequently incubated for another 10 minutes. Medium 199 (275 µL) was then added, resulting in a total volume of 550 µL, with final component concentrations of {approx}4x1010 viral particles per mL, {approx}1.25 µg/mL poly-L-lysine, and {approx}1.25 µg/mL plasmid DNA. Transfection was then initiated by replacing the culture medium with 250 µL of this transfection mixture per 17-mm-diameter well. After a 3-hour incubation at 37°C, the reaction was slowed by addition of 3 times volume of medium. This dilution prevents the damage sometimes observed with prolonged exposure to full-strength component mixture. Cells were cultured in medium, as described above, for {approx}72 hours before further analysis.

Transfection of HEK 293 Cells
HEK 293 cells were cultured and transfected by Ca2+ phosphate precipitation as previously described.37 CMV expression plasmids encoding {alpha}1C, {alpha}2{delta}, and various ß-subunit constructs (10 µg each) were used per 10-cm plate.

Electrophysiology
Whole-cell recordings were obtained at 20 to 22°C using standard patch-clamp techniques. The external solution contained (in mmol/L) N-methyl-D-glucamine (NMG) aspartate 155, HEPES 10, 4-aminopyride 10, EGTA 0.1 (pH 7.4 with NMG), with Ba2+ 10 as charge carrier. The internal solution contained (in mmol/L) cesium methanesulfonate 150, CsCl 5, HEPES 10, EGTA 10, MgCl2 1, MgATP 4 (pH 7.2 with CsOH), and 0.5 µmol/L ryanodine (Calbiochem). Internal and external solutions described above were adjusted to 280 to 300 mOsm as required. The use of Ba2+ as charge carrier, together with ryanodine in the internal solution, ensures that L-type current kinetics reflected voltage-dependent gating properties of the sarcolemmal channels themselves, with no contribution from current-dependent inactivation by divalent cation release from sarcoplasmic reticulum.38 39 40 Cells were initially bathed in Tyrode’s solution containing (in mmol/L) NaCl 138, KCl 4, CaCl2 2, MgCl2 1, NaH2PO4 0.33, HEPES 10 (pH 7.35 with NaOH), and glucose 10. Pipet current was nulled in this solution before sealing and breaking into cells. Measurements were started after >10 minutes of dialysis with the internal solution, during which time the external bath was switched to the NMG-based solution. A junction potential of -8.6 mV41 (pipet solution potential-external solution potential) was not corrected for in displays and analysis. A value of +8.6 mV should be added to all reported voltages to obtain true membrane potentials. Series resistance was typically <2 M{Omega} and compensated 60% to 80%. Voltage pulses (leak and test pulses) were delivered every 60 seconds, and data were typically filtered at 2 KHz and then sampled at 10 KHz. Data are displayed and analyzed after P/8 leak subtraction. Pooled data are given as mean±SEM. P<0.05 is recorded as significantly different. Effects of recombinant ß subunits in myocytes were compared with those in contemporaneous GFP control cells.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Delivery of Foreign Genes to Cultured Heart Cells by an Adenoviral-Component System
A prerequisite step in this study was the introduction of genes encoding Ca2+ channel ß subunits into young adult heart cells. Delivery of plasmid DNA to adult myocytes by conventional means, such as Ca2+ phosphate precipitation42 and lipofection,43 has proven challenging,44 although there are instances of highly successful variations of these techniques in cultured neonatal cells.45 By contrast, recombinant adenoviral constructs can transfect adult rat and neonatal myocytes with nearly 100% efficiency,46 but considerable time and effort are required to produce new recombinant constructs, and genes of interest are size-limited (<7 kilobases). Recently, a hybrid strategy has been introduced that combines some of the efficiency of adenovirus-mediated transfection with the convenience of plasmid-based strategies.24 In this approach, cultured neonatal heart cells could be transfected with {approx}70% efficiency, simply by application of a trinary complex containing replication-deficient adenovirus, poly-L-lysine, and expression plasmids encoding a gene of interest. Here, we adapted the adenoviral-component gene-delivery method to ventricular myocytes cultured from young adult rats. Figure 1Down diagrams the overall time course of the experiments in this study, along with the proposed mechanisms underlying the transfection strategy.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Time course and proposed mechanism for experiments using adenoviral-component gene transfection of cultured cardiac myocytes. A, Overall timetable of experiments. On day 0, rat ventricular myocytes are isolated enzymatically and placed into culture. On day 1, cultured cells are transfected with a trinary complex of replication-deficient adenovirus, poly-L-lysine, and expression plasmids encoding the genes of interest. On days 3 to 5, expression of recombinant genes is sufficient to perform electrophysiological experiments. Day 4 is considered optimal in that expression is robust while heart cells remain relatively differentiated. B, Postulated mechanism of adenoviral-component gene-delivery system, as previously proposed.24 Replication-deficient adenovirus, poly-L-lysine, and expression plasmid form a trinary complex, stabilized by electrostatic interactions. Virus enables receptor-mediated endocytosis of the entire complex into myocytes, with plasmid cDNA taking a "piggyback" ride. The endolytic capabilities of the virus further facilitates eventual translocation of plasmid cDNA to the nucleus, thereby resulting in expression of foreign genes.

Figure 2Down illustrates the characteristic efficiency of gene transfection by the adenoviral-component method in young adult ventricular myocytes, using GFP as a reporter gene. For baseline comparison, the top row displays brightfield (Figures 2ADown and 2BDown) and fluorescence (Figure 2CDown) micrographs of ventricular myocytes that have not been transfected by the compound system. The cells were isolated from 4-week-old rats and are shown after 4 days in culture using previously established methods.31 The regular striations in the brightfield view, seen more clearly at higher magnification (Figure 2ADown), are characteristic of the adult phenotype. Under fluorescence illumination by blue light, the same field of view as in Figure 2BDown is now dark (Figure 2CDown), indicating that GFP could serve as a selective reporter gene. The bottom row shows the corresponding result in a parallel set of cells transfected with the adenoviral compound system, using plasmids encoding GFP. Under fluorescence illumination (Figure 2DDown), some of the cells are now bright green, indicating successful transfection of GFP. Figures 2EDown and 2FDown show brightfield and fluorescence views of a transfected cell at higher magnification. Overall, the percentage of striated cells showing green fluorescence ranged between 1% and 10%, after optimization of transfection parameters from those used with neonatal cells.24 The main changes in methodology involved the ratios of component ingredients (optimized ratio, 4x1010 viral particles per mL:1.25 µg/mL polylysine:1.25 µg/mL plasmid DNA) and the time of exposure (increased from 1.5 to 3 hours) to full-strength component mixture. The age of the rats used also proved to be an important parameter. Whereas cultured rat neonatal heart cells could be transfected with high efficiency as previously reported, the transfection efficiency appeared to decrease with increasing age of the rats, with no successful transfection in cells from 10-week-old rats. The 4- to 6-week-old rats used here permitted a reasonable transfection efficiency, while at the same time demonstrating an adult-like phenotype.



View larger version (107K):
[in this window]
[in a new window]
 
Figure 2. Green fluorescence detection of gene delivery to cultured ventricular myocytes by the adenoviral-component system. Top row (A through C) shows photomicrographs for untransfected myocytes, as a baseline. Bottom row (D through F) displays photomicrographs for myocytes transfected with GFP. A, Brightfield view (x400) of rat ventricular myocytes, after 4 days in culture. B, Low-power (x100), brightfield view of young adult ventricular myocytes, shown after 4 days in culture after isolation from a 4-week-old rat. C, Fluorescence image of the same view as in panel B, using a B2A Nikon fluorescence cube. The lack of appreciable green fluorescence indicates the absence of confounding, endogenous fluorophore. D, Low-power (x100), fluorescence image of a parallel set of cells (from 4-week-old rat), transfected with an expression plasmid encoding GFP. The image is analogous to that in panel C, but now numerous cells manifest green fluorescence. E, High-power (x400), brightfield view of different set of cells (from a 4-week-old rat) transfected with GFP. F, Same cells as in panel E, but now under fluorescence illumination.

Variations in the Use of GFP as Reporter of Successful ß-Subunit Transfection
The results from the previous section indicated that a component adenoviral system could transfect foreign genes into cultured adult heart cells, albeit with a lower efficiency (1% to 10%) than previously found with neonatal cells ({approx}70%). Such a gene-delivery strategy would still prove useful for patch-clamp studies if there were a convenient method for detecting successfully transfected myocytes.

A first approach was to engineer plasmids encoding fusion proteins of GFP to various ß subunits, as schematized at the top of Figure 3Up. To test whether these novel constructs were functionally active as channel ß subunits, and to determine whether their properties were unchanged from those of native subunits, we examined the characteristics of recombinant L-type Ca2+ channels expressed in HEK 293 cells from cDNAs encoding the main {alpha}1C subunit, the auxiliary {alpha}2{delta} subunit, and various fusions of GFP to ß subunits. Figure 3AUp shows the characteristic properties of L-type channels containing wild-type rat ß2a subunits, which have been proposed as a dominant "cardiac" isoform.33 To focus the analysis on voltage-dependent channel gating behavior, Ba2+ serves as the charge carrier, here and throughout, so as to minimize Ca2+-dependent inactivation47 that would otherwise be present with Ca2+ as charge carrier.48 49 The exemplar current trace (Figure 3AUp1) illustrates 2 important features imparted to channels containing the rat ß2a subunit. First, the currents are comparatively large, because ß subunits help chaperone and/or stabilize the main {alpha}1C subunit at the surface membrane, as well as to enhance open probability.50 Recombinant Ca2+ channel currents expressed without a ß subunit are typically >10-fold smaller than shown here.18 51 Second, voltage-dependent inactivation is quite slow during the 1000-ms depolarizing pulse. Of all the known ß1–4 subunits, the rat ß2a subunit results in the slowest inactivation.36 The population data shown below (Figures 3AUp2 and 3A3, TableDown) entirely confirm the two exemplar trends. Plots of average peak (•) and residual ({circ}) current as a function of voltage-step potential (Figure 3AUp2) corroborate the robust expression of functional channels. Moreover, the average fraction of current remaining at the end of 1000-ms depolarizations (Figure 3AUp3, r1000) is large, consistent with slow inactivation.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of Peak Current Density and Remaining Fraction of Current After 300-ms Depolarization (r300) From HEK 293 Cells Transfected With {alpha}1C, {alpha}2{delta}, and Various ß-Subunit Constructs

Figures 3BUp and 3CUp show the properties of L-type channels containing GFP-rat ß2a fusions, following the identical format of Figure 3AUp. In both cases, the expression of current is robust, and the overall voltage dependence of activation is undetectably changed compared with native rat ß2a (compare Figures 3AUp2, 3B2, and 3C2). However, exemplar traces clearly suggest that the fusion of GFP to the rat ß2a subunit results in enhanced inactivation (compare Figures 3AUp1, 3B1, and 3C1). Averaged r1000 data confirm the faster inactivation (Figures 3BUp3 and 3C3, see also TableUp), which is obvious by comparison with the wild-type rat ß2a data reproduced as a dashed curve. When GFP is fused to the N terminus of rat ß2a (Figure 3BUp), the acceleration of inactivation is greatest. However, even with GFP fusion to the C terminus of rat ß2a, the enhancement of inactivation is still present (Figure 3CUp3). By contrast, when GFP was fused to the N-terminus of the rat ß3 subunit (Figure 3DUp, TableUp), inactivation was similar, or slightly slowed compared with unfused ß3 (Figure 3DUp3, dashed curve). The faster inactivation observed with ß3 constructs (Figure 3DUp) compared with the ß2a construct (Figure 3AUp) fits with prior reports that ß3 imparts the fastest inactivation to {alpha}1 subunits.36 In short, although direct fusion of GFP and ß subunits would provide an efficient strategy for identifying cells transfected with recombinant ß subunits, the properties of such ß subunits would be somewhat different than those of parental subunits.

To circumvent these complexities, we undertook a second reporter gene approach using a bicistronic expression plasmid encoding both GFP and rat ß2a subunits (Figure 4AUp). Here, in the rat ß2a-IR-GFP construct, the CMV promoter drives transcription of a single mRNA species that encodes both GFP and rat ß2a, punctuated by an IRES derived from encephalomyocarditis virus.52 Although the GFP sequence is terminated by a stop codon, the IRES nevertheless induces attachment and initiation of a ribosomal complex just upstream of the ß2a sequence. Hence, the single mRNA species supports translation of separate GFP and rat ß2a proteins. In principle, such a construct should give rise to an extremely tight correlation between green fluorescence and recombinant ß subunit expression, while at the same time preserving native ß-subunit properties.

Figure 4BUp shows the properties of recombinant L-type channels expressed in HEK 293 cells transfected with {alpha}1C, {alpha}2{delta}, and rat ß2a-IR-GFP constructs. For ease of comparison, the format is identical to that in Figure 3Up. The expression of current is robust (Figure 4BUp1 and 4B2), and the exemplar trace suggests that inactivation properties are identical to those observed with the conventional rat ß2a construct (compare Figures 4BUp1 and 3A1). Detailed examination of averaged r1000 data (Figure 4BUp3, TableUp) confirms that inactivation is no different than that observed with native rat ß2a subunits; the dashed curve reproduces the native subunit data from Figure 3AUp3.

One final check on the rat ß2a-IR-GFP construct concerned the possibility that differential expression levels of ß subunits could lead to different overall inactivation rates. For example, if more than one ß subunit could associate with a single {alpha}1C subunit, then channels with variable numbers of associated ß subunits could manifest different inactivation properties. In this scenario, the spectrum of inactivation rates observed across different rat ß2a constructs in Figure 3AUp through 3C could simply reflect variable levels of ß subunit expression, rather than intrinsically distinct properties of the different constructs. Likewise, the similar inactivation rates observed between rat ß2a and rat ß2a-IR-GFP might simply reflect matched expression levels. To exclude this possibility, we examined the properties of recombinant L-type channels when only one fifth the usual amount of plasmid encoding ß2a-IR-GFP was transfected (Figure 4CUp). Relative reduction of ß2a-IR-GFP did not change channel inactivation properties, as explicitly confirmed by the average r1000 data (Figure 4CUp3, TableUp). Here, the averaged data from Figure 4BUp3 have been reproduced as the dashed curve. These findings agree with earlier biochemical evidence favoring a 1:1 stoichiometry of {alpha}1 and ß subunits for L-type channels15 and suggest that different ß-subunit constructs impart distinct inactivation properties to L-type channels, in a manner that is insensitive to the level of ß-subunit expression. Even in the case of R-type ({alpha}1E) and P/Q-type ({alpha}1A) channels, where there is relatively clear biochemical evidence for multiple ß-subunit binding sites on the {alpha}1 subunit,53 54 it remains unclear whether >1 ß binding site is functionally important.18 54 Overall, the use of the bicistronic expression vector encoding GFP and a ß subunit appeared to be the reporter gene strategy that would provide the most faithful assessment of the physiological impact of a particular subunit in myocytes.

Ca2+ Channel Modulation by Recombinant ß Subunits in Cultured Heart Cells
We next tested whether the various constructs encoding GFP and ß subunits could actually direct recombinant ß-subunit expression in heart cells. The first indication that these constructs were functionally active came from the detection of green-fluorescent cells after adenoviral compound transfection of the various constructs, observed with an efficiency comparable to that observed with transfection of GFP alone. Figure 5Down shows fluorescence views of heart cells transfected with GFP alone as control (A), ß2a-N-GFP (B), ß3-N-GFP (C), and ß2a-IR-GFP (D).



View larger version (64K):
[in this window]
[in a new window]
 
Figure 5. High-power (x400) fluorescence micrographs of rat ventricular myocytes expressing GFP alone as control (A), ß2a-N-GFP (B), ß3-N-GFP (C), and ß2a-IR-GFP (D). Cells are shown after 4 days in culture.

More telling was the strong enhancement of L-type channel current density observed in such green-fluorescent cells (Figure 6Down). Compared with expression of GFP alone as control, recombinant ß subunits caused pronounced amplification of current waveforms, averaged from multiple cells (Figure 6ADown). The enhancement was confirmed statistically by explicit measurements of peak current density (Figure 6BDown). The effect appeared strongest for the rat ß2a-IR-GFP construct but was still present for every ß-subunit construct. The increased current density was manifest over a wide range of step potentials, as demonstrated in multiple cells with the rat ß2a-IR-GFP construct (Figure 6CDown). These findings not only demonstrate that recombinant ß subunits were functionally active, they also suggest a surprising result that can only be posed in native heart: ß subunits appear to be "rate limiting" for expression of functional Ca2+ channel current in native heart cells, even though channels are composed of at least 3 subunits ({alpha}1C, ß, and {alpha}2{delta}). Here, we use the term rate limiting in a functional sense, referring to a limitation either in the Po of channels or in the number of active channels in the surface membrane (as detailed in the Discussion).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 6. Increased current density for L-type channels in ventricular myocytes overexpressing recombinant ß subunits. A, Current-density waveforms averaged from multiple cells expressing GFP alone, or various ß-subunit constructs. Solid curve plots the mean, and dashed curves indicate bracketing SEM confidence range. ß-subunit expression clearly augments expression of functional Ba2+ current through L-type channels, compared with control (GFP expressed alone). B, Statistical analysis of observed increases in peak current density (at +10 mV) produced by expression of recombinant ß subunits. C, Averaged plots of peak current density as a function of step potential, for cells expressing GFP alone ({circ}) or rat ß2a-IR-GFP (•). Averages were drawn from the indicated number of cells. These data demonstrate that the ß-subunit enhancement of functional Ba2+ current was present over a broad range of voltages.

Another important question was whether recombinant ß subunits would affect Ca2+ channel inactivation in a manner similar to that observed in HEK 293 cells (Figures 3Up and 4Up). Figure 7ADown shows normalized current waveforms elicited by 1-second depolarizations to +10 mV, after averaging across multiple heart cells. It is evident that different constructs produced markedly different inactivation characteristics, according to a rank order that accords with the results from HEK 293 cells (Figures 3Up and 4Up). The effects were statistically resolved, as shown in the bar graph summary of r1000 data from multiple cells (Figure 7BDown). A similar rank order of effects was observed with analysis of the residual fraction of current measured after 300 ms of depolarization (r300), confirming that various ß-subunit constructs impart a generally uniform slowing or acceleration of inactivation over the course of 1-second depolarizations. In comparison with control cells expressing GFP alone, it is remarkable how slowly currents inactivated in cells overexpressing any of the recombinant ß subunits: the slowing was detectable even with the rat ß3-N-GFP construct, but was most marked with the putative "cardiac" isoform of the ß subunit (rat ß2a-IR-GFP) (Figure 7CDown). Given that rates of voltage-dependent inactivation were insensitive to variable levels of ß subunit expression in HEK 293 cells (Figure 4BUp and 4CUp), it is reasonable to expect that the functionally dominant ß subunit in heart is not the rat ß2a isoform. Whatever the molecular identity of the actual cardiac ß subunit turns out to be, it is interesting that this subunit imparts an inactivation rate (GFP control cells) that exceeds that observed with overexpression of rat ß3-N-GFP. In HEK 293 cells, the latter construct gives rise to an inactivation rate similar to that of unfused ß3, which yields the fastest rate observed with the known ß1–4 subunits.36



View larger version (24K):
[in this window]
[in a new window]
 
Figure 7. Tuning of voltage-dependent inactivation by expression of various recombinant ß subunits in ventricular heart cells. A, Normalized Ba2+ current waveforms, averaged from multiple cells after peak currents were rescaled to unity. Means are shown as solid curves, and bracketing SEM confidence ranges are indicated by dashed curves. All ß subunits tested produced a slowing of inactivation rate compared with control cells expressing GFP alone. The most striking effects were observed with rat ß2a-IR-GFP. B, Statistical summary of the residual fraction of peak current remaining at the end of 300-ms depolarization (r300) and at the end of 1000-ms depolarization (r1000). Data are from step depolarizations to +10 mV. The faster the inactivation rate, the smaller the value of r300 or r1000. Numbers of cells from which averages are drawn are shown in parentheses. C, Rat ß2a-IR-GFP slows inactivation over a broad range of voltages, as indicated by plots of average r1000 as a function of step potential.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
This report describes the first application of an adenoviral-component gene-delivery method to transfect young adult ventricular myocytes. In addition, we established parameters for the use of GFP to detect expression of foreign Ca2+ channel ß subunits. Fusion of GFP to ß subunits spared overall subunit function, but resulted in quantitative alterations in inactivation properties. Pairing GFP with ß subunits in a bicistronic gene cassette fully conserved the functional attributes of ß subunits. Using these approaches, this study provides the first observations of the effects of expressing recombinant Ca2+ channel ß subunits in cardiac ventricular myocytes, culture from 4- to 6-week-old rats. Previous studies have focused on heterologous expression in model systems. These experiments identified ß-subunit modulatory effects with special relevance to the native setting. In particular, the overall density of L-type channel current was markedly enhanced by ß-subunit expression, and voltage-dependent inactivation was highly sensitive to the type of ß subunit that was transfected. Here we elaborate on the implications of various ß-subunit effects, as observed in the actual cardiac environment.

ß Subunits Are Rate Limiting for Expression of Functional Ca2+ Channel Current
Expression of recombinant ß subunits alone enhanced Ca2+ channel current density up to 3- to 4-fold, arguing that ß subunits are rate limiting for expression of L-type current in heart. This finding is rather surprising, given the well-established heteromultimeric composition of L-type channels. Although the {alpha}1C subunit forms the pore of the channel and specifies overall characteristics of the channel, at least 3 subunits ({alpha}1C, ß, and {alpha}2{delta}) are believed to comprise native channels,14 15 16 with other as-yet-unknown subunits still possible as additional elements of the channel complex (eg, Reference 1919 ). One might therefore expect that coexpression of multiple Ca2+ channel subunits would be required to enhance the overall level of L-type current.

The large increase in Ca2+ channel currents arising from expression of recombinant ß subunits alone raises several possible scenarios for the heart, none of which are mutually exclusive. First, recombinant ß subunits could associate with {alpha}1C subunits that are already in the surface membrane, thereby increasing open probability of the pore via allosteric interactions favoring the open state.50 Second, new ß subunits may help to translocate excess, preexisting {alpha}1C subunits waiting in the Golgi complex to the surface membrane or to stabilize such channel complexes in the cell membrane.50 55 56 57 Either or both of these actions would lead to an increase in the number of functional channels in the sarcolemma. Finally, it is possible that gene expression of {alpha}1C and other subunits may be under feedback control that senses ß-subunit expression.

Regardless of the mechanism, the functional result that expression of ß subunits alone can increase L-type current may prove to be an important simplification for potential gene therapy to reverse the decline in overall current density seen in some forms of heart failure.7 58 59 60 61 62 In particular, in failing cardiac allografts with diastolic dysfunction, downregulation of ß subunits has been correlated with hemodynamic defects.63 On the other hand, ß-subunit supplementation would not be relevant to many forms of heart failure in which there is little decline in Ca2+ channel current density.5 64 Compared with genes encoding {alpha}1C subunits ({approx}7 kilobases), ß-subunit transcripts are relatively small (1 to 3 kilobases), thereby facilitating gene delivery. Furthermore, expression of a single foreign gene considerably simplifies the technical challenge.

Voltage Inactivation of L-Type Channels Is Highly Sensitive to the Type of ß Subunit
Another important finding is that expression of different ß subunits produces strikingly different rates of voltage-dependent inactivation of L-type channels, as observed over the course of 1-second depolarizations. Using heterologous expression in HEK 293 cells, we have previously demonstrated that different ß subunits produce remarkably small differences in the steady-state inactivation of L-type channels by voltage.18 In apparent agreement, different ß subunits (ß1b versus ß2a) produce very similar rates of voltage-dependent inactivation of recombinant L-type channels expressed in Xenopus oocytes during several-hundred–millisecond depolarizations.65 Here, we found that ß3 and ß2a subunits produced very different voltage-dependent inactivation rates during 1-second depolarization of recombinant L-type channels expressed in HEK 293 cells. Importantly, these differences in voltage-dependent inactivation were recapitulated in heart cells transfected with different recombinant ß subunits. The distinct inactivation rates observed over the span of 100 to 1000 ms are particularly relevant to specifying the APD of heart.66 In fact, the observed variation of inactivation rates with different ß subunits could be even more striking in the native setting, if we consider that both voltage-dependent and Ca2+-dependent mechanisms of inactivation are present when Ca2+ serves as charge carrier.48 49 Previous studies hint that different ß subunits would produce larger distinctions in the rate of Ca2+-dependent versus voltage-dependent inactivation,65 67 although further work may be necessary to fully establish these intriguing observations.

These findings hold particular pathophysiological relevance, because one of the hallmarks of heart failure is prolongation of the action potential,4 5 6 perhaps secondary to depressed intracellular [Ca2+], resulting in decreased Ca2+-dependent inactivation of L-type channels.9 10 Alternatively, a relative shift in the prevalence of certain ß-subunit isoforms could also account for altered Ca2+-dependent inactivation in heart failure. In either case, this study raises the possibility that gene expression of an appropriate ß subunit could rectify the prolongation of APD attendant to some forms of heart failure.

Identity of Genuine Cardiac-Specific ß Subunits
The remarkably slow inactivation rate observed on expression of the putative "cardiac" isoform of the ß subunit33 (rat ß2a) suggested that other types of ß subunits are functionally dominant in native rat heart. Historically, although the rat ß2a was cloned from a rat brain library, Northern blot analysis suggested that it was also quite prevalent in heart.33 This, however, only indicates that something quite homologous to the rat brain ß2a subunit is present in heart. Nonetheless, a highly similar rabbit ß2a subunit was cloned directly from rabbit heart.68 Because the main differences between the rat and rabbit ß2a subunits were restricted to the extreme amino terminal region, it seemed reasonable that both of these ß2a subunits might be found in heart. However, recent PCR analysis, using isoform-specific primers at the amino terminus, confirmed the presence of only the rabbit ß2a species in rabbit myocardium but failed to detect a transcript similar to the rat brain ß2a in the same tissue.69

Overall, there is considerable indeterminacy in regard to legitimate, cardiac-"specific" isoforms of ß subunits. Beyond confirmation of the rabbit ß2a species in rabbit heart, Collin et al70 cloned ß1 splice variants in human heart and showed them to be dominant by Northern blot and reverse transcriptase–PCR. No ß2 was detected. Expression of novel ß subunits in heart cells will prove useful in establishing the veracity of purported cardiac specificity.


*    Acknowledgments
 
This work was supported by the National Institutes of Health and by fellowship support from the Maryland American Heart Association and Falk Foundation (to S.-k.W.). We thank David C. Johns and Eduardo Marbán for the gift of the pCGI(GFP-IR) vector, from which rat ß2a-IR-GFP was constructed.


*    Footnotes
 
This manuscript was sent to Michael R. Rosen, Consulting Editor, for review by expert referees, editorial decision, and final disposition.

Received September 15, 1999; accepted October 18, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 

  1. Fabiato A, Fabiato F. Calcium and cardiac excitation-contraction coupling. Annu Rev Physiol. 1979;41:473–484.[Medline] [Order article via Infotrieve]
  2. Hullin R, Asmus F, Berger HJ, Boekstegers P. Differential expression of the subunits of the human cardiac L-type calcium channel in diastolic failure of the transplanted heart. Circulation. 1997;96(suppl I):I-55.
  3. Mukherjee R, Spinale FG. L-type calcium channel abundance and function with cardiac hypertrophy and failure: a review. J Mol Cell Cardiol. 1998;30:1899–1916.[Medline] [Order article via Infotrieve]
  4. Beuckelmann DJ, Nabauer M, Erdmann E. Intracellular calcium handling in isolated ventricular myocytes from patients with terminal heart failure. Circulation. 1992;85:1046–1055.[Abstract/Free Full Text]
  5. Kaab S, Nuss HB, Chiamvimonvat N, O’Rourke B, Pak PH, Kass DA, Marbán E, Tomaselli GF. Ionic mechanism of action potential prolongation in ventricular myocytes from dogs with pacing-induced heart failure. Circ Res. 1996;78:262–273.[Abstract/Free Full Text]
  6. Beuckelmann DJ, Nabauer M, Erdmann E. Alterations of K+ currents in isolated human ventricular myocytes from patients with terminal heart failure. Circ Res. 1993;73:379–385.[Abstract/Free Full Text]
  7. Mukherjee R, Hewett KW, Walker JD, Basler CG, Spinale FG. Changes in L-type calcium channel abundance and function during the transition to pacing-induced congestive heart failure. Cardiovasc Res. 1998;37:432–444.[Abstract/Free Full Text]
  8. Tomaselli GF, Beuckelmann DJ, Calkins HG, Berger RD, Kessler PD, Lawrence JH, Kass D, Feldman AM, Marbán E. Sudden cardiac death in heart failure: the role of abnormal repolarization. Circulation. 1994;90:2534–2539.[Abstract/Free Full Text]
  9. O’Rourke B, Kass DA, Tomaselli GF, Kaab S, Tunin R, Marbán E. Mechanisms of altered excitation-contraction coupling in canine tachycardia-induced heart failure, I: experimental study. Circ Res. 1999;84:562–570.[Abstract/Free Full Text]
  10. Winslow R, Rice J, Jafri S, Marbán E, O’Rourke B. Mechanisms of altered excitation-contraction coupling in canine tachycardia-induced heart failure, II: model study. Circ Res. 1999;84:571–586.[Abstract/Free Full Text]
  11. Schroder F, Handrock R, Beuckelmann DJ, Hirt S, Hullin R, Priebe L, Schwinger RHG, Weil J, Herzig S. Increased availability and open probability of single L-type calcium channels from failing compared with nonfailing human ventricle. Circulation. 1998;98:969–976.[Abstract/Free Full Text]
  12. Gomez AM, Valdivia HH, Cheng H, Lederer MR, Santana LF, Cannell MB, McCune SA, Altschuld RA, Lederer WJ. Defective excitation-contraction coupling in experimental cardiac hypertrophy and heart failure. Science. 1997;276:800–806.[Abstract/Free Full Text]
  13. Yue DT. Quenching the spark in the heart. Science. 1997;276:755–756.[Free Full Text]
  14. Perez-Reyes E, Schneider T. Calcium channels: structure, function, and classification. Drug Dev Res. 1994;33:295–318.
  15. De Waard M, Gurnett CA, Campbell KP. Structural and functional diversity of voltage-activated calcium channels. In: Narahashi T, ed. Ion Channels. New York, NY: Plenum Press; 1996:41–87.
  16. Walker D, De Waard M. Subunit interaction sites in voltage-dependent Ca2+ channels: role in channel function. Trends Neurosci. 1998;21:148–154.[Medline] [Order article via Infotrieve]
  17. Dunlap K, Luebke JI, Turner TJ. Exocytotic Ca2+ channels in mammalian central neurons. Trends Neurosci. 1995;18:89–98.[Medline] [Order article via Infotrieve]
  18. Jones LP, Wei SK, Yue DT. Mechanism of auxiliary subunit modulation of neuronal {alpha}1E calcium channels. J Gen Physiol. 1998;112:125–143.[Abstract/Free Full Text]
  19. Letts VA, Felix R, Biddlecome GH, Arikkath J, Mahaffey CL, Valenzuela A, Bartlett FS 2nd, Mori Y, Campbell KP, Frankel WN. The mouse stargazer gene encodes a neuronal Ca2+-channel gamma subunit. Nat Genet. 1998;19:340–347.[Medline] [Order article via Infotrieve]
  20. Gao T, Yatani A, Dell’Acqua ML, Sako H, Green SA, Dascal N, Scott JD, Hosey MM. cAMP-dependent regulation of cardiac L-type Ca2+ channels requires membrane targeting of PKA and phosphorylation of channel subunits. Neuron. 1997;19:185–196.[Medline] [Order article via Infotrieve]
  21. Beam KG, Adams BA, Niidome T, Numa S, Tanabe T. Function of a truncated dihydropyridine receptor as both voltage sensor and calcium channel. Nature. 1992;360:169–171.[Medline] [Order article via Infotrieve]
  22. Mochida S, Yokoyama CT, Kim DK, Itoh K, Catterall WA. Evidence for a voltage-dependent enhancement of neurotransmitter release mediated via the synaptic protein interaction site of N-type Ca2+ channels. Proc Natl Acad Sci U S A. 1998;95:14523–14528.[Abstract/Free Full Text]
  23. Bezprozvanny I, Scheller RH, Tsien RW. Functional impact of syntaxin on gating of N-type and Q-type calcium channels. Nature. 1995;378:623–626.[Medline] [Order article via Infotrieve]
  24. Kohout TA, O’Brian JJ, Gaa ST, Lederer WJ, Rogers TB. Novel adenovirus component system that transfects cultured cardiac cells with high efficiency. Circ Res. 1996;78:971–977.[Abstract/Free Full Text]
  25. Wolff MR, de Tombe PP, Harasawa Y, Burkhoff D, Bier S, Hunter WC, Gerstenblith G, Kass DA. Alterations in left ventricular mechanics, energetics, and contractile reserve in experimental heart failure. Circ Res. 1992;70:516–529.[Abstract/Free Full Text]
  26. Gidh-Jain M, Huang B, Jain P, Battula V, El-Sherif N. Reemergence of the fetal pattern of L-type calcium channel gene expression in non infarcted myocardium during left ventricular remodeling. Biochem Biophys Res Commun. 1995;216:892–897.[Medline] [Order article via Infotrieve]
  27. Diebold RJ, Koch WJ, Ellinor PT, Wang JJ, Muthuchamy M, Wieczorek DF, Schwartz A. Mutually exclusive exon splicing of the cardiac calcium channel {alpha}1 subunit gene generates developmentally regulated isoforms in the rat heart. Proc Natl Acad Sci U S A. 1992;89:1497–1501.[Abstract/Free Full Text]
  28. Tohse N, Masuda H, Sperelakis N. Novel isoform of Ca2+ channel in rat fetal cardiomyocytes. J Physiol. 1992;451:295–306.[Abstract/Free Full Text]
  29. Gomez JP, Potreau D. Effects of thapsigargin and cyclopiazonic acid on intracellular calcium activity in newborn rat cardiomyocytes during their development in primary culture. J Cardiovasc Pharmacol. 1996;27:335–346.[Medline] [Order article via Infotrieve]
  30. Atherton BT, Meyer DM, Simpson DG. Assembly and remodelling of myofibrils and intercalated discs in cultured neonatal rat heart cells. J Cell Sci. 1986;86:233–248.[Abstract/Free Full Text]
  31. Silverman HS, Wei S, Haigney MC, Ocampo CJ, Stern MD. Myocyte adaptation to chronic hypoxia and development of tolerance to subsequent acute severe hypoxia. Circ Res. 1997;80:699–707.[Abstract/Free Full Text]
  32. Mitcheson JS, Hancox JC, Levi AJ. Cultured adult rabbit myocytes: effect of adding supplements to the medium, and response to isoprenaline. J Cardiovasc Electrophysiol. 1997;8:1020–1030.[Medline] [Order article via Infotrieve]
  33. Perez-Reyes E, Castellano A, Kim HS, Bertrand P, Baggstrom E, Lacerda AE, Wei XY, Birnbaumer L. Cloning and expression of a cardiac/brain ß subunit of the L-type calcium channel. J Biol Chem. 1992;267:1792–1797.[Abstract/Free Full Text]
  34. de Leon M, Wang Y, Jones L, Perez-Reyes E, Wei X, Soong TW, Snutch TP, Yue DT. Essential Ca2+-binding motif for Ca2+-sensitive inactivation of L-type Ca2+ channels. Science. 1995;270:1502–1506.[Abstract/Free Full Text]
  35. Castellano A, Wei X, Birnbaumer L, Perez-Reyes E. Cloning and expression of a third calcium channel ß subunit. J Biol Chem. 1993;268:3450–3455.[Abstract/Free Full Text]
  36. Patil PG, Brody DL, Yue DT. Preferential closed-state inactivation of neuronal calcium channels. Neuron. 1998;20:1027–1038.[Medline] [Order article via Infotrieve]
  37. Brody DL, Patil PG, Mulle JG, Snutch TP, Yue DT. Bursts of action potential waveforms relieve G-protein inhibition of recombinant P/Q-type Ca2+ channels in HEK 293 cells. J Physiol. 1997;499:637–644.[Medline] [Order article via Infotrieve]
  38. Imredy JP, Yue DT. Mechanism of Ca2+-sensitive inactivation of L-type Ca2+ channels. Neuron. 1994;12:1301–1318.[Medline] [Order article via Infotrieve]
  39. Sham JS, Cleemann L, Morad M. Functional coupling of