Cellular Biology |
From the Program in Molecular and Cellular Systems Physiology (S.-k.W., H.M.C., C.D.D., B.Z.P., R.Z., D.T.Y.), Departments of Biomedical Engineering and Neuroscience, Johns Hopkins University School of Medicine, Baltimore, Md; Department of Medicine (T.A.K.), Howard Hughes Medical Institute, Duke University, Durham, NC; and Department of Biochemistry and Molecular Biology (T.B.R.), University of Maryland School of Medicine, Baltimore, Md.
Correspondence to David T. Yue, MD, PhD, Ross Building, Room 713, Johns Hopkins University School of Medicine, 720 Rutland Ave, Baltimore, MD 21205. E-mail dyue{at}bme.jhu.edu
| Abstract |
|---|
|
|
|---|
1C, ß, and
2
),
expression of recombinant ß subunits alone enhanced Ca2+
channel current density up to 3- to 4-fold, which argues that ß
subunits are "rate limiting" for expression of current in heart.
(4) Overexpression of the putative "cardiac" ß2a
subunit more than halved the rate of voltage-dependent inactivation at
+10 mV. This result demonstrates that ß subunits can tune
inactivation in the myocardium and suggests that other ß
subunits may be functionally dominant in the heart. Overall, this study
points to the possible therapeutic potential of ß subunits to
ameliorate contractile dysfunction and excitability in heart
failure.
Key Words: Ca2+ channel ß subunit adenovirus gene delivery
| Introduction |
|---|
|
|
|---|
However, fundamental deficits in our basic understanding of L-type
channels hinder definitive evaluation of how these channels contribute
to the (patho-) physiology of the heart. Among the more salient
deficiencies is the lack of information about the role of
Ca2+ channel auxiliary ß subunits in actual
heart cells. Although L-type channels are heteromultimers of at
least 3 different subunits (
1C, ß, and
2
), and the pore-forming
1C subunit specifies basic channel
characteristics, the auxiliary ß subunits are arguably the most
powerful modulators of expression, open probability, activation, and
inactivation.14 15 16 So far, 4 genes encoding
ß14 subunits have been identified, along with
multiple splice variants.17 Different ß subunits impart
distinctive patterns of channel expression and function,18
and therefore possess enormous potential for in vivo tuning of channel
behavior. A major shortcoming in understanding the biological role of
ß subunits is that current knowledge draws almost exclusively from
heterologous expression of recombinant subunits in model systems. Such
systems may differ from cardiocytes, given the possible
existence of as-yet-unknown regulatory molecules,19
anchoring proteins,20 and post-translational modification
in native heart.21 For example, in presynaptic termini,
Ca2+ channel inactivation may be different from
that in heterologous systems, as interactions with SNARE complex
proteins22 (present at terminals) alters
inactivation.23
Here, we therefore investigated the effects of expressing recombinant ß subunits in ventricular myocytes cultured from young adult rats. To our knowledge, these experiments are the first to transfect foreign genes in young adult myocytes using an adenoviral-component gene-delivery method24 and to characterize ß-subunit modulation in native heart cells. Although gene delivery proved more difficult in young adult rather than neonatal heart cells, we emphasized the older myocyte platform as a prelude to future experiments concerned with adult heart failure models.9 25 Neonatal heart cells have immature variants of L-type Ca2+ channels,26 27 28 excitation-contraction coupling,29 and sarcomeric structure.30 After optimization of the adenoviral-component method, we observed that expression of ß subunits alone induced a large increase in L-type current density, despite the heteromultimeric composition of Ca2+ channels. ß subunits could also strongly modulate inactivation rate in the native setting. These findings raise the possibility that gene delivery of ß subunits could counter contractile depression and excitability disorders in diseased hearts.
| Materials and Methods |
|---|
|
|
|---|
80% rod-shaped cells were usually obtained. Myocytes were
cultured relatively sparsely at a density of 50 000 to 80 000 cells
per mL on laminin-coated coverslips, in medium 199 (containing, in
mmol/L, sodium bicarbonate 26 and HEPES 25 as buffers, glucose 5.6,
acetate 0.6, and amino acids as metabolic substrates),
which was supplemented with (in mmol/L) carnitine 5, creatine 5,
and taurine 5, and (in µg/mL) penicillin 100, streptomycin
100, and amphotericin 0.25. Cultures were equilibrated with 5%
CO2/95% air at 37°C. As reported previously by
others,32 using similar culture conditions, we observed
little change in L-type channels over 4 to 5 days in culture.
Vectors for Transfection
Transfection of green fluorescent protein (GFP) alone
was accomplished with an expression plasmid containing a
cytomegalovirus (CMV) promoter driving "enhanced GFP," pEGFP
(Clontech). The rat ß2a-N-GFP construct
(Figure 3B
) was created by polymerase chain reaction (PCR)
amplification of approximately the first one third of the coding region
of rat ß2a,33 so as to place a
BglII site immediately before the second amino acid codon of
rat ß2a. The upstream and downstream primers
for PCR amplification were, respectively, AAGATCTCAGTGCTGCGGGCTGGTA and
GACCTCATACCCCTTCAG. This PCR fragment was ligated into rat
ß2a/pGW33 by BglII
and ApaI sites. The entire resulting coding region was then
transferred into pEGFP-C1 (Clontech) by BglII and
EcoRI sites. The rat ß2a-C-GFP
construct (Figure 3C
) was created by ligating the PCR-amplified
coding region of rat ß2a33 into
BglII and PstI sites of pEGFP-N3 (Clonetech). The
upstream and downstream primers for PCR amplification were,
respectively, AAGATCTATGGACAGTGGCCGTGAC and
TCTGCAGATTGGCGGATGTATACATCCCT. The rat ß3-N-GFP
construct (Figure 3D
) was created by PCR amplification of
approximately the first one half of the coding region of rat
ß3,35 so as to place a BglII
site immediately before the second amino acid codon of rat
ß3. The upstream and downstream primers for PCR
amplification were, respectively, AAGATCTTATGACGACTCCTACGTG and
GCCAGTGAGGTCTTGGCT. This PCR fragment was ligated into rat
ß3/pGW35 by BglII
and NheI sites. The entire resulting coding region was then
transferred into pEGFP-C1 (Clontech) by BglII and
EcoRI sites. Pfu polymerase (Stratagene) was used
in PCR reactions to increase fidelity, and the region between cloning
sites in final products was verified by thermocycle sequencing.
|
The mammalian expression vector pCGI(GFP-IR) (provided by Drs David
Johns and Eduardo Marbán, Johns Hopkins University, Baltimore,
Md) was used as the base for the biscistronic vector, rat
ß2a-IR-GFP (Figure 4A
). The vector
contains a CMV promotor, followed by a gene encoding enhanced GFP
(EGFP), then an internal ribosomal entry site (IRES) from
encephalomyocarditis virus, a multiple cloning site, and poly A region.
The rat ß2a-IR-GFP construct was created by
nondirectional ligation of cDNA encoding the rat
ß2a subunit33 into the
EcoR1 site of pCGI(GFP-IR), which was just downstream from
the IRES. The final product was verified by diagnostic
restriction enzyme digests.
|
For transfection with the adenoviral-component system, all cDNA constructs were purified by CsCl centrifugation. Transfection rates were considerably lower for cDNAs purified by anion-exchange resins (Qiagen), possibly because supercoiled plasmid DNA is required for proper complexation of component elements.
Adenovirus Preparation and Storage
High-quality, replication-deficient human adenovirus (type 5
mutant Ad5dl312) was critical to transfection efficiency by the
adenoviral-component system. We propagated adenovirus in complementing
cells (HEK 293) cells and then purified virus as previously
described.24 Briefly, we infected confluent HEK 293 cells
grown in 15-cm plates with
5 µL adenoviral stock solution
(1012 to 1013 viral
particles per mL in 10 mmol/L Tris-HCl buffer as described below).
About 20 plates were processed per preparation. After
48 hours,
cells from all plates were harvested as a pellet and resuspended in 20
mL of buffer containing (in mmol/L) Tris-HCl 10,
MgCl2 1, and CaCl2 1 (pH
8.0). Cells were lysed by 5 freeze-thaw cycles, and then cellular
debris was pelleted by centrifugation. The virus-laden
supernatant was then subjected to 1-hour density-gradient
ultracentrifugation with CsCl step gradients of 1.25,
1.33, and 1.45 g/mL. The viral band was collected and subjected to
overnight ultracentrifugation in 1.33 g/mL CsCl. The
viral band was again collected and subjected to a further 4-hour
ultracentrifugation in 1.33 g/mL CsCl. The now-pure
viral band was collected and dialyzed against the Tris-HCl buffer
described above. After dialysis, glycerol was added to a final
concentration of 10% (vol/vol), and the viral stock solution was
stored at -80°C. Resulting adenoviral stock solutions contained
1012 to 1013 particles per
mL with a
30:1 particle/plaque-forming unit ratio. Stocks were
stored for 4 to 6 months at -80°C without degradation of
transfection efficiency. With increasing storage time, the transfection
efficiency declined appreciably.
Transfection of Heart Cells Using Adenoviral-Component
System
Transfections were performed on cells that had been cultured for
1 day. An adenoviral-component mixture was used, which was composed of
replication-deficient adenovirus (prepared as above),
poly-L-lysine (molecular weight 34 000 to 48 000, Sigma),
and expression plasmids. The transfection procedure was similar to that
described previously,24 with modifications as noted below.
Briefly,
2 to 20 µL of Ad5dl312 virus stock
(1012 to 1013 viral
particles per mL in 10 mmol/L Tris-HCl stock solution described
above) was combined with 14 µL poly-L-lysine stock (33
µg/mL) and diluted in medium 199 to a final volume of
267 µL,
resulting in final concentrations of
8x1010
viral particles per mL and
1.7 µg/mL poly-L-lysine.
After a 30-minute incubation at room temperature, 0.7 µL of plasmid
DNA stock (1 µg/µL in water) was added to the mixture, yielding a
final DNA concentration of
2.5 µg/mL. This mixture was then
incubated for another 30 minutes. Another aliquot of
poly-L-lysine stock solution (
10 µL) was added,
resulting in a final poly-L-lysine concentration of
2.5
µg/mL. This mixture was subsequently incubated for another 10
minutes. Medium 199 (275 µL) was then added, resulting in a total
volume of 550 µL, with final component concentrations of
4x1010 viral particles per mL,
1.25
µg/mL poly-L-lysine, and
1.25 µg/mL plasmid DNA.
Transfection was then initiated by replacing the culture medium with
250 µL of this transfection mixture per 17-mm-diameter well. After a
3-hour incubation at 37°C, the reaction was slowed by addition of 3
times volume of medium. This dilution prevents the damage sometimes
observed with prolonged exposure to full-strength component mixture.
Cells were cultured in medium, as described above, for
72 hours
before further analysis.
Transfection of HEK 293 Cells
HEK 293 cells were cultured and transfected by
Ca2+ phosphate precipitation as previously
described.37 CMV expression plasmids encoding
1C,
2
, and various
ß-subunit constructs (10 µg each) were used per 10-cm plate.
Electrophysiology
Whole-cell recordings were obtained at 20 to 22°C
using standard patch-clamp techniques. The external solution contained
(in mmol/L)
N-methyl-D-glucamine (NMG)
aspartate 155, HEPES 10, 4-aminopyride 10, EGTA 0.1 (pH 7.4 with NMG),
with Ba2+ 10 as charge carrier. The internal
solution contained (in mmol/L) cesium methanesulfonate 150, CsCl
5, HEPES 10, EGTA 10, MgCl2 1, MgATP 4 (pH 7.2
with CsOH), and 0.5 µmol/L ryanodine (Calbiochem). Internal and
external solutions described above were adjusted to 280 to 300 mOsm as
required. The use of Ba2+ as charge carrier,
together with ryanodine in the internal solution, ensures that L-type
current kinetics reflected voltage-dependent gating properties of the
sarcolemmal channels themselves, with no contribution from
current-dependent inactivation by divalent cation release from
sarcoplasmic reticulum.38 39 40 Cells were initially
bathed in Tyrodes solution containing (in mmol/L) NaCl 138, KCl
4, CaCl2 2, MgCl2 1,
NaH2PO4 0.33, HEPES 10 (pH
7.35 with NaOH), and glucose 10. Pipet current was nulled in this
solution before sealing and breaking into cells. Measurements
were started after >10 minutes of dialysis with the internal solution,
during which time the external bath was switched to the NMG-based
solution. A junction potential of -8.6 mV41 (pipet
solution potential-external solution potential) was not corrected for
in displays and analysis. A value of +8.6 mV should be added to
all reported voltages to obtain true membrane potentials. Series
resistance was typically <2 M
and compensated 60% to 80%. Voltage
pulses (leak and test pulses) were delivered every 60 seconds, and data
were typically filtered at 2 KHz and then sampled at 10 KHz. Data are
displayed and analyzed after P/8 leak subtraction. Pooled data
are given as mean±SEM. P<0.05 is recorded as
significantly different. Effects of recombinant ß subunits in
myocytes were compared with those in contemporaneous GFP control
cells.
| Results |
|---|
|
|
|---|
70% efficiency, simply by
application of a trinary complex containing replication-deficient
adenovirus, poly-L-lysine, and expression plasmids encoding
a gene of interest. Here, we adapted the adenoviral-component
gene-delivery method to ventricular myocytes cultured from
young adult rats. Figure 1
|
Figure 2
illustrates the
characteristic efficiency of gene transfection by the
adenoviral-component method in young adult ventricular
myocytes, using GFP as a reporter gene. For baseline comparison, the
top row displays brightfield (Figures 2A
and 2B
) and
fluorescence (Figure 2C
) micrographs of
ventricular myocytes that have not been transfected by the
compound system. The cells were isolated from 4-week-old rats and are
shown after 4 days in culture using previously established
methods.31 The regular striations in the brightfield view,
seen more clearly at higher magnification (Figure 2A
), are
characteristic of the adult phenotype. Under
fluorescence illumination by blue light, the same field of view
as in Figure 2B
is now dark (Figure 2C
), indicating that
GFP could serve as a selective reporter gene. The bottom row shows the
corresponding result in a parallel set of cells transfected with the
adenoviral compound system, using plasmids encoding GFP. Under
fluorescence illumination (Figure 2D
), some of the cells
are now bright green, indicating successful transfection of GFP.
Figures 2E
and 2F
show brightfield and fluorescence
views of a transfected cell at higher magnification. Overall, the
percentage of striated cells showing green fluorescence ranged
between 1% and 10%, after optimization of transfection
parameters from those used with neonatal
cells.24 The main changes in methodology involved the
ratios of component ingredients (optimized ratio,
4x1010 viral particles per mL:1.25 µg/mL
polylysine:1.25 µg/mL plasmid DNA) and the time of exposure
(increased from 1.5 to 3 hours) to full-strength component mixture. The
age of the rats used also proved to be an important
parameter. Whereas cultured rat neonatal heart cells could
be transfected with high efficiency as previously reported, the
transfection efficiency appeared to decrease with increasing age of the
rats, with no successful transfection in cells from 10-week-old rats.
The 4- to 6-week-old rats used here permitted a reasonable transfection
efficiency, while at the same time demonstrating an adult-like
phenotype.
|
Variations in the Use of GFP as Reporter of Successful
ß-Subunit Transfection
The results from the previous section indicated that a component
adenoviral system could transfect foreign genes into cultured adult
heart cells, albeit with a lower efficiency (1% to 10%) than
previously found with neonatal cells (
70%). Such a gene-delivery
strategy would still prove useful for patch-clamp studies if there were
a convenient method for detecting successfully transfected
myocytes.
A first approach was to engineer plasmids encoding fusion proteins of
GFP to various ß subunits, as schematized at the top of Figure 3
. To test whether these novel constructs
were functionally active as channel ß subunits, and to determine
whether their properties were unchanged from those of native subunits,
we examined the characteristics of recombinant L-type
Ca2+ channels expressed in HEK 293 cells from
cDNAs encoding the main
1C subunit, the
auxiliary
2
subunit, and various fusions of
GFP to ß subunits. Figure 3A
shows the characteristic
properties of L-type channels containing wild-type rat
ß2a subunits, which have been proposed as a
dominant "cardiac" isoform.33 To focus the
analysis on voltage-dependent channel gating behavior,
Ba2+ serves as the charge carrier, here and
throughout, so as to minimize Ca2+-dependent
inactivation47 that would otherwise be present with
Ca2+ as charge carrier.48 49 The
exemplar current trace (Figure 3A
1) illustrates 2 important
features imparted to channels containing the rat
ß2a subunit. First, the currents are
comparatively large, because ß subunits help chaperone and/or
stabilize the main
1C subunit at the surface
membrane, as well as to enhance open probability.50
Recombinant Ca2+ channel currents expressed
without a ß subunit are typically >10-fold smaller than shown
here.18 51 Second, voltage-dependent inactivation is quite
slow during the 1000-ms depolarizing pulse. Of all the known
ß14 subunits, the rat
ß2a subunit results in the slowest
inactivation.36 The population data shown below (Figures 3A
2 and 3A3, Table
) entirely confirm the two
exemplar trends. Plots of average peak () and residual (
) current
as a function of voltage-step potential (Figure 3A
2) corroborate
the robust expression of functional channels. Moreover, the average
fraction of current remaining at the end of 1000-ms depolarizations
(Figure 3A
3, r1000) is large,
consistent with slow inactivation.
|
Figures 3B
and 3C
show the properties of L-type channels
containing GFP-rat ß2a fusions, following the
identical format of Figure 3A
. In both cases, the expression of
current is robust, and the overall voltage dependence of activation is
undetectably changed compared with native rat
ß2a (compare Figures 3A
2, 3B2, and 3C2).
However, exemplar traces clearly suggest that the fusion of GFP to the
rat ß2a subunit results in enhanced
inactivation (compare Figures 3A
1, 3B1, and 3C1). Averaged
r1000 data confirm the faster inactivation
(Figures 3B
3 and 3C3, see also Table
), which is obvious
by comparison with the wild-type rat ß2a data
reproduced as a dashed curve. When GFP is fused to the N terminus of
rat ß2a (Figure 3B
), the acceleration of
inactivation is greatest. However, even with GFP fusion to the C
terminus of rat ß2a, the enhancement of
inactivation is still present (Figure 3C
3). By contrast,
when GFP was fused to the N-terminus of the rat
ß3 subunit (Figure 3D
, Table
),
inactivation was similar, or slightly slowed compared with unfused
ß3 (Figure 3D
3, dashed curve). The
faster inactivation observed with ß3 constructs
(Figure 3D
) compared with the ß2a
construct (Figure 3A
) fits with prior reports that
ß3 imparts the fastest inactivation to
1 subunits.36 In short,
although direct fusion of GFP and ß subunits would provide an
efficient strategy for identifying cells transfected with recombinant
ß subunits, the properties of such ß subunits would be somewhat
different than those of parental subunits.
To circumvent these complexities, we undertook a second reporter
gene approach using a bicistronic expression plasmid encoding both GFP
and rat ß2a subunits (Figure 4A
). Here, in the rat
ß2a-IR-GFP construct, the CMV promoter drives
transcription of a single mRNA species that encodes both GFP and rat
ß2a, punctuated by an IRES derived from
encephalomyocarditis virus.52 Although the GFP sequence is
terminated by a stop codon, the IRES nevertheless induces attachment
and initiation of a ribosomal complex just upstream of the
ß2a sequence. Hence, the single mRNA species
supports translation of separate GFP and rat
ß2a proteins. In principle, such a construct
should give rise to an extremely tight correlation between green
fluorescence and recombinant ß subunit expression, while at
the same time preserving native ß-subunit properties.
Figure 4B
shows the properties of recombinant L-type channels
expressed in HEK 293 cells transfected with
1C,
2
, and rat
ß2a-IR-GFP constructs. For ease of comparison,
the format is identical to that in Figure 3
. The expression of
current is robust (Figure 4B
1 and 4B2), and the exemplar trace
suggests that inactivation properties are identical to those observed
with the conventional rat ß2a construct
(compare Figures 4B
1 and 3A1). Detailed examination of averaged
r1000 data (Figure 4B
3,
Table
) confirms that inactivation is no different than that
observed with native rat ß2a subunits; the
dashed curve reproduces the native subunit data from Figure 3A
3.
One final check on the rat ß2a-IR-GFP construct
concerned the possibility that differential expression levels of ß
subunits could lead to different overall inactivation rates. For
example, if more than one ß subunit could associate with a single
1C subunit, then channels with variable
numbers of associated ß subunits could manifest different
inactivation properties. In this scenario, the spectrum of inactivation
rates observed across different rat ß2a
constructs in Figure 3A
through 3C could simply reflect
variable levels of ß subunit expression, rather than
intrinsically distinct properties of the different constructs.
Likewise, the similar inactivation rates observed between rat
ß2a and rat ß2a-IR-GFP
might simply reflect matched expression levels. To exclude this
possibility, we examined the properties of recombinant L-type channels
when only one fifth the usual amount of plasmid encoding
ß2a-IR-GFP was transfected (Figure 4C
).
Relative reduction of ß2a-IR-GFP did not change
channel inactivation properties, as explicitly confirmed by the average
r1000 data (Figure 4C
3,
Table
). Here, the averaged data from Figure 4B
3 have been
reproduced as the dashed curve. These findings agree with earlier
biochemical evidence favoring a 1:1 stoichiometry of
1 and ß subunits for L-type
channels15 and suggest that different ß-subunit
constructs impart distinct inactivation properties to L-type channels,
in a manner that is insensitive to the level of ß-subunit expression.
Even in the case of R-type (
1E) and P/Q-type
(
1A) channels, where there is relatively clear
biochemical evidence for multiple ß-subunit binding sites on the
1 subunit,53 54 it remains
unclear whether >1 ß binding site is functionally
important.18 54 Overall, the use of the bicistronic
expression vector encoding GFP and a ß subunit appeared to be the
reporter gene strategy that would provide the most faithful assessment
of the physiological impact of a particular subunit
in myocytes.
Ca2+ Channel Modulation by Recombinant ß Subunits in
Cultured Heart Cells
We next tested whether the various constructs encoding GFP and ß
subunits could actually direct recombinant ß-subunit expression in
heart cells. The first indication that these constructs were
functionally active came from the detection of
green-fluorescent cells after adenoviral compound transfection
of the various constructs, observed with an efficiency comparable to
that observed with transfection of GFP alone. Figure 5
shows fluorescence views of
heart cells transfected with GFP alone as control (A),
ß2a-N-GFP (B), ß3-N-GFP
(C), and ß2a-IR-GFP (D).
|
More telling was the strong enhancement of L-type channel current
density observed in such green-fluorescent cells (Figure 6
). Compared with expression of GFP alone
as control, recombinant ß subunits caused pronounced amplification of
current waveforms, averaged from multiple cells (Figure 6A
). The
enhancement was confirmed statistically by explicit measurements of
peak current density (Figure 6B
). The effect appeared strongest
for the rat ß2a-IR-GFP construct but was still
present for every ß-subunit construct. The increased current
density was manifest over a wide range of step potentials, as
demonstrated in multiple cells with the rat
ß2a-IR-GFP construct (Figure 6C
). These
findings not only demonstrate that recombinant ß subunits were
functionally active, they also suggest a surprising result that can
only be posed in native heart: ß subunits appear to be "rate
limiting" for expression of functional Ca2+
channel current in native heart cells, even though channels are
composed of at least 3 subunits (
1C, ß, and
2
). Here, we use the term rate limiting in
a functional sense, referring to a limitation either in the
Po of channels or in the number of active
channels in the surface membrane (as detailed in the Discussion).
|
Another important question was whether recombinant ß subunits would
affect Ca2+ channel inactivation in a manner
similar to that observed in HEK 293 cells (Figures 3
and 4
). Figure 7A
shows normalized
current waveforms elicited by 1-second depolarizations to +10 mV, after
averaging across multiple heart cells. It is evident that different
constructs produced markedly different inactivation characteristics,
according to a rank order that accords with the results from HEK 293
cells (Figures 3
and 4
). The effects were statistically
resolved, as shown in the bar graph summary of
r1000 data from multiple cells (Figure 7B
). A similar rank order of effects was observed with
analysis of the residual fraction of current measured after 300
ms of depolarization (r300), confirming
that various ß-subunit constructs impart a generally uniform slowing
or acceleration of inactivation over the course of 1-second
depolarizations. In comparison with control cells expressing GFP alone,
it is remarkable how slowly currents inactivated in cells
overexpressing any of the recombinant ß subunits: the slowing was
detectable even with the rat ß3-N-GFP
construct, but was most marked with the putative "cardiac" isoform
of the ß subunit (rat ß2a-IR-GFP) (Figure 7C
). Given that rates of voltage-dependent inactivation were
insensitive to variable levels of ß subunit expression in HEK 293
cells (Figure 4B
and 4C
), it is reasonable to expect that the
functionally dominant ß subunit in heart is not the rat
ß2a isoform. Whatever the molecular identity of
the actual cardiac ß subunit turns out to be, it is interesting that
this subunit imparts an inactivation rate (GFP control cells) that
exceeds that observed with overexpression of rat
ß3-N-GFP. In HEK 293 cells, the latter
construct gives rise to an inactivation rate similar to that of unfused
ß3, which yields the fastest rate observed with
the known ß14
subunits.36
|
| Discussion |
|---|
|
|
|---|
ß Subunits Are Rate Limiting for Expression of Functional
Ca2+ Channel Current
Expression of recombinant ß subunits alone enhanced
Ca2+ channel current density up to 3- to 4-fold,
arguing that ß subunits are rate limiting for expression of L-type
current in heart. This finding is rather surprising, given the
well-established heteromultimeric composition of
L-type channels. Although the
1C subunit forms
the pore of the channel and specifies overall characteristics of the
channel, at least 3 subunits (
1C, ß, and
2
) are believed to comprise native
channels,14 15 16 with other as-yet-unknown subunits still
possible as additional elements of the channel complex (eg, Reference
1919 ). One might therefore expect that coexpression of multiple
Ca2+ channel subunits would be required to
enhance the overall level of L-type current.
The large increase in Ca2+ channel currents
arising from expression of recombinant ß subunits alone raises
several possible scenarios for the heart, none of which are mutually
exclusive. First, recombinant ß subunits could associate with
1C subunits that are already in the surface
membrane, thereby increasing open probability of the pore via
allosteric interactions favoring the open state.50 Second,
new ß subunits may help to translocate excess, preexisting
1C subunits waiting in the Golgi complex to
the surface membrane or to stabilize such channel complexes in the cell
membrane.50 55 56 57 Either or both of these actions would
lead to an increase in the number of functional channels in the
sarcolemma. Finally, it is possible that gene expression of
1C and other subunits may be under feedback
control that senses ß-subunit expression.
Regardless of the mechanism, the functional result that expression of
ß subunits alone can increase L-type current may prove to be an
important simplification for potential gene therapy to reverse the
decline in overall current density seen in some forms of heart
failure.7 58 59 60 61 62 In particular, in failing cardiac
allografts with diastolic dysfunction, downregulation of
ß subunits has been correlated with hemodynamic
defects.63 On the other hand, ß-subunit supplementation
would not be relevant to many forms of heart failure in which there is
little decline in Ca2+ channel current
density.5 64 Compared with genes encoding
1C subunits (
7 kilobases), ß-subunit
transcripts are relatively small (1 to 3 kilobases), thereby
facilitating gene delivery. Furthermore, expression of a single foreign
gene considerably simplifies the technical challenge.
Voltage Inactivation of L-Type Channels Is Highly Sensitive to the
Type of ß Subunit
Another important finding is that expression of different ß
subunits produces strikingly different rates of voltage-dependent
inactivation of L-type channels, as observed over the course of
1-second depolarizations. Using heterologous expression in HEK 293
cells, we have previously demonstrated that different ß subunits
produce remarkably small differences in the steady-state inactivation
of L-type channels by voltage.18 In apparent agreement,
different ß subunits (ß1b versus
ß2a) produce very similar rates of
voltage-dependent inactivation of recombinant L-type channels expressed
in Xenopus oocytes during several-hundredmillisecond
depolarizations.65 Here, we found that
ß3 and ß2a subunits
produced very different voltage-dependent inactivation rates during
1-second depolarization of recombinant L-type channels expressed in HEK
293 cells. Importantly, these differences in voltage-dependent
inactivation were recapitulated in heart cells transfected with
different recombinant ß subunits. The distinct inactivation rates
observed over the span of 100 to 1000 ms are particularly relevant to
specifying the APD of heart.66 In fact, the observed
variation of inactivation rates with different ß subunits could be
even more striking in the native setting, if we consider that both
voltage-dependent and Ca2+-dependent mechanisms
of inactivation are present when Ca2+ serves
as charge carrier.48 49 Previous studies hint that
different ß subunits would produce larger distinctions in the rate of
Ca2+-dependent versus voltage-dependent
inactivation,65 67 although further work may be necessary
to fully establish these intriguing observations.
These findings hold particular pathophysiological relevance, because one of the hallmarks of heart failure is prolongation of the action potential,4 5 6 perhaps secondary to depressed intracellular [Ca2+], resulting in decreased Ca2+-dependent inactivation of L-type channels.9 10 Alternatively, a relative shift in the prevalence of certain ß-subunit isoforms could also account for altered Ca2+-dependent inactivation in heart failure. In either case, this study raises the possibility that gene expression of an appropriate ß subunit could rectify the prolongation of APD attendant to some forms of heart failure.
Identity of Genuine Cardiac-Specific ß Subunits
The remarkably slow inactivation rate observed on expression of
the putative "cardiac" isoform of the ß subunit33
(rat ß2a) suggested that other types of ß
subunits are functionally dominant in native rat heart. Historically,
although the rat ß2a was cloned from a rat
brain library, Northern blot analysis suggested that it was
also quite prevalent in heart.33 This, however, only
indicates that something quite homologous to the rat brain
ß2a subunit is present in heart.
Nonetheless, a highly similar rabbit ß2a
subunit was cloned directly from rabbit heart.68 Because
the main differences between the rat and rabbit
ß2a subunits were restricted to the extreme
amino terminal region, it seemed reasonable that both of these
ß2a subunits might be found in heart. However,
recent PCR analysis, using isoform-specific primers at the
amino terminus, confirmed the presence of only the rabbit
ß2a species in rabbit myocardium
but failed to detect a transcript similar to the rat brain
ß2a in the same tissue.69
Overall, there is considerable indeterminacy in regard to legitimate, cardiac-"specific" isoforms of ß subunits. Beyond confirmation of the rabbit ß2a species in rabbit heart, Collin et al70 cloned ß1 splice variants in human heart and showed them to be dominant by Northern blot and reverse transcriptasePCR. No ß2 was detected. Expression of novel ß subunits in heart cells will prove useful in establishing the veracity of purported cardiac specificity.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received September 15, 1999; accepted October 18, 1999.
| References |
|---|
|
|
|---|
2. Hullin R, Asmus F, Berger HJ, Boekstegers P. Differential expression of the subunits of the human cardiac L-type calcium channel in diastolic failure of the transplanted heart. Circulation. 1997;96(suppl I):I-55.
3. Mukherjee R, Spinale FG. L-type calcium channel abundance and function with cardiac hypertrophy and failure: a review. J Mol Cell Cardiol. 1998;30:18991916.[Medline] [Order article via Infotrieve]
4.
Beuckelmann DJ, Nabauer M, Erdmann E. Intracellular
calcium handling in isolated ventricular myocytes from
patients with terminal heart failure. Circulation. 1992;85:10461055.
5.
Kaab S, Nuss HB, Chiamvimonvat N, ORourke B, Pak PH,
Kass DA, Marbán E, Tomaselli GF. Ionic mechanism of action
potential prolongation in ventricular myocytes from dogs
with pacing-induced heart failure. Circ Res. 1996;78:262273.
6.
Beuckelmann DJ, Nabauer M, Erdmann E. Alterations of
K+ currents in isolated human
ventricular myocytes from patients with terminal heart
failure. Circ Res. 1993;73:379385.
7.
Mukherjee R, Hewett KW, Walker JD, Basler CG, Spinale
FG. Changes in L-type calcium channel abundance and function during the
transition to pacing-induced congestive heart failure. Cardiovasc
Res. 1998;37:432444.
8.
Tomaselli GF, Beuckelmann DJ, Calkins HG, Berger RD,
Kessler PD, Lawrence JH, Kass D, Feldman AM, Marbán E. Sudden
cardiac death in heart failure: the role of abnormal repolarization.
Circulation. 1994;90:25342539.
9.
ORourke B, Kass DA, Tomaselli GF, Kaab S, Tunin R,
Marbán E. Mechanisms of altered excitation-contraction coupling
in canine tachycardia-induced heart failure, I:
experimental study. Circ Res. 1999;84:562570.
10.
Winslow R, Rice J, Jafri S, Marbán E, ORourke
B. Mechanisms of altered excitation-contraction coupling in canine
tachycardia-induced heart failure, II: model study.
Circ Res. 1999;84:571586.
11.
Schroder F, Handrock R, Beuckelmann DJ, Hirt S, Hullin
R, Priebe L, Schwinger RHG, Weil J, Herzig S. Increased availability
and open probability of single L-type calcium channels from failing
compared with nonfailing human ventricle. Circulation. 1998;98:969976.
12.
Gomez AM, Valdivia HH, Cheng H, Lederer MR, Santana LF,
Cannell MB, McCune SA, Altschuld RA, Lederer WJ. Defective
excitation-contraction coupling in experimental cardiac
hypertrophy and heart failure. Science. 1997;276:800806.
13.
Yue DT. Quenching the spark in the heart.
Science. 1997;276:755756.
14. Perez-Reyes E, Schneider T. Calcium channels: structure, function, and classification. Drug Dev Res. 1994;33:295318.
15. De Waard M, Gurnett CA, Campbell KP. Structural and functional diversity of voltage-activated calcium channels. In: Narahashi T, ed. Ion Channels. New York, NY: Plenum Press; 1996:4187.
16. Walker D, De Waard M. Subunit interaction sites in voltage-dependent Ca2+ channels: role in channel function. Trends Neurosci. 1998;21:148154.[Medline] [Order article via Infotrieve]
17. Dunlap K, Luebke JI, Turner TJ. Exocytotic Ca2+ channels in mammalian central neurons. Trends Neurosci. 1995;18:8998.[Medline] [Order article via Infotrieve]
18.
Jones LP, Wei SK, Yue DT. Mechanism of auxiliary
subunit modulation of neuronal
1E calcium
channels. J Gen Physiol. 1998;112:125143.
19. Letts VA, Felix R, Biddlecome GH, Arikkath J, Mahaffey CL, Valenzuela A, Bartlett FS 2nd, Mori Y, Campbell KP, Frankel WN. The mouse stargazer gene encodes a neuronal Ca2+-channel gamma subunit. Nat Genet. 1998;19:340347.[Medline] [Order article via Infotrieve]
20. Gao T, Yatani A, DellAcqua ML, Sako H, Green SA, Dascal N, Scott JD, Hosey MM. cAMP-dependent regulation of cardiac L-type Ca2+ channels requires membrane targeting of PKA and phosphorylation of channel subunits. Neuron. 1997;19:185196.[Medline] [Order article via Infotrieve]
21. Beam KG, Adams BA, Niidome T, Numa S, Tanabe T. Function of a truncated dihydropyridine receptor as both voltage sensor and calcium channel. Nature. 1992;360:169171.[Medline] [Order article via Infotrieve]
22.
Mochida S, Yokoyama CT, Kim DK, Itoh K, Catterall WA.
Evidence for a voltage-dependent enhancement of neurotransmitter
release mediated via the synaptic protein interaction site of N-type
Ca2+ channels. Proc Natl Acad Sci
U S A. 1998;95:1452314528.
23. Bezprozvanny I, Scheller RH, Tsien RW. Functional impact of syntaxin on gating of N-type and Q-type calcium channels. Nature. 1995;378:623626.[Medline] [Order article via Infotrieve]
24.
Kohout TA, OBrian JJ, Gaa ST, Lederer WJ, Rogers TB.
Novel adenovirus component system that transfects cultured cardiac
cells with high efficiency. Circ Res. 1996;78:971977.
25.
Wolff MR, de Tombe PP, Harasawa Y, Burkhoff D, Bier S,
Hunter WC, Gerstenblith G, Kass DA. Alterations in left
ventricular mechanics, energetics, and contractile reserve
in experimental heart failure. Circ Res. 1992;70:516529.
26. Gidh-Jain M, Huang B, Jain P, Battula V, El-Sherif N. Reemergence of the fetal pattern of L-type calcium channel gene expression in non infarcted myocardium during left ventricular remodeling. Biochem Biophys Res Commun. 1995;216:892897.[Medline] [Order article via Infotrieve]
27.
Diebold RJ, Koch WJ, Ellinor PT, Wang JJ, Muthuchamy M,
Wieczorek DF, Schwartz A. Mutually exclusive exon splicing of the
cardiac calcium channel
1 subunit gene
generates developmentally regulated isoforms in the rat heart.
Proc Natl Acad Sci U S A. 1992;89:14971501.
28.
Tohse N, Masuda H, Sperelakis N. Novel isoform of
Ca2+ channel in rat fetal
cardiomyocytes. J Physiol. 1992;451:295306.
29. Gomez JP, Potreau D. Effects of thapsigargin and cyclopiazonic acid on intracellular calcium activity in newborn rat cardiomyocytes during their development in primary culture. J Cardiovasc Pharmacol. 1996;27:335346.[Medline] [Order article via Infotrieve]
30.
Atherton BT, Meyer DM, Simpson DG. Assembly and
remodelling of myofibrils and intercalated discs in cultured neonatal
rat heart cells. J Cell Sci. 1986;86:233248.
31.
Silverman HS, Wei S, Haigney MC, Ocampo CJ, Stern MD.
Myocyte adaptation to chronic hypoxia and development of
tolerance to subsequent acute severe hypoxia. Circ
Res. 1997;80:699707.
32. Mitcheson JS, Hancox JC, Levi AJ. Cultured adult rabbit myocytes: effect of adding supplements to the medium, and response to isoprenaline. J Cardiovasc Electrophysiol. 1997;8:10201030.[Medline] [Order article via Infotrieve]
33.
Perez-Reyes E, Castellano A, Kim HS, Bertrand P,
Baggstrom E, Lacerda AE, Wei XY, Birnbaumer L. Cloning and expression
of a cardiac/brain ß subunit of the L-type calcium channel.
J Biol Chem. 1992;267:17921797.
34.
de Leon M, Wang Y, Jones L, Perez-Reyes E, Wei X, Soong
TW, Snutch TP, Yue DT. Essential Ca2+-binding
motif for Ca2+-sensitive inactivation of L-type
Ca2+ channels. Science. 1995;270:15021506.
35.
Castellano A, Wei X, Birnbaumer L, Perez-Reyes E.
Cloning and expression of a third calcium channel ß subunit.
J Biol Chem. 1993;268:34503455.
36. Patil PG, Brody DL, Yue DT. Preferential closed-state inactivation of neuronal calcium channels. Neuron. 1998;20:10271038.[Medline] [Order article via Infotrieve]
37.
Brody DL, Patil PG, Mulle JG, Snutch TP, Yue DT. Bursts
of action potential waveforms relieve G-protein inhibition of
recombinant P/Q-type Ca2+ channels in HEK 293
cells. J Physiol. 1997;499:637644.
38. Imredy JP, Yue DT. Mechanism of Ca2+-sensitive inactivation of L-type Ca2+ channels. Neuron. 1994;12:13011318.[Medline] [Order article via Infotrieve]
39.
Sham JS, Cleemann L, Morad M. Functional coupling of
Ca2+ channels and ryanodine receptors in cardiac
myocytes. Proc Natl Acad Sci U S A. 1995;92:121125.
40.
Sipido KR, Callewaert G, Carmeliet E. Inhibition and
rapid recovery of Ca2+ current during
Ca2+ release from sarcoplasmic reticulum in
guinea pig ventricular myocytes. Circ Res. 1995;76:102109.
41. Neher E. Correction for liquid junction potentials in patch clamp experiments. Methods Enzymol. 1992;207:123131.[Medline] [Order article via Infotrieve]
42. Chen CA, Okayama H. Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA. Biotechniques. 1988;6:632638.[Medline] [Order article via Infotrieve]
43.
Felgner PL, Gadek TR, Holm M, Roman R, Chan HW, Wenz M,
Northrop JP, Ringold GM, Danielsen M. Lipofection: a highly efficient,
lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci
U S A. 1987;84:74137417.
44. Antin PB, Mar JH, Ordahl CP. Single cell analysis of transfected gene expression in primary heart cultures containing multiple cell types. Biotechniques. 1988;6:6402, 6459.[Medline] [Order article via Infotrieve]
45.
Xu H, Miller J, Liang BT. High-efficiency gene transfer
into cardiac myocytes. Nucleic Acids Res. 1992;20:64256426.
46. Johns DC, Nuss HB, Chiamvimonvat N, Ramza BM, Marbán E, Lawrence JH. Adenovirus-mediated expression of a voltage-gated potassium channel in vitro (rat cardiac myocytes) and in vivo (rat liver): a novel strategy for modifying excitability. J Clin Invest. 1995;96:11521158.
47.
Brehm P, Eckert R. Calcium entry leads to inactivation
of calcium channel in Paramecium. Science. 1978;202:12031206.
48.
Kass RS, Sanguinetti M. Inactivation of calcium channel
current in the calf cardiac Purkinje fiber: evidence for voltage- and
calcium-mediated mechanisms. J Gen Physiol. 1984;84:705726.
49.
Lee K, Marbán E, Tsien RW. Inactivation of
calcium channels in mammalian heart cells: joint dependence on membrane
potential and intracellular calcium. J Physiol. 1985;364:395411.
50.
Yamaguchi H, Hara M, Strobeck M, Fukasawa K, Schwartz
A, Varadi G. Multiple modulation pathways of calcium channel activity
by a ß subunit: direct evidence of ß subunit participation in
membrane trafficking of the
1C subunit.
J Biol Chem. 1998;273:1934819356.
51.
Kamp TJ, Perez-Garcia MT, Marbán E. Enhancement
of ionic current and charge movement by coexpression of calcium
channel ß1A subunit with
1C subunit in a human embryonic kidney cell
line. J Physiol. 1996;492:8996.
52. Trouet D, Nilius B, Voets T, Droogmans G, Eggermont J. Use of a bicistronic GFP-expression vector to characterise ion channels after transfection in mammalian cells. Pflugers Arch. 1997;434:632638.[Medline] [Order article via Infotrieve]
53.
Tareilus E, Roux M, Qin N, Olcese R, Zhou J, Stefani E.
A Xenopus oocyte ß subunit: evidence for a role in the
assembly/expression of voltage-gated calcium channels that is separate
from its role as a regulatory subunit. Proc Natl Acad Sci
U S A. 1997;94:17031708.
54.
Walker D, Bichet D, Campbell KP, De Waard M. A
ß4 isoform-specific interaction site in the
carboxyl-terminal region of the voltage-dependent
Ca2+ channel
1A subunit.
J Biol Chem. 1998;273:23612367.
55.
Chien AJ, Zhao X, Shirokov RE, Puri TS, Chang CF, Sun
S, Rios E, Hosey M. Roles of a membrane-localized ß subunit in
the formation and targeting of functional L-type
Ca2+ channels. J Biol Chem. 1995;270:3003630044.
56.
Chien AJ, Gao T, Perez-Reyes E, Hosey MM. Membrane
targeting of L-type calcium channels: role of palmitoylation in the
subcellular localization of the ß2a
subunit. J Biol Chem. 1998;273:2359023597.
57.
Brice NL, Berrow NS, Campbell V, Page KM,
Brickley K, Tedder I, Dolphin AC. Importance of the different ß
subunits in the membrane expression of the
1A
and
2 calcium channel subunits: studies using
a depolarization-sensitive
1A antibody.
Eur J Neurosci. 1997;9:749759.[Medline]
[Order article via Infotrieve]
58. Ouadid H, Albat B, Nargeot J. Calcium currents in diseased human cardiac cells. J Cardiovasc Pharmacol. 1995;25:282291.[Medline] [Order article via Infotrieve]
59. Mukherjee R, Hewett KW, Spinale FG. Myocyte electrophysiological properties following the development of supraventricular tachycardia-induced cardiomyopathy. J Mol Cell Cardiol. 1995;27:13331348.[Medline] [Order article via Infotrieve]
60.
Wang DW, Kiyosue T, Shigematsu S, Arita M.
Abnormalities of K+ and
Ca2+ currents in ventricular myocytes
from rats with chronic diabetes. Am J Physiol. 1995;269:H1288H1296.
61. Santos PE, Barcellos LC, Mill JG, Masuda MO. Ventricular action potential and L-type calcium channel in infarct-induced hypertrophy in rats. J Cardiovasc Electrophysiol. 1995;6:10041014.[Medline] [Order article via Infotrieve]
62. Thuringer D, Deroubaix E, Coulombe A, Coraboeuf E, Mercadier JJ. Ionic basis of the action potential prolongation in ventricular myocytes from Syrian hamsters with dilated cardiomyopathy. Cardiovasc Res. 1996;31:747757.[Medline] [Order article via Infotrieve]
63.
Hullin R, Asmus F, Ludwig A, Hersel J, Boekstegers P.
Subunit expression of the cardiac L-type calcium channel is
differentially regulated in diastolic heart failure of the
cardiac allograft. Circulation. 1999;100:155163.
64. Beuckelmann DJ, Nabauer M, Erdmann E. Characteristics of calcium-current in isolated human ventricular myocytes from patients with terminal heart failure. J Mol Cell Cardiol. 1991;23:929937.[Medline] [Order article via Infotrieve]
65.
Cens T, Restituito S, Galas S, Charnet P. Voltage and
calcium use the same molecular determinants to inactivate
calcium channels. J Biol Chem. 1999;274:54835490.
66.
Linz KW, Meyer R. Control of L-type calcium current
during the action potential of guinea-pig ventricular
myocytes. J Physiol. 1998;513:425442.
67. Cens T, Restituito S, Charnet P. Regulation of Ca-sensitive inactivation of a L-type Ca2+ channel by specific domains of ß subunits. FEBS Lett. 1999;450:1722.[Medline] [Order article via Infotrieve]
68. Hullin R, Singer-Lahat D, Freichel M, Biel M, Dascal N, Hofmann F, Flockerzi V. Calcium channel ß subunit heterogeneity: functional expression of cloned cDNA from heart, aorta and brain. EMBO J. 1992;11:885890.[Medline] [Order article via Infotrieve]
69.
Qin N, Platano D, Olcese R, Costantin JL, Stefani E,
Birnbaumer L. Unique regulatory properties of the type 2a
Ca2+ channel ß subunit caused by
palmitoylation. Proc Natl Acad Sci U S A. 1998;95:46904695.
70.
Collin T, Wang JJ, Nargeot J, Schwartz A. Molecular
cloning of three isoforms of the L-type voltage-dependent calcium
channel ß subunit from normal human heart. Circ Res. 1993;72:13371344.
This article has been cited by other articles:
![]() |
L. O'Brien, S. Perkins, A. Williams, L. Eastaugh, A. Phelps, J. Wu, and R. Phillpotts Alpha interferon as an adenovirus-vectored vaccine adjuvant and antiviral in Venezuelan equine encephalitis virus infection J. Gen. Virol., April 1, 2009; 90(4): 874 - 882. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Miriyala, T. Nguyen, D. T. Yue, and H. M. Colecraft Role of CaV{beta} Subunits, and Lack of Functional Reserve, in Protein Kinase A Modulation of Cardiac CaV1.2 Channels Circ. Res., April 11, 2008; 102(7): e54 - e64. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Herzig, I. F. Y. Khan, D. Grundemann, J. Matthes, A. Ludwig, G. Michels, U. C. Hoppe, D. Chaudhuri, A. Schwartz, D. T. Yue, et al. Mechanism of Cav1.2 channel modulation by the amino terminus of cardiac {beta}2-subunits FASEB J, May 1, 2007; 21(7): 1527 - 1538. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. D. J. ter Keurs and P. A. Boyden Calcium and Arrhythmogenesis Physiol Rev, April 1, 2007; 87(2): 457 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Schroder, J. Magyar, D. Burgess, D. Andres, and J. Satin Chronic verapamil treatment remodels ICa,L in mouse ventricle Am J Physiol Heart Circ Physiol, April 1, 2007; 292(4): H1906 - H1916. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Yang, B. A. Alseikhan, H. Hiel, L. Grant, M. X. Mori, W. Yang, P. A. Fuchs, and D. T. Yue Switching of Ca2+-Dependent Inactivation of CaV1.3 Channels by Calcium Binding Proteins of Auditory Hair Cells. J. Neurosci., October 18, 2006; 26(42): 10677 - 10689. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Crump, R. N. Correll, E. A. Schroder, W. C. Lester, B. S. Finlin, D. A. Andres, and J. Satin L-type calcium channel {alpha}-subunit and protein kinase inhibitors modulate Rem-mediated regulation of current Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1959 - H1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kanevsky and N. Dascal Regulation of Maximal Open Probability Is a Separable Function of Cav{beta} Subunit in L-type Ca2+ Channel, Dependent on NH2 Terminus of {alpha}1C (Cav1.2{alpha}) J. Gen. Physiol., June 26, 2006; 128(1): 15 - 36. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Nerbonne and R. S. Kass Molecular Physiology of Cardiac Repolarization Physiol Rev, October 1, 2005; 85(4): 1205 - 1253. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. X. Takahashi, J. Miriyala, L. H. Tay, D. T. Yue, and H. M. Colecraft A CaV{beta} SH3/Guanylate Kinase Domain Interaction Regulates Multiple Properties of Voltage-gated Ca2+ Channels J. Gen. Physiol., September 26, 2005; 126(4): 365 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Cohen, J. D. Foell, R. C. Balijepalli, V. Shah, J. W. Hell, and T. J. Kamp Unique modulation of L-type Ca2+ channels by short auxiliary {beta}1d subunit present in cardiac muscle Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2363 - H2374. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Dubel, C. Altier, S. Chaumont, P. Lory, E. Bourinet, and J. Nargeot Plasma Membrane Expression of T-type Calcium Channel {alpha}1 Subunits Is Modulated by High Voltage-activated Auxiliary Subunits J. Biol. Chem., July 9, 2004; 279(28): 29263 - 29269. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Foell, R. C. Balijepalli, B. P. Delisle, A. M. R. Yunker, S. L. Robia, J. W. Walker, M. W. McEnery, C. T. January, and T. J. Kamp Molecular heterogeneity of calcium channel {beta}-subunits in canine and human heart: evidence for differential subcellular localization Physiol Genomics, April 13, 2004; 17(2): 183 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Su, M. Sheets, H. Ishida, F. Li, and W. H. Barry Saxitoxin Blocks L-Type ICa J. Pharmacol. Exp. Ther., January 1, 2004; 308(1): 324 - 329. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Schjott, S.-C. Hsu, and M. R. Plummer The Neuronal {beta}4 Subunit Increases the Unitary Conductance of L-type Voltage-gated Calcium Channels in PC12 Cells J. Biol. Chem., September 5, 2003; 278(36): 33936 - 33942. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hullin, I. F. Y. Khan, S. Wirtz, P. Mohacsi, G. Varadi, A. Schwartz, and S. Herzig Cardiac L-type Calcium Channel {beta}-Subunits Expressed in Human Heart Have Differential Effects on Single Channel Characteristics J. Biol. Chem., June 6, 2003; 278(24): 21623 - 21630. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-S. Wang and I. S Cohen Calcium channel heterogeneity in canine left ventricular myocytes J. Physiol., March 15, 2003; 547(3): 825 - 833. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Bosch, C. R. Scherer, N. Rub, S. Wohrl, K. Steinmeyer, H. Haase, A. E. Busch, L. Seipel, and V. Kuhlkamp Molecular mechanisms of early electrical remodeling: transcriptional downregulation of ion channel subunits reduces ICa,L and Ito in rapid atrial pacing in rabbits J. Am. Coll. Cardiol., March 5, 2003; 41(5): 858 - 869. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Song, L. Nie, A. Rodriguez-Contreras, Z.-H. Sheng, and E. N. Yamoah Functional Interaction of Auxiliary Subunits and Synaptic Proteins With CaV1.3 May Impart Hair Cell Ca2+ Current Properties J Neurophysiol, February 1, 2003; 89(2): 1143 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Alseikhan, C. D. DeMaria, H. M. Colecraft, and D. T. Yue Engineered calmodulins reveal the unexpected eminence of Ca2+ channel inactivation in controlling heart excitation PNAS, December 24, 2002; 99(26): 17185 - 17190. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Garcia, E. Carrillo, S. Rebolledo, M. C Garcia, and J. A Sanchez The {beta}1a subunit regulates the functional properties of adult frog and mouse L-type Ca2+ channels of skeletal muscle J. Physiol., December 1, 2002; 545(2): 407 - 419. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Kamp and J.-Q. He L-Type Ca2+ Channels Gaining Respect in Heart Failure Circ. Res., September 20, 2002; 91(6): 451 - 453. [Full Text] [PDF] |
||||
![]() |
H. M Colecraft, B. Alseikhan, S. X Takahashi, D. Chaudhuri, S. Mittman, V. Yegnasubramanian, R. S Alvania, D. C Johns, E. Marban, and D. T Yue Novel functional properties of Ca2+ channel {beta} subunits revealed by their expression in adult rat heart cells J. Physiol., June 1, 2002; 541(2): 435 - 452. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F Bosch and S. Nattel Cellular electrophysiology of atrial fibrillation Cardiovasc Res, May 1, 2002; 54(2): 259 - 269. [Full Text] [PDF] |
||||
![]() |
T. Yagi, J. Pu, P. Chandra, M. Hara, P. Danilo Jr., M. R Rosen, and P. A Boyden Density and function of inward currents in right atrial cells from chronically fibrillating canine atria Cardiovasc Res, May 1, 2002; 54(2): 405 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Geib, G. Sandoz, V. Cornet, K. Mabrouk, O. Fund-Saunier, D. Bichet, M. Villaz, T. Hoshi, J.-M. Sabatier, and M. De Waard The Interaction between the I-II Loop and the III-IV Loop of Cav2.1 Contributes to Voltage-dependent Inactivation in a beta -Dependent Manner J. Biol. Chem., March 15, 2002; 277(12): 10003 - 10013. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yamada, M. Nagashima, M. Tsutsuura, T. Kobayashi, S. Seki, N. Makita, Y. Horio, and N. Tohse Cloning of a Functional Splice Variant of L-type Calcium Channel beta 2 Subunit from Rat Heart J. Biol. Chem., December 7, 2001; 276(50): 47163 - 47170. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Q. He, M. W Conklin, J. D Foell, M. R Wolff, R. A Haworth, R. Coronado, and T. J Kamp Reduction in density of transverse tubules and L-type Ca2+ channels in canine tachycardia-induced heart failure Cardiovasc Res, February 1, 2001; 49(2): 298 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tateyama, S. Zong, T. Tanabe, and R. Ochi Properties of voltage-gated Ca2+ channels in rabbit ventricular myocytes expressing Ca2+ channel {alpha}1E cDNA Am J Physiol Cell Physiol, January 1, 2001; 280(1): C175 - C182. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sokolov, E. Timin, and S. Hering On the Role of Ca2+- and Voltage-Dependent Inactivation in Cav1.2 Sensitivity for the Phenylalkylamine (-)Gallopamil Circ. Res., October 12, 2001; 89(8): 700 - 708. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Research Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |