© 2000 American Heart Association, Inc.
UltraRapid Communications |
Effects of Long-Term Nitroglycerin Treatment on Endothelial Nitric Oxide Synthase (NOS III) Gene Expression, NOS III–Mediated Superoxide Production, and Vascular NO Bioavailability
From the University Hospital Eppendorf (T.M., H.M., U.H., E.M., M.H., M.O., M.S., A.W., L.D., T.M.), Division of Cardiology, Hamburg, and the Department of Pharmacology (H.L., U.F.), Johannes Gutenberg University, Mainz, Germany.
Correspondence to Thomas Münzel, MD, Universitätskrankenhaus Eppendorf, Abteilung für Kardiologie, Martinistrasse 52, 20246 Hamburg, Germany. E-mail muenzel{at}uke.uni-hamburg.de
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract—Long-term nitroglycerin (NTG) treatment has been shown to be associated with cross-tolerance to endothelium-dependent vasodilators. It may involve increased production of reactive oxygen species (such as superoxide, O2·-) that rapidly inactivate the nitric oxide (NO) released from the endothelial cells. It remains to be elucidated, however, whether long-term treatment with NTG alters the activity and expression of the endothelial NO synthase (NOS III) and whether this enzyme can contribute to O2·- formation. We studied the influence of long-term NTG treatment on the expression of NOS III as assessed by RNase protection assay and Western blot. Tolerance was measured ex vivo in organ chamber experiments with rat aortic rings. O2·- and NO formation were quantified using lucigenin- and Cypridina luciferin analog–enhanced chemiluminescence as well as electron spin resonance (ESR) spectroscopy. Treatment of Wistar rats with NTG (Alzet osmotic minipumps, NTG concentration 10 µg · kg-1 · min-1) for 3 days caused marked tolerance, cross-tolerance to the endothelium-dependent vasodilator acetylcholine, and a significant increase in O2·--induced chemiluminescence. Tolerance was associated with a significant increase in NOS III mRNA to 236±28% and NOS III protein to 239±17%. In control vessels, the NOS inhibitor NG-nitro-L-arginine (L-NNA) increased the O2·--mediated chemiluminescence, indicating that basal production of endothelium-derived NO depresses the baseline chemiluminescence signal. In the setting of tolerance, however, L-NNA decreased steady-state O2·- levels, indicating the involvement of NOS III in O2·- formation. Likewise, A23187-induced, NOS III–mediated O2·- production was more pronounced in tolerant than in control vessels. Vascular NO bioavailability as assessed with ESR spectroscopy using iron-thiocarbamate as a trap for NO was significantly reduced in tolerant vessels. Pretreatment of tolerant tissue in vitro with the protein kinase C (PKC) inhibitors reduced basal and stimulated NOS III–mediated O2·- production and partially reversed vascular tolerance. These findings suggest that NTG treatment increases the expression of a dysfunctional NOS III gene, leading to increased formation of O2·- and decreased vascular NO bioavailability. Normalization of NOS III–mediated O2·- production and improvement of tolerance with PKC inhibition suggests an important role for PKC isoforms in mediating vascular dysfunction caused by long-term NTG treatment. The full text of this article is available at http://www.circresaha.org.
Key Words: nitrate tolerance • nitric oxide synthase uncoupling • electron spin resonance
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Nitroglycerin (NTG) remains one of the foremost drugs in the treatment of acute and chronic coronary syndromes. Despite its beneficial effects on angina threshold in patients with coronary artery disease, its efficacy during continuous treatment is limited because of the rapid development of nitrate tolerance.1 2 Animal as well as clinical studies have also demonstrated negative effects of NTG treatment for vascular function as indicated by the development of cross-tolerance to endothelium-dependent vasodilators such as acetylcholine (ACh)3 4 and calcium ionophore.5 The most attractive hypotheses so far to explain the phenomenon of cross-tolerance include a desensitization of the target enzyme guanylyl cyclase5 and/or increased vascular production of reactive oxygen species leading to enhanced breakdown of endothelial-derived nitric oxide (NO).4 It remains to be established, however, whether in vivo supplementation with NTG alters gene expression of endothelial nitric oxide synthase (NOS III). Nitrovasodilator therapy with the sydnonimine CAS 936 has been shown to result in a more than 50% reduction in the expression of NOS III gene.6 In addition, exogenously applied NO has been demonstrated to directly inhibit NOS III activity.7 More recent in vitro experiments revealed that the expression of the NOS III gene is protein kinase C (PKC) dependent.8 Two studies demonstrated an activation of PKC in the setting of nitrate tolerance.9 10 NTG treatment for 3 days resulted in an increase in hypersensitivity to vasoconstrictors such as angiotensin II, phenylephrine, and serotonin, a phenomenon that was blocked ex vivo with PKC inhibitors such as staurosporine and calphostin C.10 In in vivo studies, PKC inhibitors prevented enhanced sensitivity to vasoconstrictors such as phenylephrine and thromboxane as well as the development of nitrate tolerance.9 Interestingly, recent studies demonstrate that NO can directly activate PKC isoforms in the heart. The authors speculated that these findings may have implications for long-term nitrate therapy.11 On the basis of these considerations, we investigated to what extent long-term treatment with NTG alters the expression and function of the NOS III gene. We also tested with electron spin resonance (ESR) spectroscopy to what extent long-term NTG treatment may influence the bioavailability of NO in vascular tissue.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The present study was undertaken in accordance with the guidelines for animal experimentation at University Hospital Eppendorf, Hamburg, Germany.
Animal Model: In Vivo Nitrate Tolerance
Wistar rats (210 to 250 g; Harlan, Horst, Netherlands)
were treated with a subcutaneous osmotic minipump (Alza Corp) filled
with either NTG or vehicle. NTG infusion rate averaged 0.5 mg/h.
Organ Chamber Experiments
Vasodilator responses to NTG and the
endothelium-dependent vasodilator ACh were determined
in organ chambers as described recently.12 To address the
role of PKC in mediating nitrate tolerance, aortic rings from control
and nitrate-tolerant animals were incubated with the specific PKC
inhibitors chelerythrine (3 µmol/L) and Gö
6976 (1 µmol/L) for 30 minutes.13 To address a role
of intracellular L-arginine depletion in nitrate tolerance
and cross-tolerance to ACh, aortic rings from NTG-treated rats were
incubated with L-arginine (10-3
mol/L for 30 minutes).
Measurement of O2·- Production
in Intact Vessels With Lucigenin-and Cypridina Luciferin
Analog–Enhanced Chemiluminescence
O2·-
production in intact vessels was measured as lucigenin-derived
chemiluminescence (LDCL) or using a Cypridina luciferin
analog (CLA) as described previously.14 15 In
separate studies, the effects of PKC inhibition with chelerythrine
(3 µmol/L) and Gö 6976 (1 µmol/L for 30 minutes) on
vascular O2·-
production were tested. To address the influence of
endothelial (NOS III derived) NO on vascular LDCL,
the endothelium was mechanically removed or
vessels were incubated with
NG-nitro-L-arginine
(L-NNA, 1 mmol/L).14 To estimate stimulated NOS
III–mediated O2·-
production by aortic tissue from control and tolerant animals,
calcium ionophore A23187 (10 µmol/L) was added to the tissue as
described.16
ESR Studies: Detection of Vascular NO and
O2·-
Concentrations of NO in rat aorta in the presence of
O2·- were assayed using ESR
spectroscopy and the spin-trap iron (II)-proline-dithio-carbamate
[Fe(PrTC)2], which has been shown to trap NO
with high efficacy by forming an ESR-detectable paramagnetic complex
Fe(NO)(PrTC)2.17 ESR measurements with
vascular samples were performed with an X-band ESR spectrometer (ECS
106, Bruker, Karlsruhe, Germany) and a flat quartz cell (Bruker, ERC
4201) placed into a dual-probe ESR resonator (ER 4105 DR, Bruker,
Germany).
To quantify O2·- in vessels from animals with and without NTG treatment, the formation of CP° radicals was monitored using ESR spectroscopy and 1-hydroxy-3-carboxy-2,2,5,-tetramethyl-pyrrolidine hydrochloride (CPH, 1 mmol/L) as described.15
Cloning of a Rat NOS III cDNA Fragment and RNase Protection
Analysis
A cDNA fragment of rat NOS III was generated with reverse
transcription–polymerase chain reaction as described18
using 2 µg of total RNA from rat aorta.
Oligonucleotide primers were GACATTGAGAGCAAAGGGCTGC
(sense) and CGGCTTGTCACCTCCTGG (antisense). The cloning of the rat
-actin probe (used for normalization of the RNase protection assays)
was done as previously described.19 RNase protection
assays were performed with a mixture of RNase A and RNase T1 as
described.8 18 The protected RNA fragments of NOS III and
-actin were 425 nt and 110 nt, respectively.
Superoxide Dismutase Activity Assay
To address the effects of PKC inhibition on vascular superoxide
dismutase (SOD) activity, SOD activity was assessed by measuring the
rate of SOD-sensitive autooxidation of
6-hydroxydopamine as described.20
Western Blot Analyses
Rat aortic tissue was homogenized and subjected to
SDS-PAGE and subsequently blotted to nitrocellulose membranes (BioRad).
The blots were developed with a mouse monoclonal antibody to human NOS
III (dilution 1:2500, Transduction Laboratories). The 135-kDa NOS III
band was quantified by densitometry.
An expanded Materials and Methods section is available online at http://www.circresaha.org.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Effects of In Vivo NTG Treatment on NTG- and ACh-Induced Vasorelaxation
Three days of treatment with NTG markedly attenuated the NTG concentration-response relationship (Table
). Removal
of the endothelium produced a shift to the left of the
control curve and increased the maximum relaxing effect of NTG in
control and nitrate-tolerant aortas. Tolerance was associated with
cross-tolerance to the endothelium-dependent
vasodilator ACh. Incubation of tolerant tissue with chelerythrine and
Gö 6976 significantly improved NTG-induced vasodilation in
tolerant tissue while having no significant effects on the NTG
concentration-response relationship in control vessels (Table).
Incubation of tolerant tissue with L-arginine did not
modify the ACh dose-response relationship (ED50
tol: 7.22±0.09 versus 6.94±0.11 [n=10]; max.relax tol: 68±6%
versus 70±5 with L-arginine, respectively).
|
Effects of In Vivo NTG Treatment on Vascular
O2·- Production Determined With
LDCL, CLA Chemiluminescence, and ESR Spectroscopy
In control vessels with intact endothelium, LDCL
values averaged 1355±123 counts/mg tissue per minute (n=8, Figure 1). NTG treatment for 3 days markedly
increased vascular O2·-
production in these vessels to 3334±414 counts/mg per minute
(Figure 1). With CLA chemiluminescence, similar increases in
vascular O2·- were observed
(CLA control tissue: 23 805±3040 counts/mg per minute, CLA-tolerant
tissue: 40 915±6661 counts/mg per minute). With ESR spectroscopy, we
observed a significant increase in the vascular
O2·- levels. The intensity of
the ESR signal of CPo radicals increased from
11.5±1.5 CPo in control aortas to 27.7±2.0
CPo in aorta from NTG-treated animals.
|
P<0.05 vs
tolerant without PKC inhibition.
Incubation of control vessels with the NOS inhibitor L-NNA
increased the LDCL signals, indicating as before a significant
attenuation of the baseline LDCL signal by
endothelium-derived NO14 (Figure 1
). In vessels from NTG-treated rats, LDCL was significantly
decreased in response to L-NNA, indicating a marked contribution of NOS
III to the O2·-
production in tolerant vessels. There were no significant
differences in the LDCL signal in vessels without
endothelium (control: 3132±184 versus tolerant:
2799±335 counts/mg per minute). Incubation of tolerant tissue with the
NOS III substrate L-arginine did not significantly modify
vascular steady-state O2·-
levels (tolerant 3388±124 versus 3028±33 counts/mg per minute, n=8
each).
Incubation of endothelium-intact control vessels with
the PKC inhibitors chelerythrine or Gö 6976 had no
significant effects on LDCL signals from control vessels. However, the
two PKC inhibitors markedly inhibited LDCL in vessels from
NTG-treated animals (Figure 1).
Calcium ionophore A23187 has been shown to stimulate the activity of
the calcium-dependent NOS III.16 This usually results in
an increased NO generation. In a situation of enzymatic uncoupling,
however, O2·-
production can also increase.16 Indeed, in control
vessels, A23187 slightly, but significantly, increased LDCL. In
tolerant tissue, the A23187-induced increase in
O2·- was markedly increased
(Figure 2). Incubation of control tissue
and tolerant tissue with the PKC inhibitor chelerythrine
significantly inhibited NOS III–mediated
O2·- production
(Figure 2). Likewise, endothelial removal
resulted in an inhibition of the A23187-mediated increase in LDCL
(Figure 2).
|
Effects of In Vivo Treatment With NTG on NOS III mRNA Expression
and NOS III Protein
As shown in Figure 3, NTG treatment
for 3 days increased NOS III mRNA expression to 236±28% of control
(100%). Western blot analyses with protein from rat aortas
revealed a comparable increase (Figure 4). Densitometric analyses of the
NOS III protein bands indicated an increase to 239±17% after NTG
treatment.
|
|
Effects of In Vivo NTG Treatment on Vascular NO Bioavailability
Determined With ESR Spectroscopy
The effects of NTG treatment on vascular NO bioavailability in
vascular tissue as assessed with ESR spectroscopy are depicted in
Figure 5. The
representative ESR recording of the signal of
the iron-nitrosyl-dithiocarbamate complex Fe(NO)
(PrTC)2 was strikingly reduced in vessels from
NTG-treated animals compared with spectra obtained with vessels from
control animals. This indicates a marked reduction of NO
bioavailability in tolerant tissue.
|
Effects of PKC Inhibition on Vascular SOD Activity
In control vessels, SOD activity averaged 8.69±0.5 U/mg protein
(n=4). PKC inhibition with chelerythrine and Gö 6976 did not
modify vascular SOD activity (8.74±0.68 and 7.97±0.25 U/mg protein,
n=4 each).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The results of the present study show that in vivo treatment with NTG for 3 days leads to nitrate tolerance and cross-tolerance to the endothelium-dependent vasodilator ACh. Interestingly, tolerance and endothelial dysfunction were associated with a doubling in NOS III mRNA and protein. Studies with the NOS III stimulator A23187 and the inhibitor of NOS III activity L-NNA identified the enzyme as a significant source of O2·- in the setting of tolerance. The PKC inhibitors chelerythrine and Gö 6976 markedly reduced vascular O2·- production and improved NTG-induced vascular relaxations in the aortas of nitrate-tolerant rats. This suggests an important role for PKC in mediating nitrate tolerance.
Role for Oxidative Stress in Nitrate Tolerance
The present study demonstrates in agreement with previous
observations that long-term nitrate treatment leads to nitrate
tolerance associated with increases in endothelial
O2·- and cross-tolerance to
endothelium-dependent vasodilators such as
ACh.4 As a potential
O2·- source, we identified a
vascular, angiotensin II–sensitive NAD(P)H
oxidase,12 a significant
O2·- source in
endothelial21 and smooth muscle
cells.22 The concept of increased oxidative stress as a
consequence of long-term NTG therapy was further corroborated by
studies demonstrating that in vivo, but not in vitro, treatment with
NTG decreases total vascular SOD activity and expression of the
vascular Cu/Zn SOD.20 These observations led us to
conclude that increased endothelial
O2·- formation rather than
desensitization of the smooth muscle guanylyl cyclase is a decisive
determinant of in vivo nitrate tolerance.4 This concept
was further supported by clinical observations demonstrating that
antioxidants are able to reverse or to prevent the development of
nitrate tolerance in patients with stable coronary artery
disease and heart failure.23 24
The present study goes along with the oxidative stress concept of nitrate tolerance. Using a different animal model, we found that infusion of NTG for 3 days caused a marked increase in vascular O2·- as demonstrated with LDCL- or CLA-derived chemiluminescence as well as with ESR spectroscopy. As before, we found that removal of the endothelium significantly improved relaxations to NTG4 25 in tissue from nitrate-tolerant animals.
NTG Treatment and NOS III Expression
In the present study, we found a marked increase in the
expression of the NOS III mRNA and protein in response to a 3-day NTG
treatment. This observation is somewhat surprising because previous
studies demonstrated a decreased rather than increased expression of
the NOS III gene in response to long-term treatment with
nitrovasodilators.26 There is also evidence that
supplementation of vascular tissue, endothelial cells,
or platelets with high concentrations of NO inhibits NOS III
activity.7 Recent studies extended these observations by
demonstrating that sodium nitroprusside (SNP) treatment had no effect
on NOS III mRNA or protein levels in cultured pulmonary
arterial endothelial cells but did produce
a significant decrease in enzyme activity.27 Similarly,
Chen and Mehta28 described a decrease in NOS III activity
in washed human platelets on exposure to NTG but failed to detect
changes in NOS III mRNA.
The mechanisms underlying increased expression of NOS III in the present study in response to long-term NTG treatment remain unclear. Li et al8 have recently demonstrated increased expression of NOS III in endothelial cells after PKC activation. Interestingly, other studies have shown that long-term NTG treatment leads to PKC activation in vascular tissue.9 10
In Nitrate-Tolerant Vessels, NOS III Is Involved in
O2·- Production, and This Process Is
PKC Dependent
With the present studies, we can demonstrate
cross-tolerance to the endothelium-dependent
vasodilator ACh and with ESR studies, a marked reduction in vascular NO
bioavailability, despite increased NOS III expression. We also provide
evidence that an uncoupled NOS III is—at least partially—involved in
the increased O2·-
production seen after in vivo treatment with NTG. When aortas
of untreated animals were exposed to the NOS inhibitor
L-NNA, we established a significant increase in the LDCL signal. This
indicates that the amount of NO formed in normal vascular
endothelium under basal conditions is sufficiently high
to compete for the reaction of
O2·- with
LDCL.14 In contrast, incubation of tolerant tissue with
L-NNA decreased rather than increased steady-state vascular
O2·- levels, identifying NOS
III as a significant O2·-
source.
As an additional tool to demonstrate uncoupling of NOS III, we used A23187. Recent studies have demonstrated that A23187 stimulates the simultaneous release of NO as well as O2·- and that A23187-induced O2·- was significantly higher in aortas from prehypertensive spontaneously hypertensive rats compared with increases in O2·- in control vessels16 compatible with an uncoupling of NOS III. Similarly, we found that A23187-induced increases in LDCL were markedly stronger in nitrate-tolerant than in control aortas. As before,16 the A23187-induced increase in LDCL was almost completely inhibited by preincubation of vascular tissue from control and tolerant animals with the NOS inhibitor L-NNA indicating that the observed increases in LDCL were unlikely due to activation of non-NOS O2·- sources. The observed inhibitory effect of L-NNA on A23187 responses is in line with previous in vitro studies in which NG-nitro-L-arginine methyl ester (L-NAME) inhibited NOS III–mediated O2·- production in endothelial cells treated with LDL29 and is also in agreement with more recent studies showing that L-NAME and L-NNA have inhibitory effects on O2·- production of NOS I30 and NOS III31 in an uncoupled state.
For isolated NOS enzymes, two major conditions have been described that favor O2·- production, namely BH4 as well as L-arginine deficiency.31 32 However, in intact cells, a severe L-arginine and BH4 deficiency is not very likely to occur. In addition, in the present experiments, we can demonstrate that L-arginine is not able to improve cross-tolerance to the endothelium-dependent vasodilator ACh and does not reduce vascular O2·- production of tolerant tissue significantly. These observations make it very unlikely that uncoupling of NOS III due to intracellular L-arginine depletion accounts for the cross-tolerance phenomenon. Therefore, other mechanisms have to be postulated. Because PKC inhibition with chelerythrine and Gö 6976 was able to inhibit O2·- production of tolerant tissue as well as A23187-stimulated NOS III–mediated O2·- production, one possible explanation is the phosphorylation of NOS III (or an NOS III–associated protein) by PKC. Indeed, NOS III has been shown to be a phosphorylation target of PKC,33 and PKC activation has been shown to increase vascular O2·- production.34
Mechanisms of PKC Activation During NTG Treatment
The mechanisms underlying PKC activation during NTG therapy
are not known at this time. NTG therapy has been shown to increase
circulating angiotensin II levels,1 which in
turn may activate PKC, ultimately leading to the activation of
the NAD(P)H oxidase and increased vascular
O2·-
production.35 36 Recent studies, however, have
also shown that incubation of cultured aortic
endothelial cells as well as cultured pulmonary
arterial endothelial cells with
nitrovasodilators such as NTG, SNP, and spermine NONOate can cause
significant increases in
O2·-27 37 . NO, peroxynitrite
(ONOO-),
H2O2, and OH·
have been shown to activate PKC directly11 38 or
via stimulation of phospholipase D.39 40 Interestingly,
NO-induced O2·-
production has been shown to be associated with a PKC-dependent
NOS III phosphorylation.27 On the basis of
these observations, it is tempting to speculate that long-term in vivo
therapy with NTG may lead directly (NO mediated) or indirectly (via
angiotensin II) to PKC activation within
endothelial cells, which in turn may be also be
responsible for the observed increases in NOS III
expression.8
Taken together, these data suggest that long-term NTG treatment causes not only an expressional upregulation but also an uncoupling of the endothelial NOS III gene, resulting in an increased basal and stimulated NOS III–mediated O2·- production. This may explain why in vivo treatment with NTG has been shown to cause cross-tolerance to endothelium-dependent vasodilators such as Ach.4 5 In addition, the striking in vitro effects of PKC inhibitors on in vivo tolerance and NOS III–mediated O2·- production point to a causal role for PKC in mediating these phenomena and also suggest a therapeutic potential of this class of drugs in preventing the development of nitrate tolerance.
|
Acknowledgments |
|---|
This study was supported by Deutsche Forschungsgemeinschaft Grant Mu 1079/2-2 (to T.M.), by the Collaborative Research Center SFB 553, Project A1 (to U.F.), and in part by German Israel Foundation Grant I-504-178 (to T.M.).
Received July 8, 1999; accepted October 25, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Münzel T, Heitzer T, Kurz S, Harrison DG, Luhman C, Pape L, Olschewski M, Just H. Dissociation of coronary vascular tolerance and neurohormonal adjustments during long-term nitroglycerin therapy in patients with stable coronary artery disease. J Am Coll Cardiol. 1996;27:297–303.[Abstract]
2.
Elkayam U, Kulick D, McIntosh N, Roth A, Hsueh W,
Rahimtoola SH. Incidence of early tolerance to
hemodynamic effects of continuous infusion of
nitroglycerin in patients with coronary artery
disease and heart failure. Circulation. 1987;76:577–584.
3.
Caramori PR, Adelman AG, Azevedo ER, Newton GE,
Parker AB, Parker JD. Therapy with nitroglycerin
increases coronary vasoconstriction in response to
acetylcholine. J Am Coll Cardiol. 1998;32:1969–1974.
4. Münzel T, Sayegh H, Freeman BA, Tarpey MM, Harrison DG. Evidence for enhanced vascular superoxide anion production in nitrate tolerance. A novel mechanism underlying tolerance and cross-tolerance. J Clin Invest. 1995;95:187–194.
5. Molina CR, Andresen JW, Rapoport RM, Waldman S, Murad F. Effect of in vivo nitroglycerin therapy on endothelium-dependent and independent vascular relaxation and cyclic GMP accumulation in rat aorta. J Cardiovasc Pharmacol. 1987;10:371–378.[Medline] [Order article via Infotrieve]
6.
Smith CJ, Sun D, Hoegler C, Roth DS, Chang X, Chao G,
Xu XB, Kobari Y, Pritchard K, Sessa WC, Hintze TH. Reduced gene
expression of vascular endothelial NO synthase and
cyclooxygenase I in heart failure. Circ
Res. 1996;78:58–64.
7.
Buga GM, Griscavage JM, Rogers NE, Ignarro LJ.
Negative feedback regulation of endothelial cell
function by nitric oxide. Circ Res. 1993;73:808–812.
8.
Li H, Oehrlein SA, Wallerath T, Ihrig-Biedert I,
Wohlfart P, Ulshofer T, Jessen T, Herget T, Forstermann U, Kleinert H.
Activation of protein kinase C 
and/or 
enhances
transcription of the human endothelial nitric oxide
synthase gene. Mol Pharmacol. 1998;53:630–637.
9. Zierhut W, Ball HA. Prevention of vascular nitroglycerin tolerance by inhibition of protein kinase C. Br J Pharmacol. 1996;119:3–5.[Medline] [Order article via Infotrieve]
10.
Münzel T, Giaid A, Kurz S, Stewart DJ, Harrison
DG. Evidence for a role of endothelin 1 and protein kinase C in
nitroglycerin tolerance. Proc Natl Acad Sci
U S A. 1995;92:5244–5248.
11.
Ping P, Takano H, Zhang J, Tang XL, Qiu Y, Li RCX,
Banerjee S, Dawn B, Balafonova Z, Bolli R. Isoform-selective activation
of protein kinase C by nitric oxide in the heart of conscious rabbits:
a signaling mechanism for both nitric oxide–induced and
ischemia-induced preconditioning. Circ Res. 1999;84:587–604.
12. Münzel T, Kurz S, Rajagopalan S, Thoenes M, Berrington WR, Thompson JA, Freeman BA, Harrison DG. Hydralazine prevents nitroglycerin tolerance by inhibiting activation of a membrane-bound NADH oxidase. A new action for an old drug. J Clin Invest. 1996;98:1465–1470.[Medline] [Order article via Infotrieve]
13. Herbert JM, Augereau JM, Gleye J, Maffrand JP. Chelerythrine is a potent and specific inhibitor of protein kinase C. Biochem Biophys Res Commun. 1990;172:993–999.[Medline] [Order article via Infotrieve]
14. Skatchkov MP, Sperling D, Hink U, Mulsch A, Harrison DG, Sindermann I, Meinertz T, Münzel T. Validation of lucigenin as a chemiluminescent probe to monitor vascular superoxide as well as basal vascular nitric oxide production. Biochem Biophys Res Commun. 1999;254:319–324.[Medline] [Order article via Infotrieve]
15. Skatchkov MP, Sperling D, Hink U, Anggard E, Münzel T. Quantification of superoxide radical formation in intact vascular tissue using a Cypridina luciferin analog as an alternative to lucigenin. Biochem Biophys Res Commun. 1998;248:382–386.[Medline] [Order article via Infotrieve]
16. Cosentino F, Patton S, d’Uscio LV, Werner ER, Werner-Felmayer G, Moreau P, Malinski T, Luscher TF. Tetrahydrobiopterin alters superoxide and nitric oxide release in prehypertensive rats. J Clin Invest. 1998;101:1530–1537.[Medline] [Order article via Infotrieve]
17. Paschenko SV, Khramtsov VV, Skatchkov MP, Plyusnin VF, Bassenge E. EPR and laser flash photolysis studies of the reaction of nitric oxide with water soluble NO trap Fe(II)-proline-dithiocarbamate complex. Biochem Biophys Res Commun. 1996;225:577–584.[Medline] [Order article via Infotrieve]
18.
Kleinert H, Wallerath T, Euchenhofer C, Ihrig-Biedert
I, Li H, Forstermann U. Estrogens increase transcription of the
human endothelial NO synthase gene: analysis of
the transcription factors involved. Hypertension. 1998;31:582–588.
19.
Schwarz PM, Kleinert H, Förstermann U. Potential
functional significance of brain-type and muscle-type nitric oxide
synthase I expressed in adventitia and media of rat aorta.
Arterioscler Thromb Vasc Biol. 1999;19:2584–2590.
20. Münzel T, Hink U, Yigit H, Macharzina R, Harrison DG, Mulsch A. Role of superoxide dismutase in in vivo and in vitro nitrate tolerance. Br J Pharmacol. 1999;127:1224–1230.[Medline] [Order article via Infotrieve]
21.
Mohazzab KM, Kaminski PM, Wolin MS. NADH oxidoreductase
is a major source of superoxide anion in bovine coronary artery
endothelium. Am J Physiol. 1994;266:H2568–2572.
22.
Griendling KK, Minieri CA, Ollerenshaw JD, Alexander
RW. Angiotensin II stimulates NADH and NADPH oxidase
activity in cultured vascular smooth muscle cells. Circ Res. 1994;74:1141–1148.
23. Bassenge E, Fink N, Skatchkov M, Fink B. Dietary supplement with vitamin C prevents nitrate tolerance. J Clin Invest. 1998;102:67–71.[Medline] [Order article via Infotrieve]
24.
Watanabe H, Kakihana M, Ohtsuka S, Sugishita Y.
Randomized, double-blind, placebo-controlled study of supplemental
vitamin E on attenuation of the development of nitrate tolerance.
Circulation. 1997;96:2545–2550.
25.
Laursen JB, Mulsch A, Boesgaard S, Mordvintcev P,
Trautner S, Gruhn N, Nielsen-Kudsk JE, Busse R, Aldershvile J. In
vivo nitrate tolerance is not associated with reduced bioconversion of
nitroglycerin to nitric oxide. Circulation. 1996;94:2241–2247.
26. Smith CJ, Sun D, Hoegler C, Roth BS, Zhang X, Zhao G, Xu XB, Kobari Y, Pritchard K Jr, Sessa WC, Hintze TH. Reduced gene expression of vascular endothelial NO synthase and cyclooxygenase-1 in heart failure. Circ Res. 1996;78:58–64.
27.
Sheehy AM, Burson MA, Black SM. Nitric oxide exposure
inhibits endothelial NOS activity but not gene
expression: a role for superoxide. Am J Physiol. 1998;274:L833–L841.
28. Chen LY, Mehta JL. Downregulation of nitric oxide synthase activity in human platelets by nitroglycerin and authentic nitric oxide. J Investig Med. 1997;45:69–74.[Medline] [Order article via Infotrieve]
29.
Pritchard KA Jr, Groszek L, Smalley DM, Sessa WC, Wu M,
Villalon P, Wolin MS, Stemerman MB. Native low-density lipoprotein
increases endothelial cell nitric oxide synthase
generation of superoxide anion. Circ Res. 1995;77:510–518.
30. Leber A, Hemmens B, Klosch B, Goessler W, Raber G, Mayer B, Schmidt K. Characterization of recombinant human endothelial nitric oxide synthase from the yeast Pichia pastoris. J Biol Chem. In press.
31.
Pou S, Pou WS, Bredt DS, Snyder SH, Rosen GM.
Generation of superoxide by purified brain nitric oxide synthase.
J Biol Chem. 1992;267:24173–24176.
32.
Vasquez-Vivar J, Kalyanaraman B, Martasek P, Hogg N,
Masters BS, Karoui H, Tordo P, Pritchard KA Jr. Superoxide generation
by endothelial nitric oxide synthase: the influence of
cofactors. Proc Natl Acad Sci U S A. 1998;95:9220–9225.
33.
Hirata K, Kuroda R, Sakoda T, Katayama M, Inoue N,
Suematsu M, Kawashima S, Yokoyama M. Inhibition of
endothelial nitric oxide synthase activity by protein
kinase C. Hypertension. 1995;25:180–185.
34.
Ohara Y, Peterson TE, Zheng B, Kuo JF, Harrison DG.
Lysophosphatidylcholine increases vascular superoxide anion
production via protein kinase C activation. Arterioscler
Thromb. 1994;14:1007–1013.
35. Rajagopalan S, Kurz S, Münzel T, Tarpey M, Freeman BA, Griendling KK, Harrison DG. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. Contribution to alterations of vasomotor tone. J Clin Invest. 1996;97:1916–1923.[Medline] [Order article via Infotrieve]
36. Heitzer T, Wenzel U, Hink U, Krollner D, Skatchkov M, Stahl RA, MacHarzina R, Brasen JH, Meinertz T, Münzel T. Increased NAD(P)H oxidase-mediated superoxide production in renovascular hypertension: evidence for an involvement of protein kinase C. Kidney Int. 1999;55:252–260.[Medline] [Order article via Infotrieve]
37.
Dikalov S, Fink B, Skatchkov M, Stalleicken D, Bassenge
E. Formation of reactive oxygen species by pentaerithrityltetranitrate
and glyceryl trinitrate in vitro and development of nitrate tolerance.
J Pharmacol Exp Ther. 1998;286:938–944.
38.
Gopalakrishna R, Anderson WB.
Ca2+- and phospholipid-independent activation of
protein kinase C by selective oxidative modification of the regulatory
domain. Proc Natl Acad Sci U S A. 1989;86:6758–6762.
39.
Cohen MV, Liu Y, Liu GS, Wang P, Weinbrenner C, Cordis
GA, Das DK, Downey JM. Phospholipase D plays a role in ischemic
preconditioning in rabbit heart. Circulation. 1996;94:1713–1718.
40.
Natarajan V, Taher MM, Roehm B, Parinandi NL, Schmid
HH, Kiss Z, Garcia JG. Activation of endothelial cell
phospholipase D by hydrogen peroxide and fatty acid hydroperoxide.
J Biol Chem. 1993;268:930–937.
This article has been cited by other articles:
 |
|
 |
|
  R. Parent, N. Leblanc, and M. Lavallee Nitroglycerin reduces myocardial oxygen consumption during exercise despite vascular tolerance Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H1226 - H1234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. W. Stepp, J. Ou, A. W. Ackerman, S. Welak, D. Klick, and K. A. Pritchard Jr. Native LDL and minimally oxidized LDL differentially regulate superoxide anion in vascular endothelium in situ Am J Physiol Heart Circ Physiol, August 1, 2002; 283(2): H750 - H759. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zhang, J. W. Bissing, L. Xu, A. J. Ryan, S. M. Martin, F. J. Miller Jr, K. C. Kregel, G. R. Buettner, and R. E. Kerber Nitric oxide synthase inhibitors decrease coronary sinus-free radical concentration and ameliorate myocardial stunning in an ischemia-reperfusion model J. Am. Coll. Cardiol., August 1, 2001; 38(2): 546 - 554. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Ratz, A. B. Fraser, K. J. Rees-Milton, M. A. Adams, and B. M. Bennett Endothelin Receptor Antagonism Does Not Prevent the Development of In Vivo Glyceryl Trinitrate Tolerance in the Rat J. Pharmacol. Exp. Ther., November 1, 2000; 295(2): 578 - 585. [Abstract] [Full Text]
|
|
|
|
 |
|
 T. J. Guzik, S. Mussa, D. Gastaldi, J. Sadowski, C. Ratnatunga, R. Pillai, and K. M. Channon Mechanisms of Increased Vascular Superoxide Production in Human Diabetes Mellitus: Role of NAD(P)H Oxidase and Endothelial Nitric Oxide Synthase Circulation, April 9, 2002; 105(14): 1656 - 1662. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||