© 1999 American Heart Association, Inc.
Integrative Physiology |
Diminished Basal Phosphorylation Level of Phospholamban in the Postinfarction Remodeled Rat Ventricle
Role of ß-Adrenergic Pathway, Gi Protein, Phosphodiesterase, and Phosphatases
From the Cardiology Division (B.H., D.Q., M.B., N.E.-S.), Department of Medicine, State University of New York Health Science Center and Veterans Affairs Medical Center, Brooklyn, NY, and Laboratory of Cardiovascular Science (S.W.), Gerontology Research Center, National Institute on Aging, NIH, Baltimore, Md.
Correspondence to Nabil El-Sherif, Cardiology Division, Box 1199, SUNY Health Science Center, 450 Clarkson Ave, Brooklyn, NY 11203. E-mail nelsherif{at}aol.com
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abstract—Three weeks after myocardial infarction (MI) in the rat, remodeled hypertrophy of noninfarcted myocardium is at its maximum and the heart is in a compensated stage with no evidence of heart failure. Our hemodynamic measurements at this stage showed a slight but insignificant decrease of +dP/dt but a significantly higher left ventricular end-diastolic pressure. To investigate the basis of the diastolic dysfunction, we explored possible defects in the ß-adrenergic receptor–Gs/i protein–adenylyl cyclase–cAMP–protein kinase A–phosphatase pathway, as well as molecular or functional alterations of sarcoplasmic reticulum Ca2+-ATPase and phospholamban (PLB). We found no significant difference in both mRNA and protein levels of sarcoplasmic reticulum Ca2+-ATPase and PLB in post-MI left ventricle compared with control. However, the basal levels of both the protein kinase A–phosphorylated site (Ser16) of PLB (p16-PLB) and the calcium/calmodulin–dependent protein kinase-phosphorylated site (Thr17) of PLB (p17-PLB) were decreased by 76% and 51% in post-MI myocytes (P<0.05), respectively. No change was found in the ß-adrenoceptor density, Gs
protein level, or adenylyl
cyclase activity. Inhibition of phosphodiesterase and Gi
protein by Ro-20-1724 and pertussis toxin, respectively, did not
correct the decreased p16-PLB or p17-PLB levels. Stimulation of
ß-adrenoceptor or adenylyl cyclase increased both p16-PLB and p17-PLB
in post-MI myocytes to the same levels as in sham myocytes, suggesting
that decreased p16-PLB and p17-PLB in post-MI myocytes is not due to a
decrease in the generation of p16-PLB or p17-PLB. We found that type 1
phosphatase activity was increased by 32% (P<0.05)
with no change in phosphatase 2A activity. Okadaic acid, a protein
phosphatase inhibitor, significantly increased p16-PLB and
p17-PLB levels in post-MI myocytes and partially corrected the
prolonged relaxation of the [Ca2+]i
transient. In summary, prolonged relaxation of post-MI remodeled
myocardium could be explained, in part, by altered basal
levels of p16-PLB and p17-PLB caused by increased protein phosphatase
1 activity.
Key Words: phospholamban • phosphatase • postmyocardial infarction • sarcoplasmic reticulum
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
After myocardial infarction (MI), the heart undergoes a remodeling process characterized by significant hypertrophy of the noninfarcted myocardium.1 2 3 4 The process is adaptive in nature and primarily represents a universal response of the heart to systolic or diastolic overload from whatever cause. After a stage of compensated hypertrophy, heart failure may ensue. Heart failure is characteristically associated with systolic and diastolic dysfunction. The contraction duration is prolonged, and relaxation abnormalities occur in patients with heart failure.5 6 These changes are accompanied by prolonged [Ca2+]i transients in isolated ventricular myocytes from failing hearts.6 7 The prolonged diastolic decay of the transient in heart failure is most probably a result of reduced Ca2+ uptake or storage by the sarcoplasmic reticulum (SR).8 At present the biochemical mechanisms for this defect are controversial.
The SR plays a critical role in the regulation of cytosolic Ca2+ concentrations and thus, excitation-contraction coupling in adult myocardium. The release and reuptake of Ca2+ by the SR is tightly regulated in mammalian heart and is critical for systolic and diastolic function. Contraction is mediated through the release of Ca2+ from the SR, whereas relaxation involves the active reuptake of Ca2+ into the SR lumen by SR Ca2+-ATPase (SERCA2). In cardiac muscle, SERCA2 is under reversible regulation by phospholamban (PLB). Dephosphorylated PLB inhibits the affinity of the SERCA2 for Ca2+ and phosphorylation relieves the inhibitory effects.9 10 The mRNA levels for PLB and SERCA2 have been reported to be reduced in failing human11 12 13 and rat14 hearts. However, controversy exists regarding the corresponding protein levels.15 16 17 18 19 It is conceivable that the abnormality could be caused by functional alterations in PLB and SERCA2 in the failing ventricle without changes in their protein levels. A reduced uptake of Ca2+ into SR as well as reduced release from SR could result entirely from reduced phosphorylation of PLB.
There is significant interest in understanding the nature of alterations associated with the remodeling process and the transition from an adaptive compensated hypertrophy to a decompensated failing heart. Three weeks after MI in the rat, remodeled hypertrophy of noninfarcted myocardium is at its maximum, and the heart is in a compensated stage with no evidence of heart failure.20 However, some studies have shown that the left ventricular end-diastolic pressure may be increased and both +dP/dt and –dP/dt could be depressed at this stage.20 Systolic [Ca2+]i also was shown to be slightly but significantly lower and diastolic [Ca2+]i higher in post-MI myocytes.21 The molecular and biochemical bases of these alterations are not known. The present study was designed to investigate possible defects in the ß-adrenergic receptor–Gs/i protein–adenylyl cyclase–cAMP–protein kinase A (PKA)–phosphatase pathway as well as molecular or functional alterations of SERCA2 and PLB at the stage of compensated hypertrophy of the post-MI rat heart. These data may provide insight into the nature of early alterations associated with the attempt of the heart to adapt to an increased workload and the possible negative consequences of some of these adaptive mechanisms.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Materials
Anti-G
s and
-Gi polyclonal antibodies were from Santa Cruz
Biotechnology. Anti-SERCA2 monoclonal antibody was from Affinity
Bioreagents, Inc. The polyclonal antibodies PS-16 and PT-17 and
monoclonal antibody A1 were obtained from PhosphoProtein
Research.
Experimental Model
Sprague-Dawley rats weighing 200 to 250 g underwent either
coronary ligation or sham operation as previously
described.22 The rats were studied 3 weeks after
operation. Measurements were made for heart rate; systolic,
diastolic, and mean systemic pressure; and left
ventricular end-diastolic pressure (LVEDP), and
the maximal dP/dt was determined by averaging 10 consecutive
cycles.
Preparation of Isolated Cardiac Myocytes
Ventricular myocytes from adult rats were isolated
by collagenase digestion as described
previously.22 Some of the freshly isolated myocytes from
sham and post-MI rats were preincubated with the phosphodiesterase
(PDE) inhibitor Ro-20-1724 (0.7 mmol/L) alone or plus
isoproterenol (50 nmol/L) or forskolin (1 µmol/L) for 10 minutes
at room temperature, with 1 µg/mL pertussis toxin (PTX) for 3 hours
at 37°C and with 0.5 µmol/L okadaic acid (OA) for 30 minutes
at room temperature.
Radioligand Binding Assay
Cell surface ß-adrenergic receptors were quantified as
previously described.23 24 25
cAMP Determination
The procedure for extraction of cAMP from myocyte suspensions
and cAMP quantitative enzyme immunoassay kit (EIA system) were provided
by Amersham Life Science.
Western Blot Analysis
Myocyte suspensions were briefly spun down, and the pellets were
solubilized in 2x Laemmli buffer.26 Protein concentration
was determined according to Bradford.27
Immunoblot detection was accomplished by following the
manufacturer's instructions (Tropix, Inc, or NEB Labs, Inc).
Preparation of RNA From Ventricular Muscle
Total RNA was extracted from left ventricle using standard
protocol.28
Construction of DNA Templates
DNA templates were prepared by subcloning cDNA fragments into
pCRII (Invitrogen). The cDNA fragments were prepared by reverse
transcriptase–polymerase chain reaction from total cellular RNA
isolated from normal rat heart. For each template, the following
sequences were used as primers: PLB 320 bp (nucleotides 21
to 34029 ) forward, GTCTGCATTGTGACGATCAC, and reverse,
AGGTCTGCGGTGGCGACAGC, and SERCA2 260 bp (nucleotides 2281
to 254030 ) forward, TCCTTTGATGAGATCACAGC, and reverse,
GCCGTCAGGAAGATACAGAC. Internal control used was a cDNA fragment of
cyclophilin31 (nucleotides 38 to 142) from
Ambion.
RNase Protection Assay
RNase protection assays were performed as previously
described.32
Preparation of Left Ventricular Membrane
Vesicles
Membrane vesicles were prepared as described by Neumann et
al.33
Protein Phosphatase Activity Assay
Assays were performed by using manufacturer's protocol (protein
phosphatase assay system, Life Technologies). Phosphatase activity was
measured at 30°C using 32P-labeled
phosphorylase a as substrate.
Tricholoroacetic Acid (TCA) Extraction and Assay of Phosphatase
Inhibitor Activity
TCA extract enriched in phosphatase inhibitors 1 and
2 was isolated from left ventricular
myocardium, and the phosphatase inhibitor
activity in extracts was measured as described by Ahmad et
al.34
Measurement of [Ca2+]i Transient
[Ca2+]i transient
in myocytes from sham and post-MI rats was measured as described by
Spurgeon et al.35 The sampling rate was 5 milliseconds.
Data were not filtered.
Statistical Analysis
Data are expressed as mean±SEM. Comparisons between sham and
post-MI myocardium were performed by Student nonpaired
t test. A value of P<0.05 was accepted as
statistically significant.
An expanded Materials and Methods section is available online at http://www.circresaha.org.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Hemodynamic Characterization
Hemodynamic measurements were taken before the heart was removed. There was no significant difference between sham and post-MI rats regarding heart rate (sham, 319±20 bpm; post-MI, 325±18 bpm), systolic blood pressure (sham, 115±12 mm Hg; post-MI, 112±10 mm Hg), and mean systemic pressure (sham, 105±10 mm Hg; post-MI, 102±9 mm Hg). The +dP/dt was slightly decreased in post-MI rats compared with sham rats, but the difference was not statistically significant (sham, 10 200±1800 mm Hg per second; post-MI, 9100±1500 mm Hg per second). On the other hand, the LVEDP was significantly higher in post-MI compared with sham rats, (sham, 2.6±0.4 mm Hg; post-MI, 6.1±1.3 mm Hg; P<0.05).
ß-Adrenergic Receptor Density
To determine whether changes of ß-adrenergic receptor density
occur in isolated 3-week-post-MI myocytes, receptor binding assays were
performed. Cell-surface ß-adrenergic receptors were quantified using
the hydrophilic ligand [3H]CGP-12177, which
specifically labels cell-surface receptors.23 The binding
data from 5 sham and 5 post-MI rat hearts were analyzed with a
nonlinear least-squares method. The ß-adrenergic receptor density was
significantly increased from 13.6±0.3 to 20.6±0.7
fmol/105 cells (P<0.05) in sham (n=8)
and post-MI (n=8) myocytes, respectively. However, the ß-adrenergic
receptor densities normalized to protein concentrations showed no
significant change between sham and post-MI myocytes (14.0±0.6 fmol/mg
sham versus 13.6±0.9 fmol/mg post-MI; NS). The affinity
(Kd) of the receptor for the
radioligand in the myocytes was also not affected after MI
(41.2±2.3 pmol sham versus 38.9±2.1 pmol post-MI; NS).
Gi and Gs Protein Densities
Figure 1
shows results of Western
blot analysis of Gi and
Gs protein levels. Compared with sham,
Gi immunoreactivity was significantly
increased by 55% (P<0.03, n=8), whereas
Gs protein level was found unchanged in
3-week-post-MI myocytes.
|
Adenylyl Cyclase Activity
The cAMP EIA system was used to measure the cAMP contents in
myocytes with or without stimulation. The basal activity of adenylyl
cyclase was unmodified, being 4.2±0.3 (n=8) pmol cAMP per mg protein
in sham and 4.3±0.3 (n=8) units in post-MI (Figure 2) myocytes. Figure 2 also shows
no change in cAMP concentration in post-MI (n=8) compared with sham
(n=8) myocytes after inhibition of PDE by Ro-20-1724 (5.8±0.4 sham
versus 6.1±0.5 pmol/mg post-MI), Ro-20-1724 plus isoproterenol
(12.3±1.6 sham versus 11.3±1.7 pmol/mg post-MI), or Ro-20-1724 plus
forskolin (416±22 sham versus 440±30 pmol/mg post-MI) for 10
minutes.
|
PLB and SERCA2 mRNAs Levels
Figure 3 shows the results of RNase
protection assay of PLB and SERCA2 gene expression in sham as well as
post-MI myocardium. Compared with sham, both PLB and SERCA2
mRNA levels showed no significant difference in post-MI
myocardium.
|
PLB and SERCA2 Protein Levels
Figure 4 shows the results of
Western blot of PLB and SERCA2 protein levels in sham and post-MI
myocardium. No significant difference was found between
sham and post-MI in the protein levels of PLB or SERCA2.
|
PLB Phosphorylation
Figure 5 compares the level of
phosphorylated PLB and total PLB in sham and post-MI
myocytes. The antibody p-16 that recognizes
phosphorylated Ser16 in PLB, which is known to be the
main phosphorylation site by PKA, was used. After a
second antibody and luminescent detection, the membrane was stripped
and relabeled with antibody A1, which recognizes total PLB (Figure 5A). There was no change in the level of total PLB, but there
was a 76% (P<0.05, n=6) decrease in the basal level of
p16-PLB in post-MI myocytes. The level of p16-PLB was only slightly
corrected by Ro-20-1724 alone. However, the addition of forskolin or
isoproterenol increased the p16-PLB in post-MI to the same level as
sham (Figure 5B). Similarly, the basal level of p17-PLB was also
found to be significantly decreased (51%, P<0.05) in
post-MI (n=6) compared with sham myocytes (n=6), and the addition of
forskolin or isoproterenol increased the p17-PLB level in post-MI to
the same level as in sham (Figure 6).
Taken together, these results further support the intact function in
dissociated myocytes.
|
|
Phosphatase Activities
Activators of phosphatases can
dephosphorylate PLB and exert a negative inotropic
effect.36 Type 1 and 2A phosphatases are the main
phosphatases of the myocardium,37 and both
phosphatases can dephosphorylate PLB.38
We, therefore, compared phosphatase 1 and 2A activities in membrane
vesicle preparations from sham and post-MI rat left ventricles. Figure 7A shows the results of assays of
protein phosphatase activities using radiolabeled
phosphorylase a as substrate. Types 1 and 2A
were differentiated in the presence of 10 nmol/L
OA.39 The type 1 phosphatase activity was
significantly increased by 32% in post-MI compared with sham myocytes
(P<0.05, n=6), and there was no change in the type 2A
phosphatase activity (Figure 7A). Figure 7B demonstrates
that the acid extract enriched in phosphatase inhibitors 1
and 2 showed no difference in inhibition of purified phosphatase 1
activity.
|
Effects of Gi Protein, PDE, and Protein Phosphatase on
Phosphorylation of PLB
We used PTX, Ro-20-1724, and 0.5 µmol/L OA to block
Gi protein, PDE, and protein phosphatase
activities, respectively, to study their effects on the levels of
p16-PLB and p17-PLB in 3-week-post-MI myocytes. The results of these
experiments are illustrated in Figures 8 and 9. In Figure 8, OA alone or in
combination with Ro-20-1724 significantly increased the level of
p16-PLB in post-MI myocytes by 2.3 to 8.4 times the basal level
(P<0.05, n=6), respectively. Lesser changes were seen with
PTX alone or PTX plus Ro-20-1724. Figure 9 shows that OA alone
as well as in combination with Ro-20-1724 significantly increased the
p17-PLB in post-MI myocytes by 10 times. Lesser effects were also seen
with PTX plus Ro-20-1724. No significant changes were found in both
p16- and p17-PLB levels when a low dose of OA (10 nmol/L) was used
(data not shown).
|
|
[Ca2+]i Transient in Sham and
Post-MI Myocytes
We further compared the changes of
[Ca2+]i transient in sham
and post-MI myocytes before and after incubation with 10 nmol/L and
0.5 µmol/L of OA. Figure 10
shows transients recorded from a sham and a post-MI myocyte before
and after incubation with OA. Data from 6 sham (n=17 cells) and 6
post-MI (n=24 cells) myocyte preparations are summarized in the
Table. Half time of relaxation
(T50) was found significantly prolonged in
post-MI myocytes compared with sham myocytes (P<0.005).
After a 30-minute incubation with 0.5 µmol/L of OA,
T50 of the relaxation time significantly
shortened in post-MI myocytes (P<0.01) but remained
prolonged compared with sham myocytes. On the other hand, OA had no
significant effect on T50 of sham myocytes. Also,
no significant change of T50 was found in post-MI
myocytes after incubation of 10 nmol/L of OA compared with before
OA.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Three weeks after MI, the heart is in a compensated stage with remodeled hypertrophy of noninfarcted myocardium. However, abnormalities of the diastolic function could be detected in vivo as increased LVEDP20 and in vitro as an increased diastolic [Ca2+]i.21 Our findings of prolonged relaxation of the Ca2+ transient in post-MI remodeled myocytes is consistent with those observations and suggest a reduced SERCA2 activity.12 We have shown that the reduction in SERCA2 activity at this stage was not a result of altered gene expression and protein levels of SERCA2 and its regulatory protein PLB, but it was a result of decreased basal levels of both p16-PLB and p17-PLB. A recent study has shown that phosphorylation of Ser16 is a prerequisite for Thr17 phosphorylation in PLB, and prevention of phosphoserine formation results in attenuation of the ß-agonist stimulatory responses in the mammalian heart.40 Reduced p-PLBs are expected to increase the inhibitory effect of PLB on SERCA2. In principle, the reduction in p-PLBs can result either from a diminished cAMP content or an increased activity of protein phosphatases. We have shown that the reduced p-PLBs were not caused by significant abnormalities of the ß-adrenergic receptor–G protein–adenylyl cyclase–cAMP–PKA complex, because stimulation of ß-adrenergic receptor, Gs protein, or adenylyl cyclase could increase the level of p-PLBs in post-MI myocytes to the same level as in sham myocytes. Further, no changes were found in the ß-adrenergic receptor density, Gs
protein expression level, and
adenylyl cyclase activity. Our findings that Gi
protein level was significantly increased in 3-week-post-MI
myocardium and that PTX, in combination with Ro-20-1724,
can slightly but significantly increase the PLB
phosphorylation levels indicated that an increased
Gi level may play a role in post-MI hypertrophied
myocardium. Gi protein was found to
be increased in rat heart as early as 4 weeks after MI,41
in pacing-induced heart failure in dogs,42 and in human
heart failure.43 An increased Gi
protein level could alter activity of the catalytic subunit of adenylyl
cyclase and result in an increased level of inhibition of adenylyl
cyclase activity. Further, Gi protein stimulation
could enhance phosphatase activity via
inhibitor-1.44 45 Our results seem to support
the latter mechanism, given that we found no change in adenylyl cyclase
activity in post-MI compared with sham myocytes. However, the slight
but significant increase of p-PLB levels in post-MI myocytes after
incubating with PTX suggests that, besides Gi
protein alteration, additional defects exist in post-MI myocytes. Our results strongly suggest that the decreased basal p16-PLB and p17-PLB levels in our animal model were mainly a result of the enhanced activity of type 1 phosphatase that dephosphorylates p16-PLB and p17-PLB. Type 1 phosphatase has been reported to be capable of dephosphorylating membrane-associated PLB when it is phosphorylated by PKA.38 46 47 Further evidence that supports this hypothesis is our finding that 0.5 µmol/L of OA, a protein phosphatase inhibitor, dramatically increased p16-PLB as well as p17-PLB levels in post-MI myocytes. This is one more indication that the PLB phosphorylation process in compensated post-MI myocardium is essentially normal. The same dose of OA also partially corrected the prolonged relaxation of the Ca2+ transient. However, PLB is only one of the phosphoproteins contributing to the accelerated relaxation of the Ca2+ transient.
It is important to emphasize the advantage of the use of dissociated myocytes rather than myocardial homogenates in the study of the ß-adrenergic receptor–Gs/i protein–adenylyl cyclase–cAMP–PKA pathway in the post-MI remodeled hypertrophied myocardium. Tissue homogenates inevitably include other cell types besides myocytes. This is especially important when comparing normal and diseased myocardium, because nonmyocyte structures are also altered after MI.48 Further, using hydrophilic radioactive probe in ß-adrenergic receptor binding assays on isolated myocytes would allow the quantification of receptor density exclusively on the extracellular membrane of intact cell, an effective approach to compare diseased and normal myocardium.24
The role of PLB in the regulation of basal myocardial contractility has been recently elucidated through the generation of a PLB-deficient mouse model.49 Ablation of PLB was associated with a significant increase in intraventricular pressure and in the rates of contraction and relaxation, assessed in isolated work-performing heart preparations.49 The elevated contractile parameters in PLB-deficient hearts could not be further stimulated with isoproterenol.49 These findings demonstrated that PLB is a repressor of left ventricular basal contractile parameters, and alterations in the levels of PLB would be expected to result in alterations in myocardial contractility. The rates of phosphorylation/dephosphorylation reactions on PLB appear to be faster than those of other phosphoproteins. PLB has been shown to be phosphorylated in vivo, and the resulting stimulatory effects on SR Ca2+ transport have been suggested to be a prominent mediator of the ß-adrenergic responses in the mammalian heart.50 51 52 The function of PLB during catecholamine stimulation of the heart suggests a role for this protein as an internal "brake mechanism."53 Ser16 of PLB is the first and main site to be phosphorylated in response to an increase in cAMP levels during ß-agonist administration, followed by an increase in the activity of the cardiac SR Ca2+ transport system and increased rate of cardiac relaxation.51 54 55
In addition to phosphorylation of PLB, myocardial SR possesses phosphatase activity capable of dephosphorylating PLB. SR-associated "PLB phosphatase" has been shown to be inhibited by inhibitor-1,46 which is very similar to protein phosphatase 1.38 46 In addition to activation of PKA through augmentation of cAMP, ß-agonist may also exert its effect on augmenting cardiac contractility by phosphorylation of protein phosphatase inhibitor-1.56 A decrease in type 1 protein phosphatase activity through phosphorylation of phosphatase inhibitor-1 is expected to further augment the effects of ß-agonist. Our findings that isoproterenol and forskolin can increase both p16-PLB and p17-PLB levels in post-MI myocytes to the same levels in sham could be explained by their inhibitory effects on phosphatases by phosphorylating protein phosphatase inhibitor-1.
In summary, the present study has shown that alterations in diastolic function develop much earlier in the post-MI remodeled rat heart and well before the onset of overt heart failure. The prolonged relaxation of post-MI remodeled myocytes was due to decreased basal levels of both p16- and p17-PLB. The latter could be explained, in part, by increased type 1 protein phosphatase activity. However, other factors, including increase of Gi, could also be involved.
|
Acknowledgments |
|---|
This work was supported by Veteran Affairs Medical Research Funds (in part by VA MERIT grant to N.E.-S.).
Received July 30, 1999; accepted August 19, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Anversa P, Beghi C, Kikkawa Y, Olivetti G. Myocardial infarction in rats. Infarct size, myocyte hypertrophy, and capillary growth. Circ Res. 1986;58:26–37.
2.
Pfeffer JM, Pfeffer MA, Fletcher PJ, Braunwald E.
Progressive ventricular remodeling in rat with myocardial
infarction. Am J Physiol. 1991;260:H1406–H1414.
3. Swynghedauw B, ed. Cardiac Hypertrophy and Failure. Paris, France: INSERM/John Libbey; 1990.
4. Gidh-Jain M, Huang B, Jain P, Gick G, El-Sherif N. Alterations in cardiac gene expression during ventricular remodeling following experimental myocardial infarction. J Mol Cell Cardiol. 1998;30:627–637.[Medline] [Order article via Infotrieve]
5. Morgan JP. Abnormal intracellular modulation of calcium as a major cause of cardiac contractile dysfunction. N Engl J Med. 1991;325:625–632.[Medline] [Order article via Infotrieve]
6.
Gwathmey JK, Copelas L, MacKinnon R, Schoen FJ,
Feldman MD, Grossman W, Morgan JP. Abnormal intracellular calcium
handling in myocardium from patients with end-stage heart
failure. Circ Res. 1987;61:70–76.
7. del Monte F, O'Gara P, Poole-Wilson PA, Yacoub M, Harding SE. Cell geometry and contractile abnormalities of myocytes from failing human left ventricle. Cardiovasc Res. 1995;30:281–290.[Medline] [Order article via Infotrieve]
8.
Davies CH, Harding SE, Poole-Wilson PA. Cellular
mechanisms of contractile dysfunction in human heart failure. Eur
Heart J. 1996;17:189–198.
9.
Hicks MJ, Shigekawa M, Katz AM. Mechanism by which
cyclic adenosine 3':5'-monophosphate-dependent protein kinase
stimulates calcium transport in cardiac sarcoplasmic reticulum.
Circ Res. 1979;44:384–391.
10.
Kim HW, Steenaart NAE, Ferguson DG, Kranias EG.
Functional reconstitution of the cardiac sarcoplasmic reticulum
Ca2+-ATPase with phospholamban in phospholipid
vesicle. J Biol Chem. 1990;265:1702–1709.
11.
Feldman AM, Ray PE, Silan CM, Mercer JA, Minobe W,
Bristow MR. Selective gene expression on failing human heart:
quantification of steady-state levels of messenger RNA in
endomyocardial biopsies using the polymerase chain
reaction. Circulation. 1991;83:1866–1872.
12. Mercadier J-J, Lompré AM, Duc P, Boheler KR, Fraysse J-B, Wisnewsky C, Allen PD, Komajda M, Schwartz K. Altered sarcoplasmic reticulum Ca2+-ATPase gene expression in the human ventricle during end-stage heart failure. J Clin Invest. 1990;85:305–309.
13.
Arai M, Alpert NR, MacLennan DH, Barton P, Periasamy M.
Alterations in sarcoplasmic reticulum gene expression in human heart
failure: a possible mechanism for alterations in systolic and
diastolic properties of the failing myocardium.
Circ Res. 1992;72:463–469.
14. Zarain-Herzberg A, Afzal N, Elimban V, Dhalla NS. Decreased expression of cardiac sarcoplasmic reticulum Ca(2+)-pump ATPase in congestive heart failure due to myocardial infarction. Mol Cell Biochem. 1996;163–164:285–290.
15.
Hasenfuss G, Reinecke H, Studer R, Meyer M, Pieske B,
Holtz J, Holubarsch C, Posival H, Just H, Drexler H. Relation between
myocardial function and expression of sarcoplasmic reticulum
Ca2+-ATPase in failing and nonfailing human
myocardium. Circ Res. 1994;75:434–442.
16.
Movsesian MA, Karimi M, Green K, Jones LR.
Ca2+-transporting ATPase, phospholamban and
calsequestrin levels in nonfailing and failing human heart.
Circulation. 1994;90:653–657.
17. Linck B, Bokník P, Eschenhagen T, Müller FU, Neumann J, Nose M, Jones LR, Schmitz W, Scholz H. Messenger RNA expression and immunological quantification of phospholamban and SR-Ca2+-ATPase in failing and nonfailing human hearts. Cardiovasc Res. 1996;31:625–632.[Medline] [Order article via Infotrieve]
18. Munch G, Bolch B, Hoischen S, Brixius K, Bloch W, Reuter H, Schwinger RH. Unchanged protein expression of sarcoplasmic reticulum Ca2+-ATPase, phospholamban, and calsequestrin in terminally failing human myocardium. J Mol Med. 1998;76:434–441.[Medline] [Order article via Infotrieve]
19.
Schwinger RH, Bohm M, Schmidt U, Karczewski P,
Bavendiek U, Flesch M, Krause EG, Erdmann E. Unchanged protein levels
of SERCA II and phospholamban but reduced Ca2+
uptake and Ca(2+)-ATPase activity of cardiac sarcoplasmic reticulum
from dilated cardiomyopathy patients compared with
patients with nonfailing hearts. Circulation. 1995;92:3220–3228.
20. Pfeffer JM, Pfeffer MA, Fletcher PJ, Braunwald E. Ventricular performance in rats with myocardial infarction and failure. Am J Med. 1984;76:99–103.[Medline] [Order article via Infotrieve]
21.
Zhang XQ, Moore RL, Tenhave T, Cheung JY.
[Ca2+]i transients in
hypertensive and postinfarction myocytes. Am J Physiol. 1995;269:C632–C640.
22.
Qin D, Zhang ZH, Caref EB, Boutjdir M, Jain P,
El-Sherif N. Cellular and ionic basis of arrhythmias in
postinfarction remodeled ventricular
myocardium. Circ Res. 1996;79:461–473.
23. Stachelin M, Hertel C. [3H]CGP-12177, a beta-adrenergic ligand suitable for measuring cell surface receptors. J Recept Res. 1983;3:35–43.[Medline] [Order article via Infotrieve]
24. Horackova M, Wilkinson M. Characterization of cell-surface ß-adrenergic ([3H]CGP-12177) binding in adult rat ventricular myocytes: lack of regulation by ß-agonists at physiological concentrations. Pflügers Arch. 1992;421:440–446.
25. Munson PJ, Rodbard D. Ligand, a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem. 1980;107:220–239.[Medline] [Order article via Infotrieve]
26. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685.[Medline] [Order article via Infotrieve]
27. Bradford MM. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254.[Medline] [Order article via Infotrieve]
28. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]
29. Hwang KS, Nadal-Ginard B. Cloning phospholamban cDNA from rat aortic smooth muscle. Adv Exp Med Biol. 1991;304:387–395.[Medline] [Order article via Infotrieve]
30. Lompré AM, de la Bastie D, Boheler KR, Schwartz K. Characterization and expression of the rat heart sarcoplasmic reticulum Ca2+-ATPase mRNA. FEBS Lett. 1989;249:35–41.[Medline] [Order article via Infotrieve]
31. Danielson P, Forss-Petter S, Brow M, Calavette L, Douglass J, Milner R, Sutcliffe J. p1B15: a cDNA clone of the rat mRNA encoding cyclophilin. DNA. 1988;7:261–267.[Medline] [Order article via Infotrieve]
32.
Gidh-Jain M, Huang B, Jain P, El-Sherif N. Differential
expression of voltage-gated K+ channel genes in
left ventricular remodeled myocardium after
experimental myocardial infarction. Circ Res. 1996;79:669–675.
33.
Neumann J, Gupta RC, Schmitz W, Scholz H, Nairn AC,
Watanabe AM. Evidence for isoproterenol-induced
phosphorylation of phosphatase inhibitor-1
in the intact heart. Circ Res. 1991;69:1450–1457.
34.
Ahmad Z, Green FJ, Subuhi HS, Watanabe AM. Autonomic
regulation of type 1 protein phosphatase in cardiac muscle.
J Biol Chem. 1989;264:3859–3863.
35.
Spurgeon HA, Stern MD, Baartz G, Raffaeli S, Hansford
RG, Talo A, Lakatta EG, Capogrossi MC. Simultaneous
measurement of Ca2+, contraction, and potential
in cardiac myocytes. Am J Physiol. 1990;258:H574–H586.
36. Zimmermann N, Boknik P, Gams E, Gsell S, Jones LR, Maas R, Neumann J, Scholz H. Mechanisms of the contractile effects of 2,3-butanedione-monoxime in the mammalian heart. Naunyn Schmiedebergs Arch Pharmacol. 1996;354:431–436.[Medline] [Order article via Infotrieve]
37. Wera S, Hemmings BA. Serine/threonine protein phosphatases. Biochem J. 1995;311(Pt 1):17–29.
38. MacDougall LK, Jones LR, Cohen P. Identification of the major protein phosphatases in mammalian cardiac muscle which dephosphorylate phospholamban. Eur J Biochem. 1991;196:725–734.[Medline] [Order article via Infotrieve]
39. Neumann J, Eschenhagen T, Jones LR, Linck B, Schmitz W, Scholz H, Zimmermann N. Increased expression of cardiac phosphatases in patients with end-stage heart failure. J Mol Cell Cardiol. 1997;29:265–272.[Medline] [Order article via Infotrieve]
40.
Luo W, Chu G, Sato Y, Zhou Z, Kadambi VJ, Kranias EG.
Transgenic approaches to define the functional role of dual site
phospholamban phosphorylation. J Biol
Chem. 1998;273:4734–4739.
41. Kompa AR, Gu Xh, Evans BA, Summers RJ. Desensitization of cardiac beta-adrenoceptor signaling with heart failure produced by myocardial infarction in the rat: evidence for the role of Gi but not Gs or phosphorylating proteins. J Mol Cell Cardiol. 1999;31:1185–1201.[Medline] [Order article via Infotrieve]
42.
Vatner DE, Sato N, Galper JB, Vatner SF.
Physiological and biochemical evidence for
coordinate increases in muscarinic receptors and
Gi during pacing-induced heart failure.
Circulation. 1996;94:102–107.
43. Feldman AM, Cates AE, Veazey WB, Hershberger RE, Bristow MR, Baughman KL, Baumgartner WA, Van Dop C. Increase of the 40,000-mol wt pertussis toxin substrate (G protein) in the failing human heart. J Clin Invest. 1988;82:189–197.
44. Gupta RC, Neumann J, Watanabe AM, Sabbah HN. Muscarinic-cholinoceptor mediated attenuation of phospholamban phosphorylation induced by inhibition of phosphodiesterase in ventricular cardiomyocytes: evidence against a cAMP-dependent effect. Mol Cell Biochem. 1998;187:155–161.[Medline] [Order article via Infotrieve]
45.
Gupta RC, Neumann J, Watanabe AM. Comparison of
adenosine and muscarinic receptor-mediated effects on protein
phosphatase inhibitor-1 activity in the heart. J
Pharmacol Exp Ther. 1993;266:16–22.
46. Steenart NAE, Ganim JR, Di Salvo JD, Kranias EG. The phospholamban phosphatase associated with cardiac sarcoplasmic reticulum is a type 1 enzyme. Arch Biochem Biophys. 1991;297:17–24.
47. Sulakhe PV, Vo XT, Morris TE, Pato MD, Khandelwal RL. Protein phosphorylation in rat cardiac microsomes: effects of inhibitors of protein kinase A and of phosphatases. Mol Cell Biochem. 1997;175:109–115.[Medline] [Order article via Infotrieve]
48. Yamamoto J, Ohyanagi M, Morita M, Iwasaki T. Beta-adrenoceptor-G protein-adenylate cyclase complex in rat hearts with ischemic heart failure produced by coronary artery ligation. J Mol Cell Cardiol. 1994;26:617–626.[Medline] [Order article via Infotrieve]
49.
Luo W, Grupp IL, Harrer J, Ponniah S, Grupp G, Duffy
JJ, Doetschman T, Kranias EG. Targeted ablation of the phospholamban
gene is associated with markedly enhanced myocardial
contractility and loss of ß-agonist stimulation.
Circ Res. 1994;75:401–409.
50. Kranias EG, Solaro RJ. Phosphorylation of troponin I and phospholamban during catecholamine stimulation of rabbit heart. Nature. 1982;298:182–184.[Medline] [Order article via Infotrieve]
51.
Lindemann JP, Jones LR, Hathaway DR, Henry BG, Watanabe
AM. ß-Adrenergic stimulation of phospholamban
phosphorylation and Ca2+-ATPase
activity in guinea pig ventricles. J Biol Chem. 1983;258:464–471.
52.
Wegner AD, Simmerman HKB, Lindemann JP, Jones LR.
Phospholamban phosphorylation in intact ventricles.
J Biol Chem. 1989;264:11468–11474.
53.
Koss KL, Kranias EG. Phospholamban: a prominent
regulator of myocardial contractility. Circ
Res. 1996;79:1059–1063.
54. Mundina de Weilenmann C, Vittone L, deCingolani G, Mattiazi A. Dissociation between contraction and relaxation: the possible role of phospholamban phosphorylation. Basic Res Cardiol. 1987;82:507–516.[Medline] [Order article via Infotrieve]
55. Garvey JL, Kranias EG, Solaro RJ. Phosphorylation of C-protein, troponin I and phospholamban in isolated rabbit hearts. Biochem J. 1988;249:709–714.[Medline] [Order article via Infotrieve]
56. Gupta RC, Neumann J, Watanabe AM, Lesch M, Sabbah HN. Evidence for presence and hormonal regulation of protein phosphatase inhibitor-1 in ventricular cardiomyocyte. Am J Physiol. 1996;270(4 pt 2):H1159–H1164.
This article has been cited by other articles:
 |
|
 |
|
  M. Brini and E. Carafoli Calcium Pumps in Health and Disease Physiol Rev, October 1, 2009; 89(4): 1341 - 1378. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Yu, Z.-H. Wang, and H.-T. Yang Calcium/calmodulin-dependent protein kinase II mediates cardioprotection of intermittent hypoxia against ischemic-reperfusion-induced cardiac dysfunction Am J Physiol Heart Circ Physiol, August 1, 2009; 297(2): H735 - H742. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ikeda, M. Hoshijima, and K. R. Chien Toward Biologically Targeted Therapy of Calcium Cycling Defects in Heart Failure Physiology, February 1, 2008; 23(1): 6 - 16. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Bito, F. R. Heinzel, L. Biesmans, G. Antoons, and K. R. Sipido Crosstalk between L-type Ca2+ channels and the sarcoplasmic reticulum: alterations during cardiac remodelling Cardiovasc Res, January 15, 2008; 77(2): 315 - 324. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X.-Y. Zhao, S.-J. Hu, J. Li, Y. Mou, K. Bian, J. Sun, and Z.-H. Zhu rAAV-asPLB transfer attenuates abnormal sarcoplasmic reticulum Ca2+-ATPase activity and cardiac dysfunction in rats with myocardial infarction Eur J Heart Fail, January 1, 2008; 10(1): 47 - 54. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Nattel, A. Maguy, S. Le Bouter, and Y.-H. Yeh Arrhythmogenic Ion-Channel Remodeling in the Heart: Heart Failure, Myocardial Infarction, and Atrial Fibrillation Physiol Rev, April 1, 2007; 87(2): 425 - 456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. El-Armouche, P. Boknik, T. Eschenhagen, L. Carrier, M. Knaut, U. Ravens, and D. Dobrev Molecular Determinants of Altered Ca2+ Handling in Human Chronic Atrial Fibrillation Circulation, August 15, 2006; 114(7): 670 - 680. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Yamada, Y. Ikeda, M. Yano, K. Yoshimura, S. Nishino, H. Aoyama, L. Wang, H. Aoki, and M. Matsuzaki Inhibition of protein phosphatase 1 by inhibitor-2 gene delivery ameliorates heart failure progression in genetic cardiomyopathy FASEB J, June 1, 2006; 20(8): 1197 - 1199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mattiazzi, C. Mundina-Weilenmann, C. Guoxiang, L. Vittone, and E. Kranias Role of phospholamban phosphorylation on Thr17 in cardiac physiological and pathological conditions Cardiovasc Res, December 1, 2005; 68(3): 366 - 375. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. R. Sipido and D. Eisner Something old, something new: Changing views on the cellular mechanisms of heart failure Cardiovasc Res, November 1, 2005; 68(2): 167 - 174. [Full Text] [PDF]
|
|
|
|
|
|
Y. Xie, Y. Zhu, W.-Z. Zhu, L. Chen, Z.-N. Zhou, W.-J. Yuan, and H.-T. Yang Role of dual-site phospholamban phosphorylation in intermittent hypoxia-induced cardioprotection against ischemia-reperfusion injury Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2594 - H2602. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-H. Chen, C. J. Baty, T. Maeda, S. Brooks, L. C. Baker, T. Ueyama, E. Gursoy, S. Saba, G. Salama, B. London, et al. Transcription Enhancer Factor-1-Related Factor-Transgenic Mice Develop Cardiac Conduction Defects Associated With Altered Connexin Phosphorylation Circulation, November 9, 2004; 110(19): 2980 - 2987. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Zhang, S. Miyamoto, and J. H. Brown Cardiomyocyte Calcium and Calcium/Calmodulin-dependent Protein Kinase II: Friends or Foes? Recent Prog. Horm. Res., January 1, 2004; 59(1): 141 - 168. [Abstract] [Full Text]
|
|
|
|
|
|
M. Zheng, K. Dilly, J. Dos Santos Cruz, M. Li, Y. Gu, J. A. Ursitti, J. Chen, J. Ross Jr., K. R. Chien, J. W. Lederer, et al. Sarcoplasmic reticulum calcium defect in Ras-induced hypertrophic cardiomyopathy heart Am J Physiol Heart Circ Physiol, January 1, 2004; 286(1): H424 - H433. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. C. Gupta, S. Mishra, S. Rastogi, M. Imai, O. Habib, and H. N. Sabbah Cardiac SR-coupled PP1 activity and expression are increased and inhibitor 1 protein expression is decreased in failing hearts Am J Physiol Heart Circ Physiol, December 1, 2003; 285(6): H2373 - H2381. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. B. Margulies Blocking Stretch-Induced Myocardial Remodeling Circ. Res., November 28, 2003; 93(11): 1020 - 1022. [Full Text] [PDF]
|
|
|
|
|
|
H. N. Sabbah, V. G. Sharov, R. C. Gupta, S. Mishra, S. Rastogi, A. I. Undrovinas, P. A. Chaudhry, A. Todor, T. Mishima, E. J. Tanhehco, et al. Reversal of Chronic Molecular and Cellular Abnormalities Due to Heart Failure by Passive Mechanical Ventricular Containment Circ. Res., November 28, 2003; 93(11): 1095 - 1101. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F R Quinn, S Currie, A M Duncan, S Miller, R Sayeed, S M Cobbe, and G L Smith Myocardial infarction causes increased expression but decreased activity of the myocardial Na+--Ca2+ exchanger in the rabbit J. Physiol., November 15, 2003; 553(1): 229 - 242. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Terentyev, S. Viatchenko-Karpinski, I. Gyorke, R. Terentyeva, and S. Gyorke Protein Phosphatases Decrease Sarcoplasmic Reticulum Calcium Content by Stimulating Calcium Release in Cardiac Myocytes J. Physiol., October 1, 2003; 552(1): 109 - 118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Mishra, H. N. Sabbah, J. C. Jain, and R. C. Gupta Reduced Ca2+-calmodulin-dependent protein kinase activity and expression in LV myocardium of dogs with heart failure Am J Physiol Heart Circ Physiol, March 1, 2003; 284(3): H876 - H883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. ISODA, N. PAOLOCCI, K. HAGHIGHI, C. WANG, Y. WANG, D. GEORGAKOPOULOS, G. SERVILLO, M. A. DELLA FAZIA, E. G. KRANIAS, A. A. DEPAOLI-ROACH, et al. Novel regulation of cardiac force-frequency relation by CREM (cAMP response element modulator) FASEB J, February 1, 2003; 17(2): 144 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Sjaastad, J A. Wasserstrom, and O. M Sejersted Heart failure - a challenge to our current concepts of excitation-contraction coupling J. Physiol., January 1, 2003; 546(1): 33 - 47. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. El-Adawi, L. Deng, A. Tramontano, S. Smith, E. Mascareno, K. Ganguly, R. Castillo, and N. El-Sherif The functional role of the JAK-STAT pathway in post-infarction remodeling Cardiovasc Res, January 1, 2003; 57(1): 129 - 138. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Sjaastad, J. Bokenes, F. Swift, J. A. Wasserstrom, and O. M. Sejersted Normal contractions triggered by ICa,L in ventricular myocytes from rats with postinfarction CHF Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H1225 - H1236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. N. Carr, A. G. Schmidt, Y. Suzuki, F. del Monte, Y. Sato, C. Lanner, K. Breeden, S.-L. Jing, P. B. Allen, P. Greengard, et al. Type 1 Phosphatase, a Negative Regulator of Cardiac Function Mol. Cell. Biol., June 15, 2002; 22(12): 4124 - 4135. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. B Sande, I. Sjaastad, I. B Hoen, J. Bokenes, T. Tonnessen, E. Holt, P. K Lunde, and G. Christensen Reduced level of serine16 phosphorylated phospholamban in the failing rat myocardium: a major contributor to reduced SERCA2 activity Cardiovasc Res, February 1, 2002; 53(2): 382 - 391. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. C. Prahash, S. Gupta, and I. S. Anand Myocyte Response to {beta}-Adrenergic Stimulation Is Preserved in the Noninfarcted Myocardium of Globally Dysfunctional Rat Hearts After Myocardial Infarction Circulation, October 10, 2000; 102(15): 1840 - 1846. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gupta, A. J.C Prahash, and I. S Anand Myocyte contractile function is intact in the post-infarct remodeled rat heart despite molecular alterations Cardiovasc Res, October 1, 2000; 48(1): 77 - 88. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Zhang, E. N. Johnson, Y. Gu, M. R. Morissette, V. P. Sah, M. S. Gigena, D. D. Belke, W. H. Dillmann, T. B. Rogers, H. Schulman, et al. The Cardiac-specific Nuclear delta B Isoform of Ca2+/Calmodulin-dependent Protein Kinase II Induces Hypertrophy and Dilated Cardiomyopathy Associated with Increased Protein Phosphatase 2A Activity J. Biol. Chem., January 4, 2002; 277(2): 1261 - 1267. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||